Oligo Tm by nearest neighbour with salt and Mg corrections

Worked example

• The T7 promoter primer TAATACGACTCACTATAGGG (20 nt, 40 percent GC) at 250 nM in 50 mM Na⁺: Tm 47.6 °C with the primer in excess over its template and 45.7 °C with equal strands (SantaLucia 1998 stacks, Owczarzy 2004 correction).
• With 1.5 mM Mg²⁺ and 0.2 mM dNTPs the Owczarzy 2008 correction applies (adjusted-constants, R = 0.72): Tm 54.5 °C.
• Monovalent correction: Owczarzy 2004, fitted at 69 mM to 1.02 M Na⁺. It is also used from 20 to 69 mM, an extrapolation whose error has not been established here: Owczarzy 2008 places typical PCR buffers (20 to 100 mM monovalent) where this equation applies.
• Magnesium correction: Owczarzy 2008. Its free Mg²⁺ range, recalled as 0.5 to 600 mM, is Unverified: not yet checked against Owczarzy 2008.
• An ambiguity code refuses the Tm by name: the nearest-neighbour sums need A, C, G and T.

Method

Tm = ΔH° / (ΔS° + R ln(C/x)) − 273.15 with the stacks of SantaLucia 1998; the salt correction named on the chip

• Oligo melting temperature by nearest neighbour. SantaLucia J Jr. A unified view of polymer, dumbbell, and oligonucleotide DNA nearest-neighbor thermodynamics. Proc Natl Acad Sci USA 1998;95:1460-1465 (Table 2; read 6 October 2026); concentration models after SantaLucia J Jr, Hicks D. Annu Rev Biophys Biomol Struct 2004;33:415-440.Checked against Biopython 1.88 MeltingTemp.Tm_NN within 0.1 °C on 45 oligos under both concentration models, with the Owczarzy 2008 regime exact and the seven refusals exact (6 October 2026).
• Monovalent salt correction. Owczarzy R, You Y, Moreira BG, et al. Effects of sodium ions on DNA duplex oligomers: improved predictions of melting temperatures. Biochemistry 2004;43:3537-3554 (equation 22).Checked against Biopython 1.88 MeltingTemp.Tm_NN within 0.1 °C on 45 oligos under both concentration models, with the Owczarzy 2008 regime exact and the seven refusals exact (6 October 2026).
• Magnesium and mixed-cation salt correction. Owczarzy R, Moreira BG, You Y, Behlke MA, Walder JA. Predicting stability of DNA duplexes in solutions containing magnesium and monovalent cations. Biochemistry 2008;47:5336-5353 (equations 16 and 18 to 20).Checked against Biopython 1.88 MeltingTemp.Tm_NN within 0.1 °C on 45 oligos under both concentration models, with the Owczarzy 2008 regime exact and the seven refusals exact (6 October 2026).
• Entropy salt correction. SantaLucia J Jr. Proc Natl Acad Sci USA 1998;95:1460-1465 (equation 7): ΔS° + 0.368 (N − 1) ln[Na⁺].Checked against Biopython 1.88 MeltingTemp.Tm_NN within 0.1 °C on 45 oligos under both concentration models, with the Owczarzy 2008 regime exact and the seven refusals exact (6 October 2026).