Drybench Plasmid product page
Drybench Plasmid.
SpCas9 guide sites in a sequence (no scores)
Find every SpCas9 guide (20 base protospacer, NGG PAM) on both strands, with GC, homopolymer run and the exact within-sequence count; no score or genome claim.
The worked example: every SpCas9 guide (a 20 base protospacer immediately 5′ of an NGG PAM) in bases 1 to 80 of pUC19 (GenBank L09137.2), on both strands. 6 were found; the first are listed.
The count is of exact matches of the protospacer inside the window you are looking at. It is not an off-target assessment and says nothing about the genome. No on-target or off-target score is given, and no mismatch-tolerant search is run. SpCas9 (NGG, 20 bases) only.
| Position | Strand | Protospacer (5′→3′) | PAM | GC | Longest run | Other protospacer matches |
|---|---|---|---|---|---|---|
| 29 to 48 | forward | CCTCTGACACATGCAGCTCC | CGG | 60% | 2 | 0 |
| 32 to 51 | reverse | CCGGGAGCTGCATGTGTCAG | AGG | 65% | 3 | 0 |
| 35 to 54 | forward | ACACATGCAGCTCCCGGAGA | CGG | 60% | 3 | 0 |
| 50 to 69 | reverse | GACAAGCTGTGACCGTCTCC | GGG | 60% | 2 | 0 |
| 51 to 70 | reverse | AGACAAGCTGTGACCGTCTC | CGG | 55% | 2 | 0 |
| 56 to 75 | forward | GGTCACAGCTTGTCTGTAAG | CGG | 50% | 2 | 0 |
Open the plasmid mapFor your own sequence, open it in the map; this finder lists SpCas9 sites, never a score or a genome claim.
Computed when this page was built, from data release f1.e1.p1.
How it is computed
- SpCas9 guide sites. Every 20 nt protospacer immediately 5′ of an NGG PAM (SpCas9), on both strands, matched base for base; a PAM across the origin of a circular sequence is found once. Each candidate carries its coordinates and strand, the protospacer, the PAM, the GC fraction (G+C over the 20 protospacer bases), the longest homopolymer run and the exact count of other occurrences of the protospacer within the pasted sequence on both strands. No on-target or off-target score of any kind, no mismatch-tolerant search and no genome-wide or specificity statement: the count is of exact matches inside the sequence you pasted, it is not an off-target assessment and says nothing about the genome. SpCas9 (NGG, 20 nt) only. Candidates are ordered by position.Checked against an independent enumeration on 5 sequences, 21 SpCas9 guides in all: one regular-expression search for a protospacer and its PAM, run over the sequence for the + strand and over Biopython 1.88's reverse complement for the − strand, each hit's position mapped back to top-strand coordinates, with the sequence doubled first when circular. Every position, strand, protospacer, PAM, GC, homopolymer run and within-sequence occurrence count exact, with one case worked by hand base by base (the script refuses to write unless its search agrees with the hand work), and a tandem repeat, an opposite-strand other site and a PAM across a circular origin among them (10 October 2026).
Limits
- For research and education only, and not medical advice: plasmid maps and sequence assembly designs. A designed product is not evidence that the reaction occurred; nothing here predicts expression or how well a reaction will work.