Drybench Sequence product page
Drybench Sequence.
Reverse complement of a DNA sequence
Paste DNA and get the reverse complement, the complement and the reverse, with IUPAC codes handled and the calculation performed locally.
Sequence
Paste once, read every answer
Answer
Reverse complement
The complement, the reverse and the reverse complement, with IUPAC ambiguity codes complemented as codes.
Paste a sequence, or open an example, and every operation answers.
Open in the workbenchThe workbench carries this paste and offers every operation on it.
Worked example
- The first 36 bases of the insulin coding sequence, ATGGCCCTGTGGATGCGCCTCCTGCCCCTGCTGGCG, read 3′ to 5′ on the other strand: CGCCAGCAGGGGCAGGAGGCGCATCCACAGGGCCAT.
- An IUPAC code is complemented as a code: R (A or G) becomes Y (C or T), K becomes M, B becomes V, D becomes H; S, W and N stay as they are.
Method
Each base to its complement (IUPAC codes to their complementary codes), read 3′ to 5′
Limits
- For research and education only, and not medical advice: nothing here is an assessment of any person's variant, sample or molecule, and a difference reported from a reference is a difference, not an interpretation.
- Tags and protease sites are found by their published motifs and a cut is proposed at the site nearest an end; confirm it, since a motif inside the protein is not a cleavage site.
- Ambiguity codes are refused by name where a number cannot be computed from them (Tm, DNA molecular weight, hairpins and dimers) and kept where it can (reverse complement, translation to X, GC with S counted).