SantaLucia Nearest-Neighbor DNA Tm and Salt Calculator
Compute DNA oligonucleotide melting temperatures from the unified SantaLucia 1998 dinucleotide enthalpy and entropy tables paired with explicit monovalent cation corrections. The interactive reference opens the single-oligo Tm calculation on the forward primer of the verified J01636.1 primer pair, so every dinucleotide step, initiation term, strand concentration convention, and ionic-strength adjustment remains transparent and reproducible.
Uses the pinned forward primer CCAGCCACGTTTCTGCGAAA from the versioned sequence-toolkit verification fixture at 250 nM oligonucleotide, 50 mM Na+, 0 mM Mg2+ and 0 mM dNTP, with the Owczarzy 2004 correction and the primer-excess convention. The fixture records 60.0 °C for this primer; template matching for the pair is on the primer Tm page.
Decompose duplex stability into dinucleotide stacking and terminal initiation
A DNA duplex is stabilized primarily by vertical base-stacking interactions between neighboring base pairs rather than isolated hydrogen bonds. The unified SantaLucia 1998 model partitions a sequence of length N into N − 1 overlapping dinucleotide steps plus two terminal initiation contributions that distinguish terminal G·C pairs from terminal A·T pairs. Because terminal base pairs fray more readily in solution, sequence permutations that share identical base composition can still exhibit measurably different enthalpy and entropy sums.
When inspecting the pre-loaded 20-mer primer from the E. coli lac operon reference window, verify both the summed standard-state ΔH° and ΔS° values and the symmetry penalty before applying ionic corrections. If a sequence is perfectly self-complementary, rotational symmetry reduces the entropy of duplex formation by 1.4 cal K⁻¹ mol⁻¹. Recording the exact parameter set alongside any exported primer specification prevents ambiguity when comparing values across software packages that silently substitute Breslauer 1986 or Sugimoto 1996 tables.
Align ionic strength and strand-excess conventions with experimental buffers
Standard nearest-neighbor parameters are defined at 1.0 M NaCl, pH 7.0, a regime far more concentrated than routine polymerase chain reaction or hybridization buffers. To bridge that gap, the calculator applies the Owczarzy 2004 monovalent correction, which scales reciprocal melting temperature in Kelvin as a quadratic function of ln[Na+] modulated by the oligonucleotide GC fraction. When magnesium and deoxynucleotide triphosphates are present, free divalent cations chelated by dNTPs must be accounted for separately rather than added linearly to monovalent sodium.
Keep the distinction between equilibrium duplex melting and enzymatic primer extension explicit during assay design. Additives such as betaine, dimethyl sulfoxide, formamide, and proprietary polymerase stabilizers shift apparent melting behavior without changing the underlying DNA sequence. Use this thermodynamic baseline to match forward and reverse primer stabilities under explicit salt and concentration assumptions, then confirm amplification specificity and yield empirically across a thermal gradient.
Equations and variables
Two-state nearest-neighbor melting temperature
Tm = ΔH° / (ΔS° + R ln(CT / f)) − 273.15
- Tm
- Two-state duplex transition temperature at half-dissociation (°C)
- ΔH°
- Summed dinucleotide and terminal initiation enthalpy change (cal mol⁻¹)
- ΔS°
- Summed dinucleotide, initiation, and symmetry entropy change (cal K⁻¹ mol⁻¹)
- R
- Universal gas constant (1.9872) (cal K⁻¹ mol⁻¹)
- CT / f
- Effective strand concentration divisor (f = 4 non-self-complementary, f = 1 self-complementary, or primer-excess convention) (mol L⁻¹)
Owczarzy 2004 GC-dependent monovalent salt correction
1 / Tm(Na+) = 1 / Tm(1 M) + (4.29 fGC − 3.95) × 10⁻⁵ ln[Na+] + 9.40 × 10⁻⁶ (ln[Na+])²
- Tm(Na+), Tm(1 M)
- Corrected and standard-state melting temperatures (K)
- fGC
- Fractional guanine-plus-cytosine content of the oligomer
- [Na+]
- Monovalent sodium-equivalent cation molarity (mol L⁻¹)
Scope and limitations
- Two-state thermodynamics assumes an all-or-none transition between single strands and a fully base-paired B-form duplex without intermediate hairpin or bulge states.
- Standard SantaLucia 1998 parameters were fitted at 1 M NaCl; extrapolating below the calibrated monovalent salt domain or omitting divalent magnesium competition introduces systematic offsets.
- Predicted equilibrium melting temperature is a physical duplex property and does not directly equal the optimal kinetic annealing temperature of a specific thermostable polymerase buffer.
Sources and provenance
- GenBank E. coli lac operon J01636.1Existing source notice: NCBI public domain
- SantaLucia 1998 unified nearest-neighbor thermodynamicsArticle citation; published thermodynamic parameter table
- Owczarzy et al. 2004 sodium ion duplex stability scalingArticle citation; empirical salt-correction equation
Technical questions
Why do nearest-neighbor Tm predictions differ from simple 2(A+T) + 4(G+C) Wallace estimates?
The Wallace rule counts only monomer base composition and ignores stacking interactions between adjacent base pairs. Nearest-neighbor models sum the 10 unique dinucleotide step enthalpies and entropies, capturing sequence-order effects such as the difference between 5′-GC-3′ and 5′-CG-3′ stacks as well as strand molarity and salt concentration.
How does the strand concentration divisor change between primer-template annealing and self-complementary duplexes?
When a PCR primer is present in vast molar excess over template DNA, the effective concentration term in the logarithmic denominator reduces to the total primer concentration rather than CT/4. For equimolar non-self-complementary strands CT/4 is used, whereas self-complementary palindromes use CT without division.
Why does the Owczarzy salt correction include a fractional GC term?
GC-rich duplexes experience a slightly different dependence of melting temperature on sodium activity than AT-rich duplexes. The Owczarzy quadratic log-salt expression weights the linear ln[Na+] coefficient by fractional GC content rather than applying a purely sequence-independent entropy offset.
Connected workflows
- Primer-pair Tm and template matching
Inspect primer-pair template matching and product coordinates.
- Six-frame translation and ORF inspection
Verify the coding reading frame spanned by the amplicon.
- qPCR master mix and dead-volume calculation
Calculate master-mix reagent volumes after selecting primers.