{ "about": { "generatedBy": "pipeline/sequence-toolkit/primer_qualification_effective_salt.py", "scriptSha256": "95e5fd8d2ae37385f83dc664e9894b2d8f34b1f205b0e4dcc3cd83b7e72c8c16", "recordedOn": "2026-10-11", "oracle": "Independent Python saved-record contract; Biopython 1.88 numerical cross-check", "sourceFixture": { "path": "pipeline/sequence-toolkit/fixtures/primer-design-qualification-v2.json", "sha256": "15bc9c8cb50e4568f42a10cdd3d52eb88121d59826c73dfc9a2a24abbef3dd21" }, "sourceDesigns": [ "design-lac-mg", "design-lac-linear" ], "independentTmChecks": 4, "contract": "Default-expand/effective-select requested conditions only; compare retained normalized condition and correction claims literally. Do not recompute historical stored temperatures or inject missing historical metadata.", "boundary": "Reader consistency, not experimental validation or secondary-structure prediction." }, "recordCases": [ { "id": "mg-request-owczarzy-2004", "input": [ { "v": 1, "id": "effective-salt-design-lac-mg", "label": "Independent effective-salt reader example", "createdAt": "2026-10-11T00:00:00.000Z", "notes": "", "forward": { "annealing": "AAACGCGGGAAAAAGTGG", "tail": "" }, "reverse": { "annealing": "GGTCATCCAGCGGATAGTTA", "tail": "" }, "conditions": { "oligo_nM": 250, "na_mM": 50, "mg_mM": 1.5, "dntp_mM": 0.2, "model": "primer-excess", "saltCorrection": "owczarzy-2004" }, "witness": { "templateHash": "fd182829946e68ba90d7c14906883ef31f663537dade5f617f804b8ce46dc316", "templateLength": 600, "topology": "linear", "coordinates": "1-based-inclusive-5prime-to-3prime", "forward": { "strand": "+", "start": 176, "end": 193, "length": 18 }, "reverse": { "strand": "-", "start": 469, "end": 450, "length": 20 }, "productId": "+:176:193|-:469:450", "method": "exact-pair-v1" }, "design": { "method": "bounded-flanks-v2", "target": { "start": 201, "end": 400 }, "capped": true, "ranking": { "tmDeviation": 0.3746413561051156, "lengthDeviation": 0.4, "deltaTm": 0.0405300140981808, "total": 0.8151713702032964 }, "counts": { "windows": 918, "boundary": 0, "excluded": 0, "gc": 40, "tm": 507, "validForward": 141, "validReverse": 230, "productSize": 0, "deltaTm": 0, "eligiblePairs": 576, "exactChecked": 5, "exactRefused": 0 }, "settings": { "target": { "start": 201, "end": 400 }, "excluded": [], "forwardTail": "", "reverseTail": "", "conditions": { "oligo_nM": 250, "na_mM": 50, "mg_mM": 1.5, "dntp_mM": 0.2, "model": "primer-excess", "saltCorrection": "owczarzy-2004" }, "flank": 50, "minLength": 18, "maxLength": 26, "targetLength": 20, "minTm": 55, "maxTm": 68, "targetTm": 60.95, "maxDeltaTm": 3, "minGc": 30, "maxGc": 70, "minProduct": 180, "maxProduct": 420 }, "structures": [ { "kind": "forward hairpin", "evaluated": false, "dG37": null, "detail": "Not evaluated in this hand-authored reader-contract example." }, { "kind": "reverse hairpin", "evaluated": false, "dG37": null, "detail": "Not evaluated in this hand-authored reader-contract example." }, { "kind": "forward self-dimer", "evaluated": false, "dG37": null, "detail": "Not evaluated in this hand-authored reader-contract example." }, { "kind": "reverse self-dimer", "evaluated": false, "dG37": null, "detail": "Not evaluated in this hand-authored reader-contract example." }, { "kind": "cross-dimer", "evaluated": false, "dG37": null, "detail": "Not evaluated in this hand-authored reader-contract example." } ], "limitations": [ "Reader-contract fixture: no secondary structure calculation is represented." ], "temperatures": { "forward": { "value": 61.15758568510165, "method": "oligo-tm-nearest-neighbour", "version": "1.0.0", "saltCorrection": "owczarzy-2008", "conditions": { "oligo_nM": 250, "na_mM": 50, "k_mM": 0, "tris_mM": 0, "mg_mM": 1.5, "dntp_mM": 0.2, "model": "primer-excess", "saltCorrection": "owczarzy-2008" }, "limit": "Magnesium correction: Owczarzy 2008. Its free Mg²⁺ range, recalled as 0.5 to 600 mM, is Unverified: not yet checked against Owczarzy 2008.", "outside": [] }, "reverse": { "value": 61.11705567100347, "method": "oligo-tm-nearest-neighbour", "version": "1.0.0", "saltCorrection": "owczarzy-2008", "conditions": { "oligo_nM": 250, "na_mM": 50, "k_mM": 0, "tris_mM": 0, "mg_mM": 1.5, "dntp_mM": 0.2, "model": "primer-excess", "saltCorrection": "owczarzy-2008" }, "limit": "Magnesium correction: Owczarzy 2008. Its free Mg²⁺ range, recalled as 0.5 to 600 mM, is Unverified: not yet checked against Owczarzy 2008.", "outside": [] } } } } ], "expectedAccepted": true, "reason": "Requested correction is effective-selected to Owczarzy 2008 at Mg 1.5 mM; both retained correction claims already say 2008 and remain byte-equivalent.", "expectedRead": [ { "v": 1, "id": "effective-salt-design-lac-mg", "label": "Independent