PCR Primer Pair Tm and Template Annealing Inspection
Inspect a primer pair against the retained J01636.1 template window using the existing nearest-neighbour thermodynamic calculation and exact template matching. The reference keeps salt and oligo concentrations explicit. A calculated melting temperature is not a validated PCR annealing temperature, and exact matches within one template do not establish genome-wide specificity.
Forward CCAGCCACGTTTCTGCGAAA and reverse TGCGCGAGAAGATTGTGCAC, with the retained 600-base template. Inputs use 250 nM oligo, 50 mM Na+, zero Mg2+ and zero dNTP, primer-excess concentration convention and the existing Owczarzy 2004 monovalent correction.
Keep annealing sequence and template orientation distinct
A forward primer is compared with the appropriate template strand, while a reverse primer is interpreted through its reverse complement. Simply finding both written strings in the forward template is not the same as identifying an inward-facing PCR pair. Inspect the positions and orientation of the matched sites and retain the topology of the supplied template.
The reference pair comes from a retained independent worked case rather than a pair selected to make an attractive display. The template interval and primer strings are preserved. If you edit a primer or add a tail, the resulting construct is a new input and should be reviewed under the relevant annealing-sequence and product rules. The original expected values no longer describe an altered pair.
Compare thermodynamic results under matched assumptions
Nearest-neighbour calculations sum sequence-dependent contributions and apply conventions for concentration, initiation and symmetry. Salt corrections then account approximately for ionic conditions within a stated domain. Changing the correction or assuming equal strands in place of primer excess can change the result without any change to the DNA sequence.
Record sodium, magnesium and dNTP inputs as well as the oligo concentration. A nominal buffer label is not necessarily enough to reproduce the effective ionic conditions. Where the model marks extrapolation or refuses an input, preserve that qualification. Use independent experimental optimisation for the final PCR conditions, and keep any genome-wide specificity assessment separate from the exact local template check shown here.
Equations and variables
Nearest-neighbour melting relationship
Tm = ΔH/(ΔS + R ln(Ceff)) − 273.15, with the selected salt correction
- Tm
- Calculated duplex melting temperature (°C)
- ΔH, ΔS
- Summed nearest-neighbour enthalpy and entropy with method-specific terms
- R
- Gas constant in units consistent with the thermodynamic parameters
- Ceff
- Effective oligo concentration under the stated strand convention
Inclusive sequence interval
L = end − start + 1
- L
- Length of a non-wrapping interval (nt)
- start, end
- One-based inclusive coordinates on the stated reference sequence
Scope and limitations
- The 50 mM monovalent condition is below the original fitted range stated for the correction and retains the existing extrapolation qualification.
- Exact template matching is restricted to the supplied sequence. It does not search a genome or predict mismatch extension by a polymerase.
- Tails, modified bases, secondary structure and reaction additives require appropriate treatment. A Tm value alone does not determine an optimised cycling programme.
Sources and provenance
- GenBank E. coli lac operon J01636.1Existing source notice: NCBI public domain
- Independent primer-pair worked referenceOriginal reference calculations on cited sequence inputs
- SantaLucia: unified view of DNA nearest-neighbour thermodynamicsArticle citation; method parameters documented by the existing implementation
- Owczarzy et al.: effects of sodium ions on DNA duplex stabilityArticle citation; existing correction method
Technical questions
Is the reported Tm my PCR annealing temperature?
No. Tm describes a modelled duplex equilibrium under specified assumptions. PCR annealing also depends on polymerase chemistry, buffer, cycling conditions and the experiment. Use the calculation as one input to protocol design and optimisation rather than an automatically validated temperature setting.
Why must oligo and salt concentrations be specified?
The thermodynamic relationship and salt correction depend on those conditions. The same sequence can receive different Tm values under different assumptions. Retain concentration units, strand convention and correction method with comparisons so a difference is not mistaken for a sequence effect.
Do exact forward and reverse matches prove successful amplification?
They establish sequence compatibility within the supplied template under the matching rule. They do not prove polymerase extension, absence of secondary structures or specificity across a genome. An expected product remains a prediction until supported by experimental evidence.
Connected workflows
- qPCR master mix and dead-volume calculation
Plan reagent volumes after defining the actual primer assay.
- SpCas9 NGG PAM-site inspection
Compare local target-site enumeration with specificity claims.
- Type IIS restriction-site inspection
Review how added sequence tails change a cloning design.
- SantaLucia Nearest-Neighbor DNA Tm and Salt Calculator
Inspect the nearest-neighbour Tm of a single oligo with its salt correction.
- PCR Primer Dimer and Hairpin ΔG Inspector for Primer Pairs
Screen a primer pair for hairpins and dimers beside its melting temperatures.
- DNA Oligo Molecular Weight and Nanomole to Microgram Guide
Compute an oligo molecular weight to convert its nanomole yield to mass and volume.