PCR Lab

Place primers, step through thermal cycles and follow the DNA fragments you make.

Experimental Klentaq polymerase cutaway with a pink DNA primer, cyan template and gold bound nucleotide analogue and magnesium at its cleft.

A primer is a starting point

Choose a primer arrangement, then step through the cycle. Watch where synthesis starts and which products can build up.

Cycle — / 8Ready

Begin with one DNA duplex longer than the target region.

A representative template pair, not every molecule. In later cycles, templates of different lengths coexist. Polymerase copies beyond the intended target when a template continues past it. Swipe the diagram on a small screen.

0completed cycles

0exact-length duplexes in this ideal model

36 bpintended product, including primer sites

Both primers extend toward the intervening sequence. After the first cycles, products bounded by both primer sites accumulate.

Exact-length single strands first appear in cycle 2; the first duplexes bounded at both ends appear in cycle 3.

Connect the diagram to sequence orientation

Synthetic target, top strand 5′ → 3′:

ACGTACTGACCTGATCGTACGATCGGATCAGTACGA

For the inward pair, forward primer 5′-ACGTACTG-3′; reverse primer 5′-TCGTACTG-3′. The reverse primer is the reverse complement of the right-hand target site.

These shortened 8-base examples explain orientation. They are not practical primer designs.

Teaching scope: one longer linear starting duplex, perfect extension and doubling, eight cycles. This is not a PCR yield predictor or protocol. Real amplification depends on sequence, chemistry and reaction conditions; a mismatch does not invariably block extension.

Loading the experiment…

Quick reference

Choose the region

PCR uses two primers that bind to opposite strands of a DNA template. Their 3′ ends must point into the region to be amplified so extension produces templates for subsequent rounds.

Repeat the cycle

Heating separates the strands. Cooling permits primer annealing, and an extension stage allows a thermostable polymerase to make new DNA. Repeating these stages enriches the target product.

Check the experiment

Primer orientation and complementarity are necessary checks, but they do not establish experimental success. Reaction conditions, template quality and competing products matter. A no-template control helps reveal contamination.

Check your understanding Optional

Which arrangement supports amplification of a bounded region?

Both primers bind the same strand and point the same way.Primers bind opposite strands with their 3′ ends pointing inward.The direction does not matter if the primers are long enough.

At the bench

Move from the teaching template to primer-binding and melting-temperature checks in Sequence.

Open primer checks

Sources and model notes

Structure-based views of resolved experimental coordinates. Cutaways, category colours, camera choices and guided highlights are authored for teaching. Coordinates remain fixed; highlights are not experimental trajectories or simulation outputs.

NHGRI · PCR fact sheet

The purpose and cycling mechanism of PCR.