effective-salt reader example", "createdAt": "2026-10-11T00:00:00.000Z", "notes": "", "forward": { "annealing": "AAACGCGGGAAAAAGTGG", "tail": "" }, "reverse": { "annealing": "GGTCATCCAGCGGATAGTTA", "tail": "" }, "conditions": { "oligo_nM": 250, "na_mM": 50, "mg_mM": 1.5, "dntp_mM": 0.2, "model": "primer-excess", "saltCorrection": "owczarzy-2004" }, "witness": { "templateHash": "fd182829946e68ba90d7c14906883ef31f663537dade5f617f804b8ce46dc316", "templateLength": 600, "topology": "linear", "coordinates": "1-based-inclusive-5prime-to-3prime", "forward": { "strand": "+", "start": 176, "end": 193, "length": 18 }, "reverse": { "strand": "-", "start": 469, "end": 450, "length": 20 }, "productId": "+:176:193|-:469:450", "method": "exact-pair-v1" }, "design": { "method": "bounded-flanks-v2", "target": { "start": 201, "end": 400 }, "capped": true, "ranking": { "tmDeviation": 0.3746413561051156, "lengthDeviation": 0.4, "deltaTm": 0.0405300140981808, "total": 0.8151713702032964 }, "counts": { "windows": 918, "boundary": 0, "excluded": 0, "gc": 40, "tm": 507, "validForward": 141, "validReverse": 230, "productSize": 0, "deltaTm": 0, "eligiblePairs": 576, "exactChecked": 5, "exactRefused": 0 }, "settings": { "target": { "start": 201, "end": 400 }, "excluded": [], "forwardTail": "", "reverseTail": "", "conditions": { "oligo_nM": 250, "na_mM": 50, "mg_mM": 1.5, "dntp_mM": 0.2, "model": "primer-excess", "saltCorrection": "owczarzy-2004" }, "flank": 50, "minLength": 18, "maxLength": 26, "targetLength": 20, "minTm": 55, "maxTm": 68, "targetTm": 60.95, "maxDeltaTm": 3, "minGc": 30, "maxGc": 70, "minProduct": 180, "maxProduct": 420 }, "structures": [ { "kind": "forward hairpin", "evaluated": false, "dG37": null, "detail": "Not evaluated in this hand-authored reader-contract example." }, { "kind": "reverse hairpin", "evaluated": false, "dG37": null, "detail": "Not evaluated in this hand-authored reader-contract example." }, { "kind": "forward self-dimer", "evaluated": false, "dG37": null, "detail": "Not evaluated in this hand-authored reader-contract example." }, { "kind": "reverse self-dimer", "evaluated": false, "dG37": null, "detail": "Not evaluated in this hand-authored reader-contract example." }, { "kind": "cross-dimer", "evaluated": false, "dG37": null, "detail": "Not evaluated in this hand-authored reader-contract example." } ], "limitations": [ "Reader-contract fixture: no secondary structure calculation is represented." ], "temperatures": { "forward": { "value": 61.15758568510165, "method": "oligo-tm-nearest-neighbour", "version": "1.0.0", "saltCorrection": "owczarzy-2008", "conditions": { "oligo_nM": 250, "na_mM": 50, "k_mM": 0, "tris_mM": 0, "mg_mM": 1.5, "dntp_mM": 0.2, "model": "primer-excess", "saltCorrection": "owczarzy-2008" }, "limit": "Magnesium correction: Owczarzy 2008. Its free Mg²⁺ range, recalled as 0.5 to 600 mM, is Unverified: not yet checked against Owczarzy 2008.", "outside": [] }, "reverse": { "value": 61.11705567100347, "method": "oligo-tm-nearest-neighbour", "version": "1.0.0", "saltCorrection": "owczarzy-2008", "conditions": { "oligo_nM": 250, "na_mM": 50, "k_mM": 0, "tris_mM": 0, "mg_mM": 1.5, "dntp_mM": 0.2, "model": "primer-excess", "saltCorrection": "owczarzy-2008" }, "limit": "Magnesium correction: Owczarzy 2008. Its free Mg²⁺ range, recalled as 0.5 to 600 mM, is Unverified: not yet checked against Owczarzy 2008.", "outside": [] } } } } ] }, { "id": "mg-request-omitted", "input": [ { "v": 1, "id": "effective-salt-design-lac-mg", "label": "Independent effective-salt reader example", "createdAt": "2026-10-11T00:00:00.000Z", "notes": "", "forward": { "annealing": "AAACGCGGGAAAAAGTGG", "tail": "" }, "reverse": { "annealing": "GGTCATCCAGCGGATAGTTA", "tail": "" }, "conditions": { "oligo_nM": 250, "na_mM": 50, "mg_mM": 1.5, "dntp_mM": 0.2, "model": "primer-excess" }, "witness": { "templateHash": "fd182829946e68ba90d7c14906883ef31f663537dade5f617f804b8ce46dc316", "templateLength": 600, "topology": "linear", "coordinates": "1-based-inclusive-5prime-to-3prime", "forward": { "strand": "+", "start": 176, "end": 193, "length": 18 }, "reverse": { "strand": "-", "start": 469, "end": 450, "length": 20 }, "productId": "+:176:193|-:469:450", "method": "exact-pair-v1" }, "design": { "method": "bounded-flanks-v2", "target": { "start": 201, "end": 400 }, "capped": true, "ranking": { "tmDeviation": 0.3746413561051156, "lengthDeviation": 0.4, "deltaTm": 0.0405300140981808, "total": 0.8151713702032964 }, "counts": { "windows": 918, "boundary": 0, "excluded": 0, "gc": 40, "tm": 507, "validForward": 141, "validReverse": 230, "productSize": 0, "deltaTm": 0, "eligiblePairs": 576, "exactChecked": 