DNA Oligo Molecular Weight and Nanomole to Microgram Guide
Convert lyophilized oligonucleotide synthesis yields between molar amount (nmol, pmol), mass (µg, ng), and stock resuspension volume (µL for a target µM concentration) using exact base-composition molecular weight rather than a rough 330 Da/nt approximation. The workspace computes that molecular weight for the forward primer of the verified J01636.1 pair; the amount and volume conversions follow from the equations below.
Opens the DNA molecular weight calculation on the 20-nt forward primer CCAGCCACGTTTCTGCGAAA as a neutral free acid with 5′-OH and 3′-OH ends, summed from residue formulas and the IUPAC 2021 atomic weights. The reverse primer TGCGCGAGAAGATTGTGCAC can be pasted for comparison.
Derive exact single-stranded DNA molecular weight from base composition
Synthetic oligonucleotides are polymeric chains of four deoxynucleotide subunits with distinct molecular masses: dAMP (313.21 g mol⁻¹), dCMP (289.18 g mol⁻¹), dGMP (329.21 g mol⁻¹), and dTMP (304.20 g mol⁻¹). Because standard phosphoramidite synthesis leaves both the 5′ and 3′ termini as unphosphorylated hydroxyl groups, summing the four monomer counts and subtracting 61.96 g mol⁻¹ yields the exact anhydrous free-acid molecular weight of the unmodified strand.
Inspecting the two 20-mer primers in the pre-loaded J01636.1 fixture illustrates why base composition matters: forward primer CCAGCCACGTTTCTGCGAAA (5 A, 7 C, 4 G, 4 T) has an unmodified mass of 6,061.99 g mol⁻¹, whereas reverse primer TGCGCGAGAAGATTGTGCAC (5 A, 4 C, 7 G, 4 T) weighs 6,182.07 g mol⁻¹ despite having the same 20-nucleotide length (the workspace values; the four-term sum above agrees within 0.02). Relying on a fixed 20 × 330 = 6,600 g mol⁻¹ approximation overestimates the two strands by 8.9% and 6.8%.
Keep molar resuspension and mass-to-copy conversions dimensionally consistent
When reconstituting a lyophilized primer tube into a master stock (typically 100 µM in TE buffer, pH 8.0), the required buffer volume depends solely on the molar yield n(nmol) and target concentration Ctarget(µM) via V(µL) = 1000 × n / Ctarget. Molecular weight enters the calculation only when converting between mass units (µg, ng) and molar units (nmol, pmol, fmol)—for example, when preparing a qPCR copy-number standard curve from a mass concentration reading or computing picomoles of ssDNA bridge oligo per microgram.
If your oligonucleotide carries a 5′ phosphate for ligation (+79.98 g mol⁻¹), a 5′ biotin, or a fluorescent reporter-quencher pair, add the exact modification mass from the synthesis certificate before converting nanograms to picomoles. Preserving the sequence string, modification state, and stock molarity together prevents stoichiometry errors in downstream PCR, cloning, and hybridization workflows.
Equations and variables
Exact unmodified 5′-OH / 3′-OH ssDNA molecular weight
MWssDNA = 313.21 nA + 289.18 nC + 329.21 nG + 304.20 nT − 61.96
- MWssDNA
- Anhydrous free-acid molecular weight of an unphosphorylated DNA strand (g mol⁻¹)
- nA, nC, nG, nT
- Counts of deoxyadenosine, deoxycytidine, deoxyguanosine, and deoxythymidine
- −61.96
- End correction: one water added and one HPO3 removed (18.02 − 79.98) for a 5′-OH strand (g mol⁻¹)
Resuspension volume and mass-to-molarity conversion
V(µL) = 1000 × n(nmol) / Ctarget(µM); m(µg) = n(nmol) × MW(g mol⁻¹) / 1000
- V(µL)
- Buffer volume required to achieve target stock molarity Ctarget (µL)
- n(nmol)
- Synthesized molar quantity reported on the oligonucleotide specification sheet (nmol)
- m(µg)
- Total oligonucleotide mass corresponding to n nanomoles (µg)
Scope and limitations
- Standard chemical synthesis yields unphosphorylated 5′-OH / 3′-OH oligonucleotides; 5′-phosphorylated oligos (+79.98 Da), fluorophores, and quenchers require explicit mass additions.
- Manufacturer tube labels often report sodium-salt mass rather than anhydrous free-acid mass; always use the reported molar amount (nmol) when calculating buffer volume for a 100 µM stock.
- Nominal rules of thumb (330 Da per ssDNA nucleotide or 660 Da per dsDNA base pair) can deviate by several percent on short purine-rich or pyrimidine-rich oligomers.
Sources and provenance
- GenBank E. coli lac operon J01636.1Existing source notice: NCBI public domain
- Sequence toolkit primer verification fixtureOriginal reference calculations on cited sequence inputs
Technical questions
Why is −61.96 Da subtracted when summing anhydrous deoxynucleotide monophosphate masses?
Each nucleotide unit in a DNA chain has the formula of a deoxynucleoside 5′-monophosphate less one water, so N units carry N phosphates. A synthetic primer has a 5′-hydroxyl and 3′-hydroxyl instead of a 5′ phosphate: adding one water for the ends (18.02 g mol⁻¹) and removing one HPO3 (79.98 g mol⁻¹) gives the net −61.96.
How many microliters of buffer make a 100 µM master stock from X nanomoles of lyophilized oligo?
Because 100 µM equals 100 nmol per milliliter (or 0.1 nmol per microliter), multiplying the reported synthesis yield in nanomoles by 10 gives the exact volume in microliters needed for a 100 µM stock, independent of sequence length or molecular weight.
When does the exact sequence composition matter more than the 330 Da/nt rule of thumb?
Whenever converting a measured mass concentration (such as ng/µL from a spectrophotometer or Qubit assay) into picomoles for ligation, Gibson assembly, or standard-curve copy-number dilution. The dGMP unit (329.21 Da) weighs 13.8% more than the dCMP unit (289.18 Da), so pyrimidine-rich oligos fall well below the 330 Da figure and purine-rich ones come closer to it.
Connected workflows
- Primer-pair Tm and template matching
Evaluate primer melting temperatures at your chosen working molarity.
- DMSO stock reconstitution volume
Compare molar stock reconstitution rules for small-molecule solutes.
- Vector and insert molar-ratio calculation
Convert double-stranded fragment nanograms into picomoles for assembly.