PCR primer design for a target region, within your template

Worked example

• The first 600 bases of the E. coli lac operon (J01636.1), target 201 to 400, a 50-base flank on each side, 18 to 26 bases (preferred 20), Tm 55 to 68 °C (preferred 59.95), ΔTm at most 3 °C, GC 30 to 70 percent, product 180 to 420 bases, 250 nM oligo in 50 mM Na⁺: 918 windows considered, 353 forward and 291 reverse eligible, 576 pairs within the product and ΔTm bounds, 5 checked for an exact product, 5 returned. The search is capped: the sides are cut to 24 windows by penalty, so the pairs shown are the best among those evaluated, not of every pair.
• The first pair: forward CCAGCCACGTTTCTGCGAAA (158 to 177, Tm 60.00 °C, 55.0 percent GC) and reverse TGCGCGAGAAGATTGTGCAC (428 to 409, Tm 59.97 °C, 55.0 percent GC): one exact site each in the template and one exact product of 271 bp; ranking total 0.097 (Tm departures 0.065, length departures 0.000, ΔTm 0.033).
• This is the published fixture case design-lac-linear: the same pairs, in the same order, are what the independent derivation returns. A returned pair is a sequence design checked for one exact product in this template; it is not a prediction that it amplifies, and nothing is checked against a genome.

Method

Windows of the chosen lengths within the flank of each target edge, kept inside the GC and Tm bounds; each side ranked by |Tm − preferred Tm| + 0.2·|length − preferred length| and cut to 24; pairs ranked by the two Tm departures + 0.2·the two length departures + ΔTm; the best 24 checked for one exact product, the first 5 returned

• Bounded primer design for a target region. A bounded enumeration within the supplied A/C/G/T template (at most 50,000 bases, linear or circular): candidate windows of the chosen lengths whose 3′ ends sit 0 to the chosen flank (at most 200 bases) before the target's first base and after its last, read around the circle when circular; a window is rejected, under the first reason that applies and counted, when it falls off a linear template, touches the target or an excluded region, or has a GC or a nearest-neighbour Tm (annealing part alone, the primer in excess, the recorded conditions) outside the bounds. Each side is ranked by |Tm − preferred Tm| + 0.2 × |length − preferred length| and cut to 24 windows; the pairs are ranked by the two Tm departures, 0.2 times the two length departures and the pair's ΔTm, with the product length (tails included) and ΔTm bounds applied first; the best 24 pairs are checked by the exact-pair method for one exact product at the designed sites and the first 5 that pass are returned. A search cut at any cap is reported as capped. Each retained annealing-part Tm includes its method version, conditions and qualifications; historical v1 receipts remain unchanged. No Tm of a tailed oligo, no annealing temperature, no genome specificity, no mismatched binding and no amplification outcome is derived: a returned pair is a sequence design, not evidence that it amplifies.Checked against 9 design cases and 4 refusals published and hashed from an independent derivation (every melting temperature from Biopython 1.88 under the recorded conditions; the windows, counts, ranking and caps derived in the script; exact binding by the exact-pair derivation; one case worked by hand): every returned pair, coordinate, product, count and cap exact, Tm and ranking terms within 1e-6 °C (11 October 2026). A separate primer-design program was run offline as a recorded comparison, not as the reference.
• Oligo melting temperature by nearest neighbour. SantaLucia J Jr. A unified view of polymer, dumbbell, and oligonucleotide DNA nearest-neighbor thermodynamics. Proc Natl Acad Sci USA 1998;95:1460-1465 (Table 2; read 6 October 2026); concentration models after SantaLucia J Jr, Hicks D. Annu Rev Biophys Biomol Struct 2004;33:415-440.Checked against Biopython 1.88 MeltingTemp.Tm_NN within 0.1 °C on 45 oligos under both concentration models, with the Owczarzy 2008 regime exact and the seven refusals exact (6 October 2026).
• Monovalent salt correction. Owczarzy R, You Y, Moreira BG, et al. Effects of sodium ions on DNA duplex oligomers: improved predictions of melting temperatures. Biochemistry 2004;43:3537-3554 (equation 22).Checked against Biopython 1.88 MeltingTemp.Tm_NN within 0.1 °C on 45 oligos under both concentration models, with the Owczarzy 2008 regime exact and the seven refusals exact (6 October 2026).
• Predicted PCR product from a supplied primer pair. Exact matches only: each primer's annealing part, or its reverse complement, matched base for base on an A/C/G/T template of at most 50,000 bases, on both strands, across the origin of a circular template once. A product runs from the forward primer's 5′ end to the reverse primer's 5′ end on the template, with each 5′ tail added once (the reverse tail reverse complemented); pairs whose footprints overlap are counted and build no product; every product is listed, with more than 100 sites per primer or 100 products refused as incomplete. A sequence construction, not a prediction of amplification or of specificity in a genome.Checked exactly against an independent Python derivation (Biopython 1.88 reverse complements, every window tested directly, one case worked by hand) on 30 cases: every site, product and status, and 13 refusals (10 October 2026).