5, "exactRefused": 0 }, "settings": { "target": { "start": 201, "end": 400 }, "excluded": [], "forwardTail": "", "reverseTail": "", "conditions": { "oligo_nM": 250, "na_mM": 50, "mg_mM": 1.5, "dntp_mM": 0.2, "model": "primer-excess" }, "flank": 50, "minLength": 18, "maxLength": 26, "targetLength": 20, "minTm": 55, "maxTm": 68, "targetTm": 60.95, "maxDeltaTm": 3, "minGc": 30, "maxGc": 70, "minProduct": 180, "maxProduct": 420 }, "structures": [ { "kind": "forward hairpin", "evaluated": false, "dG37": null, "detail": "Not evaluated in this hand-authored reader-contract example." }, { "kind": "reverse hairpin", "evaluated": false, "dG37": null, "detail": "Not evaluated in this hand-authored reader-contract example." }, { "kind": "forward self-dimer", "evaluated": false, "dG37": null, "detail": "Not evaluated in this hand-authored reader-contract example." }, { "kind": "reverse self-dimer", "evaluated": false, "dG37": null, "detail": "Not evaluated in this hand-authored reader-contract example." }, { "kind": "cross-dimer", "evaluated": false, "dG37": null, "detail": "Not evaluated in this hand-authored reader-contract example." } ], "limitations": [ "Reader-contract fixture: no secondary structure calculation is represented." ], "temperatures": { "forward": { "value": 61.15758568510165, "method": "oligo-tm-nearest-neighbour", "version": "1.0.0", "saltCorrection": "owczarzy-2008", "conditions": { "oligo_nM": 250, "na_mM": 50, "k_mM": 0, "tris_mM": 0, "mg_mM": 1.5, "dntp_mM": 0.2, "model": "primer-excess", "saltCorrection": "owczarzy-2008" }, "limit": "Magnesium correction: Owczarzy 2008. Its free Mg²⁺ range, recalled as 0.5 to 600 mM, is Unverified: not yet checked against Owczarzy 2008.", "outside": [] }, "reverse": { "value": 61.11705567100347, "method": "oligo-tm-nearest-neighbour", "version": "1.0.0", "saltCorrection": "owczarzy-2008", "conditions": { "oligo_nM": 250, "na_mM": 50, "k_mM": 0, "tris_mM": 0, "mg_mM": 1.5, "dntp_mM": 0.2, "model": "primer-excess", "saltCorrection": "owczarzy-2008" }, "limit": "Magnesium correction: Owczarzy 2008. Its free Mg²⁺ range, recalled as 0.5 to 600 mM, is Unverified: not yet checked against Owczarzy 2008.", "outside": [] } } } } ], "expectedAccepted": true, "reason": "Requested correction is effective-selected to Owczarzy 2008 at Mg 1.5 mM; both retained correction claims already say 2008 and remain byte-equivalent.", "expectedRead": [ { "v": 1, "id": "effective-salt-design-lac-mg", "label": "Independent effective-salt reader example", "createdAt": "2026-10-11T00:00:00.000Z", "notes": "", "forward": { "annealing": "AAACGCGGGAAAAAGTGG", "tail": "" }, "reverse": { "annealing": "GGTCATCCAGCGGATAGTTA", "tail": "" }, "conditions": { "oligo_nM": 250, "na_mM": 50, "mg_mM": 1.5, "dntp_mM": 0.2, "model": "primer-excess" }, "witness": { "templateHash": "fd182829946e68ba90d7c14906883ef31f663537dade5f617f804b8ce46dc316", "templateLength": 600, "topology": "linear", "coordinates": "1-based-inclusive-5prime-to-3prime", "forward": { "strand": "+", "start": 176, "end": 193, "length": 18 }, "reverse": { "strand": "-", "start": 469, "end": 450, "length": 20 }, "productId": "+:176:193|-:469:450", "method": "exact-pair-v1" }, "design": { "method": "bounded-flanks-v2", "target": { "start": 201, "end": 400 }, "capped": true, "ranking": { "tmDeviation": 0.3746413561051156, "lengthDeviation": 0.4, "deltaTm": 0.0405300140981808, "total": 0.8151713702032964 }, "counts": { "windows": 918, "boundary": 0, "excluded": 0, "gc": 40, "tm": 507, "validForward": 141, "validReverse": 230, "productSize": 0, "deltaTm": 0, "eligiblePairs": 576, "exactChecked": 5, "exactRefused": 0 }, "settings": { "target": { "start": 201, "end": 400 }, "excluded": [], "forwardTail": "", "reverseTail": "", "conditions": { "oligo_nM": 250, "na_mM": 50, "mg_mM": 1.5, "dntp_mM": 0.2, "model": "primer-excess" }, "flank": 50, "minLength": 18, "maxLength": 26, "targetLength": 20, "minTm": 55, "maxTm": 68, "targetTm": 60.95, "maxDeltaTm": 3, "minGc": 30, "maxGc": 70, "minProduct": 180, "maxProduct": 420 }, "structures": [ { "kind": "forward hairpin", "evaluated": false, "dG37": null, "detail": "Not evaluated in this hand-authored reader-contract example." }, { "kind": "reverse hairpin", "evaluated": false, "dG37": null, "detail": "Not evaluated in this hand-authored reader-contract example." }, { "kind": "forward self-dimer", "evaluated": false, "dG37": null, "detail": "Not evaluated in this hand-authored reader-contract example." }, { "kind": "reverse self-dimer", "evaluated": false, "dG37": null, "detail": "Not evaluated in this hand-authored reader-contract example." }, { "kind": "cross-dimer", "evaluated": false, "dG37": null, "detail": "Not