Drybench Plasmid.
Gibson assembly online: exact overlap joining
Join 2 to 6 fragments on exact terminal overlaps into a circular or linear product, each overlap collapsed once, with a refusal for a missing or repeated one.
The worked example: pUC19 cut into three arcs, each carrying a 25 base overlap with the next where a primer would add it, re-joined into the circle. Adjacent fragments share an exact terminal sequence, collapsed once; nothing is flipped and no overlap length is recommended.
The fragments
| Fragment | Length (bp) | Source |
|---|---|---|
| pUC19 arc 1 | 920 | pUC19 (GenBank L09137.2) |
| pUC19 arc 2 | 920 | pUC19 (GenBank L09137.2) |
| pUC19 arc 3 | 921 | pUC19 (GenBank L09137.2) |
Overlaps
- pUC19 arc 1 to pUC19 arc 2: 25 bp (ATCACAAAAATCGACGCTCA…)
- pUC19 arc 2 to pUC19 arc 3: 25 bp (TTTATCAGCAATAAACCAGC…)
- pUC19 arc 3 to pUC19 arc 1: 25 bp (TCGCGCGTTTCGGTGATGAC…)
The product
A circular product of 2,686 bp; each overlap appears once.
Material conserved: 2,761 fragment bases less 75 overlap bases, each overlap once, give 2,686 bp.
The method depends on terminal homology long enough to anneal (Gibson et al. 2009; the commonly used working range is roughly 15 to 40 bases), so an overlap shorter than 15 bp withholds the product: that floor is a limit of the method, not a recommended length. A missing or contradictory overlap, or an overlap that occurs more than at its two designed ends on either strand, also withholds the product rather than resolving it silently. No overlap length is recommended and no melting temperature is used, and a designed product is not evidence that the reaction occurred.
Computed when this page was built, from data release f1.e1.p1.
How it is computed
- Gibson-style assembly. A user-ordered plan of 2 to 6 fragments joined on exact terminal overlaps: the overlap between two consecutive fragments is the longest suffix of one that is a prefix of the next, found base for base, collapsed once; the plan closes into a circle or is left linear, within a 50,000 bp product ceiling. The method depends on terminal homology long enough for the recessed strands to anneal (Gibson et al. 2009, Nat Methods 6:343–345, doi 10.1038/nmeth.1318; the commonly used working range is roughly 15 to 40 bases), so an overlap shorter than 15 bp withholds the product: the floor is a limit of applicability, not a recommended length. Sequence planning on double-stranded homology, not a thermodynamic model: no overlap length is recommended or called optimal and no melting temperature is used; fragments are taken as supplied and nothing is flipped. A missing or contradictory overlap, or an overlap that occurs more than at its two designed termini when the overlap and its reverse complement are counted across all fragments (repeated homology on either strand, which would permit an alternative or inverted assembly), withholds the product rather than resolving it silently. Every fragment must retain a non-overlapping core after both terminal overlaps; fully consumed fragments, bridge oligos and overlapping junction assignments are outside this planner and withhold the product. Material is conserved: the product length is the sum of the fragment lengths less each collapsed overlap once. The product carries a segment map: which input each run of product bases came from and where, a collapsed overlap belonging to both the fragments that hold it. A designed product is not evidence that the reaction occurred.Checked against 2 assemblies and 5 refusals: a three-fragment circular plan with 20 bp overlaps and a two-fragment linear plan with an overlap exactly at the 15 bp floor, whose fragments are cut from a chosen product and extended by exact overlaps, with the product re-derived by an independent concatenation, material accounted base by base, and reverse-complement and rotation giving the same product; a missing overlap, an 8 bp and a 14 bp overlap below the floor, and repeated homology on the supplied strand and on the other strand only each withheld (10 October 2026).
Limits
- For research and education only, and not medical advice: plasmid maps and sequence assembly designs. A designed product is not evidence that the reaction occurred; nothing here predicts expression or how well a reaction will work.