evaluated in this hand-authored reader-contract example." } ], "limitations": [ "Reader-contract fixture: no secondary structure calculation is represented." ], "temperatures": { "forward": { "value": 61.15758568510165, "method": "oligo-tm-nearest-neighbour", "version": "1.0.0", "saltCorrection": "owczarzy-2008", "conditions": { "oligo_nM": 250, "na_mM": 50, "k_mM": 0, "tris_mM": 0, "mg_mM": 1.5, "dntp_mM": 0.2, "model": "primer-excess", "saltCorrection": "owczarzy-2008" }, "limit": "Magnesium correction: Owczarzy 2008. Its free Mg²⁺ range, recalled as 0.5 to 600 mM, is Unverified: not yet checked against Owczarzy 2008.", "outside": [] }, "reverse": { "value": 61.11705567100347, "method": "oligo-tm-nearest-neighbour", "version": "1.0.0", "saltCorrection": "owczarzy-2008", "conditions": { "oligo_nM": 250, "na_mM": 50, "k_mM": 0, "tris_mM": 0, "mg_mM": 1.5, "dntp_mM": 0.2, "model": "primer-excess", "saltCorrection": "owczarzy-2008" }, "limit": "Magnesium correction: Owczarzy 2008. Its free Mg²⁺ range, recalled as 0.5 to 600 mM, is Unverified: not yet checked against Owczarzy 2008.", "outside": [] } } } } ] }, { "id": "mg-request-santalucia-1998", "input": [ { "v": 1, "id": "effective-salt-design-lac-mg", "label": "Independent effective-salt reader example", "createdAt": "2026-10-11T00:00:00.000Z", "notes": "", "forward": { "annealing": "AAACGCGGGAAAAAGTGG", "tail": "" }, "reverse": { "annealing": "GGTCATCCAGCGGATAGTTA", "tail": "" }, "conditions": { "oligo_nM": 250, "na_mM": 50, "mg_mM": 1.5, "dntp_mM": 0.2, "model": "primer-excess", "saltCorrection": "santalucia-1998" }, "witness": { "templateHash": "fd182829946e68ba90d7c14906883ef31f663537dade5f617f804b8ce46dc316", "templateLength": 600, "topology": "linear", "coordinates": "1-based-inclusive-5prime-to-3prime", "forward": { "strand": "+", "start": 176, "end": 193, "length": 18 }, "reverse": { "strand": "-", "start": 469, "end": 450, "length": 20 }, "productId": "+:176:193|-:469:450", "method": "exact-pair-v1" }, "design": { "method": "bounded-flanks-v2", "target": { "start": 201, "end": 400 }, "capped": true, "ranking": { "tmDeviation": 0.3746413561051156, "lengthDeviation": 0.4, "deltaTm": 0.0405300140981808, "total": 0.8151713702032964 }, "counts": { "windows": 918, "boundary": 0, "excluded": 0, "gc": 40, "tm": 507, "validForward": 141, "validReverse": 230, "productSize": 0, "deltaTm": 0, "eligiblePairs": 576, "exactChecked": 5, "exactRefused": 0 }, "settings": { "target": { "start": 201, "end": 400 }, "excluded": [], "forwardTail": "", "reverseTail": "", "conditions": { "oligo_nM": 250, "na_mM": 50, "mg_mM": 1.5, "dntp_mM": 0.2, "model": "primer-excess", "saltCorrection": "santalucia-1998" }, "flank": 50, "minLength": 18, "maxLength": 26, "targetLength": 20, "minTm": 55, "maxTm": 68, "targetTm": 60.95, "maxDeltaTm": 3, "minGc": 30, "maxGc": 70, "minProduct": 180, "maxProduct": 420 }, "structures": [ { "kind": "forward hairpin", "evaluated": false, "dG37": null, "detail": "Not evaluated in this hand-authored reader-contract example." }, { "kind": "reverse hairpin", "evaluated": false, "dG37": null, "detail": "Not evaluated in this hand-authored reader-contract example." }, { "kind": "forward self-dimer", "evaluated": false, "dG37": null, "detail": "Not evaluated in this hand-authored reader-contract example." }, { "kind": "reverse self-dimer", "evaluated": false, "dG37": null, "detail": "Not evaluated in this hand-authored reader-contract example." }, { "kind": "cross-dimer", "evaluated": false, "dG37": null, "detail": "Not evaluated in this hand-authored reader-contract example." } ], "limitations": [ "Reader-contract fixture: no secondary structure calculation is represented." ], "temperatures": { "forward": { "value": 61.15758568510165, "method": "oligo-tm-nearest-neighbour", "version": "1.0.0", "saltCorrection": "owczarzy-2008", "conditions": { "oligo_nM": 250, "na_mM": 50, "k_mM": 0, "tris_mM": 0, "mg_mM": 1.5, "dntp_mM": 0.2, "model": "primer-excess", "saltCorrection": "owczarzy-2008" }, "limit": "Magnesium correction: Owczarzy 2008. Its free Mg²⁺ range, recalled as 0.5 to 600 mM, is Unverified: not yet checked against Owczarzy 2008.", "outside": [] }, "reverse": { "value": 61.11705567100347, "method": "oligo-tm-nearest-neighbour", "version": "1.0.0", "saltCorrection": "owczarzy-2008", "conditions": { "oligo_nM": 250, "na_mM": 50, "k_mM": 0, "tris_mM": 0, "mg_mM": 1.5, "dntp_mM": 0.2, "model": "primer-excess", "saltCorrection": "owczarzy-2008" }, "limit": "Magnesium correction: Owczarzy 2008. Its free Mg²⁺ range, recalled as 0.5 to 600 mM, is Unverified: not yet checked against Owczarzy 2008.", "outside": [] } } } } ], "expectedAccepted": true, "reason": "Requested correction is effective-selected to Owczarzy 2008 at Mg 1.5 mM; both retained correction claims already say 2008 and remain byte-equivalent.", "expectedRead": [ { "v": 1, "id": "effective-salt-design-lac-mg", "label": "Independent effective-salt reader example", "createdAt": "2026-10-11T00:00:00.000Z", "notes": "", "forward": { "annealing": "AAACGCGGGAAAAAGTGG", "tail": "" }, "reverse": { "annealing": "GGTCATCCAGCGGATAGTTA", "tail": "" }, "conditions": { "oligo_nM": 250, "na_mM": 50, "mg_mM": 1.5, "dntp_mM": 0.2, "model": "primer-excess", "saltCorrection": "santalucia-1998" }, "witness": { "templateHash": "fd182829946e68ba90d7c14906883ef31f663537dade5f617f804b8ce46dc316", "templateLength": 600, "topology": "linear", "coordinates": "1-based-inclusive-5prime-to-3prime", "forward": { "strand": "+", "start": 176, "end": 193, "length": 18 }, "reverse": { "strand": "-", "start": 469, "end": 450, "length": 20 }, "productId": "+:176:193|-:469:450", "method": "exact-pair-v1" }, "design": { "method": "bounded-flanks-v2", "target": { "start": 201, "end": 400 }, "capped": true, "ranking": { "tmDeviation": 0.3746413561051156, "lengthDeviation": 0.4, "deltaTm": 0.0405300140981808, "total": 0.8151713702032964 }, "counts": { "windows": 918, "boundary": 0, "excluded": 0, "gc": 40, "tm": 507, "validForward": 141, "validReverse": 230, "productSize": 0, "deltaTm": 0, "eligiblePairs": 576, "exactChecked": 5, "exactRefused": 0 }, "settings": { "target": { "start": 201, "end": 400 }, "excluded": [], "forwardTail": "", "reverseTail": "", "conditions": { "oligo_nM": 250, "na_mM": 50, "mg_mM": 1.5, "dntp_mM": 0.2, "model": "primer-excess", "saltCorrection": "santalucia-1998" }, "flank": 50, "minLength": 18, "maxLength": 26, "targetLength": 20, "minTm": 55, "maxTm": 68, "targetTm": 60.95, "maxDeltaTm": 3, "minGc": 30, "maxGc": 70, "minProduct": 180, "maxProduct": 420 }, "structures": [ { "kind": "forward hairpin", "evaluated": false, "dG37": null, "detail": "Not evaluated in this hand-authored reader-contract example." }, { "kind": "reverse hairpin", "evaluated": false, "dG37": null, "detail": "Not evaluated in this hand-authored reader-contract example." }, { "kind": "forward self-dimer", "evaluated": false, "dG37": null, "detail": "Not evaluated in this hand-authored reader-contract example." }, { "kind": "reverse self-dimer", "evaluated": false, "dG37": null, "detail": "Not evaluated in this hand-authored reader-contract example." }, { "kind": "cross-dimer", "evaluated": false, "dG37": null, "detail": "Not evaluated in this hand-authored reader-contract example." } ], "limitations": [ "Reader-contract fixture: no secondary structure calculation is represented." ], "temperatures": { "forward": { "value": 61.15758568510165, "method": "oligo-tm-nearest-neighbour", "version": "1.0.0", "saltCorrection": "owczarzy-2008", "conditions": { "oligo_nM": 250, "na_mM": 50, "k_mM": 0, "tris_mM": 0, "mg_mM": 1.5, "dntp_mM": 0.2, "model": "primer-excess", "saltCorrection": "owczarzy-2008" }, "limit": "Magnesium correction: Owczarzy 2008. Its free Mg²⁺ range, recalled as 0.5 to 600 mM, is Unverified: not yet checked against Owczarzy 2008.", "outside": [] }, "reverse": { "value": 61.11705567100347, "method": "oligo-tm-nearest-neighbour", "version": "1.0.0", "saltCorrection": "owczarzy-2008", "conditions": { "oligo_nM": 250, "na_mM": 50, "k_mM": 0, "tris_mM": 0, "mg_mM": 1.5, "dntp_mM": 0.2, "model": "primer-excess", "saltCorrection": "owczarzy-2008" }, "limit": "Magnesium correction: Owczarzy 2008. Its free Mg²⁺ range, recalled as 0.5 to 600 mM, is Unverified: not yet checked against Owczarzy 2008.", "outside": [] } } } } ] }, { "id": "mg-request-owczarzy-2008", "input": [ { "v": 1, "id": "effective-salt-design-lac-mg", "label": "Independent effective-salt reader example", "createdAt": "2026-10-11T00:00:00.000Z", "notes": "", "forward": { "annealing": "AAACGCGGGAAAAAGTGG", "tail": "" }, "reverse": { "annealing": "GGTCATCCAGCGGATAGTTA", "tail": "" }, "conditions": { "oligo_nM": 250, "na_mM": 50, "mg_mM": 1.5, "dntp_mM": 0.2, "model": "primer-excess", "saltCorrection": "owczarzy-2008" }, "witness": { "templateHash": "fd182829946e68ba90d7c14906883ef31f663537dade5f617f804b8ce46dc316", "templateLength": 600, "topology": "linear", "coordinates": "1-based-inclusive-5prime-to-3prime", "forward": { "strand": "+", "start": 176, "end": 193, "length": 18 }, "reverse": { "strand": "-", "start": 469, "end": 450, "length": 20 }, "productId": "+:176:193|-:469:450", "method": "exact-pair-v1" }, "design": { "method": "bounded-flanks-v2", "target": { "start": 201, "end": 400 }, "capped": true, "ranking": { "tmDeviation": 0.3746413561051156, "lengthDeviation": 0.4, "deltaTm": 0.0405300140981808, "total": 0.8151713702032964 }, "counts": { "windows": 918, "boundary": 0, "excluded": 0, "gc": 40, "tm": 507, "validForward": 141, "validReverse": 230, "productSize": 0, "deltaTm": 0, "eligiblePairs": 576, "exactChecked": 5, "exactRefused": 0 }, "settings": { "target": { "start": 201, "end": 400 }, "excluded": [], "forwardTail": "", "reverseTail": "", "conditions": { "oligo_nM": 250, "na_mM": 50, "mg_mM": 1.5, "dntp_mM": 0.2, "model": "primer-excess", "saltCorrection": "owczarzy-2008" }, "flank": 50, "minLength": 18, "maxLength": 26, "targetLength": 20, "minTm": 55, "maxTm": 68, "targetTm": 60.95, "maxDeltaTm": 3, "minGc": 30, "maxGc": 70, "minProduct": 180, "maxProduct": 420 }, "structures": [ { "kind": "forward hairpin", "evaluated": false, "dG37": null, "detail": "Not evaluated in this hand-authored reader-contract example." }, { "kind": "reverse hairpin", "evaluated": false, "dG37": null, "detail": "Not evaluated in this hand-authored reader-contract example." }, { "kind": "forward self-dimer", "evaluated": false, "dG37": null, "detail": "Not evaluated in this hand-authored reader-contract example." }, { "kind": "reverse self-dimer", "evaluated": false, "dG37": null, "detail": "Not evaluated in this hand-authored reader-contract example." }, { "kind": "cross-dimer", "evaluated": false, "dG37": null, "detail": "Not evaluated in this hand-authored reader-contract example." } ], "limitations": [ "Reader-contract fixture: no secondary structure calculation is represented." ], "temperatures": { "forward": { "value": 61.15758568510165, "method": "oligo-tm-nearest-neighbour", "version": "1.0.0", "saltCorrection": "owczarzy-2008", "conditions": { "oligo_nM": 250, "na_mM": 50, "k_mM": 0, "tris_mM": 0, "mg_mM": 1.5, "dntp_mM": 0.2, "model": "primer-excess", "saltCorrection": "owczarzy-2008" }, "limit": "Magnesium correction: Owczarzy 2008. Its free Mg²⁺ range, recalled as 0.5 to 600 mM, is Unverified: not yet checked against Owczarzy 2008.", "outside": [] }, "reverse": { "value": 61.11705567100347, "method": "oligo-tm-nearest-neighbour", "version": "1.0.0", "saltCorrection": "owczarzy-2008", "conditions": { "oligo_nM": 250, "na_mM": 50, "k_mM": 0, "tris_mM": 0, "mg_mM": 1.5, "dntp_mM": 0.2, "model": "primer-excess", "saltCorrection": "owczarzy-2008" }, "limit": "Magnesium correction: Owczarzy 2008. Its free Mg²⁺ range, recalled as 0.5 to 600 mM, is Unverified: not yet checked against Owczarzy 2008.", "outside": [] } } } } ], "expectedAccepted": true, "reason": "Requested correction is effective-selected to Owczarzy 2008 at Mg 1.5 mM; both retained correction claims already say 2008 and remain byte-equivalent.", "expectedRead": [ { "v": 1, "id": "effective-salt-design-lac-mg", "label": "Independent effective-salt reader example", "createdAt": "2026-10-11T00:00:00.000Z", "notes": "", "forward": { "annealing": "AAACGCGGGAAAAAGTGG", "tail": "" }, "reverse": { "annealing": "GGTCATCCAGCGGATAGTTA", "tail": "" }, "conditions": { "oligo_nM": 250, "na_mM": 50, "mg_mM": 1.5, "dntp_mM": 0.2, "model": "primer-excess", "saltCorrection": "owczarzy-2008" }, "witness": { "templateHash": "fd182829946e68ba90d7c14906883ef31f663537dade5f617f804b8ce46dc316", "templateLength": 600, "topology": "linear", "coordinates": "1-based-inclusive-5prime-to-3prime", "forward": { "strand": "+", "start": 176, "end": 193, "length": 18 }, "reverse": { "strand": "-", "start": 469, "end": 450, "length": 20 }, "productId": "+:176:193|-:469:450", "method": "exact-pair-v1" }, "design": { "method": "bounded-flanks-v2", "target": { "start": 201, "end": 400 }, "capped": true, "ranking": { "tmDeviation": 0.3746413561051156, "lengthDeviation": 0.4, "deltaTm": 0.0405300140981808, "total": 0.8151713702032964 }, "counts": { "windows": 918, "boundary": 0, "excluded": 0, "gc": 40, "tm": 507, "validForward": 141, "validReverse": 230, "productSize": 0, "deltaTm": 0, "eligiblePairs": 576, "exactChecked": 5, "exactRefused": 0 }, "settings": { "target": { "start": 201, "end": 400 }, "excluded": [], "forwardTail": "", "reverseTail": "", "conditions": { "oligo_nM": 250, "na_mM": 50, "mg_mM": 1.5, "dntp_mM": 0.2, "model": "primer-excess", "saltCorrection": "owczarzy-2008" }, "flank": 50, "minLength": 18, "maxLength": 26, "targetLength": 20, "minTm": 55, "maxTm": 68, "targetTm": 60.95, "maxDeltaTm": 3, "minGc": 30, "maxGc": 70, "minProduct": 180, "maxProduct": 420 }, "structures": [ { "kind": "forward hairpin", "evaluated": false, "dG37": null, "detail": "Not evaluated in this hand-authored reader-contract example." }, { "kind": "reverse hairpin", "evaluated": false, "dG37": null, "detail": "Not evaluated in this hand-authored reader-contract example." }, { "kind": "forward self-dimer", "evaluated": false, "dG37": null, "detail": "Not evaluated in this hand-authored reader-contract example." }, { "kind": "reverse self-dimer", "evaluated": false, "dG37": null, "detail": "Not evaluated in this hand-authored reader-contract example." }, { "kind": "cross-dimer", "evaluated": false, "dG37": null, "detail": "Not evaluated in this hand-authored reader-contract example." } ], "limitations": [ "Reader-contract fixture: no secondary structure calculation is represented." ], "temperatures": { "forward": { "value": 61.15758568510165, "method": "oligo-tm-nearest-neighbour", "version": "1.0.0", "saltCorrection": "owczarzy-2008", "conditions": { "oligo_nM": 250, "na_mM": 50, "k_mM": 0, "tris_mM": 0, "mg_mM": 1.5, "dntp_mM": 0.2, "model": "primer-excess", "saltCorrection": "owczarzy-2008" }, "limit": "Magnesium correction: Owczarzy 2008. Its free Mg²⁺ range, recalled as 0.5 to 600 mM, is Unverified: not yet checked against Owczarzy 2008.", "outside": [] }, "reverse": { "value": 61.11705567100347, "method": "oligo-tm-nearest-neighbour", "version": "1.0.0", "saltCorrection": "owczarzy-2008", "conditions": { "oligo_nM": 250, "na_mM": 50, "k_mM": 0, "tris_mM": 0, "mg_mM": 1.5, "dntp_mM": 0.2, "model": "primer-excess", "saltCorrection": "owczarzy-2008" }, "limit": "Magnesium correction: Owczarzy 2008. Its free Mg²⁺ range, recalled as 0.5 to 600 mM, is Unverified: not yet checked against Owczarzy 2008.", "outside": [] } } } } ] }, { "id": "mg-forward-retained-top-level-2004", "input": [ { "v": 1, "id": "effective-salt-design-lac-mg", "label": "Independent effective-salt reader example", "createdAt": "2026-10-11T00:00:00.000Z", "notes": "", "forward": { "annealing": "AAACGCGGGAAAAAGTGG", "tail": "" }, "reverse": { "annealing": "GGTCATCCAGCGGATAGTTA", "tail": "" }, "conditions": { "oligo_nM": 250, "na_mM": 50, "mg_mM": 1.5, "dntp_mM": 0.2, "model": "primer-excess", "saltCorrection": "owczarzy-2004" }, "witness": { "templateHash": "fd182829946e68ba90d7c14906883ef31f663537dade5f617f804b8ce46dc316", "templateLength": 600, "topology": "linear", "coordinates": "1-based-inclusive-5prime-to-3prime", "forward": { "strand": "+", "start": 176, "end": 193, "length": 18 }, "reverse": { "strand": "-", "start": 469, "end": 450, "length": 20 }, "productId": "+:176:193|-:469:450", "method": "exact-pair-v1" }, "design": { "method": "bounded-flanks-v2", "target": { "start": 201, "end": 400 }, "capped": true, "ranking": { "tmDeviation": 0.3746413561051156, "lengthDeviation": 0.4, "deltaTm": 0.0405300140981808, "total": 0.8151713702032964 }, "counts": { "windows": 918, "boundary": 0, "excluded": 0, "gc": 40, "tm": 507, "validForward": 141, "validReverse": 230, "productSize": 0, "deltaTm": 0, "eligiblePairs": 576, "exactChecked": 5, "exactRefused": 0 }, "settings": { "target": { "start": 201, "end": 400 }, "excluded": [], "forwardTail": "", "reverseTail": "", "conditions": { "oligo_nM": 250, "na_mM": 50, "mg_mM": 1.5, "dntp_mM": 0.2, "model": "primer-excess", "saltCorrection": "owczarzy-2004" }, "flank": 50, "minLength": 18, "maxLength": 26, "targetLength": 20, "minTm": 55, "maxTm": 68, "targetTm": 60.95, "maxDeltaTm": 3, "minGc": 30, "maxGc": 70, "minProduct": 180, "maxProduct": 420 }, "structures": [ { "kind": "forward hairpin", "evaluated": false, "dG37": null, "detail": "Not evaluated in this hand-authored reader-contract example." }, { "kind": "reverse hairpin", "evaluated": false, "dG37": null, "detail": "Not evaluated in this hand-authored reader-contract example." }, { "kind": "forward self-dimer", "evaluated": false, "dG37": null, "detail": "Not evaluated in this hand-authored reader-contract example." }, { "kind": "reverse self-dimer", "evaluated": false, "dG37": null, "detail": "Not evaluated in this hand-authored reader-contract example." }, { "kind": "cross-dimer", "evaluated": false, "dG37": null, "detail": "Not evaluated in this hand-authored reader-contract example." } ], "limitations": [ "Reader-contract fixture: no secondary structure calculation is represented." ], "temperatures": { "forward": { "value": 61.15758568510165, "method": "oligo-tm-nearest-neighbour", "version": "1.0.0", "saltCorrection": "owczarzy-2004", "conditions": { "oligo_nM": 250, "na_mM": 50, "k_mM": 0, "tris_mM": 0, "mg_mM": 1.5, "dntp_mM": 0.2, "model": "primer-excess", "saltCorrection": "owczarzy-2008" }, "limit": "Magnesium correction: Owczarzy 2008. Its free Mg²⁺ range, recalled as 0.5 to 600 mM, is Unverified: not yet checked against Owczarzy 2008.", "outside": [] }, "reverse": { "value": 61.11705567100347, "method": "oligo-tm-nearest-neighbour", "version": "1.0.0", "saltCorrection": "owczarzy-2008", "conditions": { "oligo_nM": 250, "na_mM": 50, "k_mM": 0, "tris_mM": 0, "mg_mM": 1.5, "dntp_mM": 0.2, "model": "primer-excess", "saltCorrection": "owczarzy-2008" }, "limit": "Magnesium correction: Owczarzy 2008. Its free Mg²⁺ range, recalled as 0.5 to 600 mM, is Unverified: not yet checked against Owczarzy 2008.", "outside": [] } } } } ], "expectedAccepted": false, "reason": "Retained correction is a literal scientific claim, not a request. Re-normalizing it would hide this contradiction." }, { "id": "mg-forward-retained-nested-2004", "input": [ { "v": 1, "id": "effective-salt-design-lac-mg", "label": "Independent effective-salt reader example", "createdAt": "2026-10-11T00:00:00.000Z", "notes": "", "forward": { "annealing": "AAACGCGGGAAAAAGTGG", "tail": "" }, "reverse": { "annealing": "GGTCATCCAGCGGATAGTTA", "tail": "" }, "conditions": { "oligo_nM": 250, "na_mM": 50, "mg_mM": 1.5, "dntp_mM": 0.2, "model": "primer-excess", "saltCorrection": "owczarzy-2004" }, "witness": { "templateHash": "fd182829946e68ba90d7c14906883ef31f663537dade5f617f804b8ce46dc316", "templateLength": 600, "topology": "linear", "coordinates": "1-based-inclusive-5prime-to-3prime", "forward": { "strand": "+", "start": 176, "end": 193, "length": 18 }, "reverse": { "strand": "-", "start": 469, "end": 450, "length": 20 }, "productId": "+:176:193|-:469:450", "method": "exact-pair-v1" }, "design": { "method": "bounded-flanks-v2", "target": { "start": 201, "end": 400 }, "capped": true, "ranking": { "tmDeviation": 0.3746413561051156, "lengthDeviation": 0.4, "deltaTm": 0.0405300140981808, "total": 0.8151713702032964 }, "counts": { "windows": 918, "boundary": 0, "excluded": 0, "gc": 40, "tm": 507, "validForward": 141, "validReverse": 230, "productSize": 0, "deltaTm": 0, "eligiblePairs": 576, "exactChecked": 5, "exactRefused": 0 }, "settings": { "target": { "start": 201, "end": 400 }, "excluded": [], "forwardTail": "", "reverseTail": "", "conditions": { "oligo_nM": 250, "na_mM": 50, "mg_mM": 1.5, "dntp_mM": 0.2, "model": "primer-excess", "saltCorrection": "owczarzy-2004" }, "flank": 50, "minLength": 18, "maxLength": 26, "targetLength": 20, "minTm": 55, "maxTm": 68, "targetTm": 60.95, "maxDeltaTm": 3, "minGc": 30, "maxGc": 70, "minProduct": 180, "maxProduct": 420 }, "structures": [ { "kind": "forward hairpin", "evaluated": false, "dG37": null, "detail": "Not evaluated in this hand-authored reader-contract example." }, { "kind": "reverse hairpin", "evaluated": false, "dG37": null, "detail": "Not evaluated in this hand-authored reader-contract example." }, { "kind": "forward self-dimer", "evaluated": false, "dG37": null, "detail": "Not evaluated in this hand-authored reader-contract example." }, { "kind": "reverse self-dimer", "evaluated": false, "dG37": null, "detail": "Not evaluated in this hand-authored reader-contract example." }, { "kind": "cross-dimer", "evaluated": false, "dG37": null, "detail": "Not evaluated in this hand-authored reader-contract example." } ], "limitations": [ "Reader-contract fixture: no secondary structure calculation is represented." ], "temperatures": { "forward": { "value": 61.15758568510165, "method": "oligo-tm-nearest-neighbour", "version": "1.0.0", "saltCorrection": "owczarzy-2008", "conditions": { "oligo_nM": 250, "na_mM": 50, "k_mM": 0, "tris_mM": 0, "mg_mM": 1.5, "dntp_mM": 0.2, "model": "primer-excess", "saltCorrection": "owczarzy-2004" }, "limit": "Magnesium correction: Owczarzy 2008. Its free Mg²⁺ range, recalled as 0.5 to 600 mM, is Unverified: not yet checked against Owczarzy 2008.", "outside": [] }, "reverse": { "value": 61.11705567100347, "method": "oligo-tm-nearest-neighbour", "version": "1.0.0", "saltCorrection": "owczarzy-2008", "conditions": { "oligo_nM": 250, "na_mM": 50, "k_mM": 0, "tris_mM": 0, "mg_mM": 1.5, "dntp_mM": 0.2, "model": "primer-excess", "saltCorrection": "owczarzy-2008" }, "limit": "Magnesium correction: Owczarzy 2008. Its free Mg²⁺ range, recalled as 0.5 to 600 mM, is Unverified: not yet checked against Owczarzy 2008.", "outside": [] } } } } ], "expectedAccepted": false, "reason": "Retained correction is a literal scientific claim, not a request. Re-normalizing it would hide this contradiction." }, { "id": "mg-forward-retained-both-2004", "input": [ { "v": 1, "id": "effective-salt-design-lac-mg", "label": "Independent effective-salt reader example", "createdAt": "2026-10-11T00:00:00.000Z", "notes": "", "forward": { "annealing": "AAACGCGGGAAAAAGTGG", "tail": "" }, "reverse": { "annealing": "GGTCATCCAGCGGATAGTTA", "tail": "" }, "conditions": { "oligo_nM": 250, "na_mM": 50, "mg_mM": 1.5, "dntp_mM": 0.2, "model": "primer-excess", "saltCorrection": "owczarzy-2004" }, "witness": { "templateHash": "fd182829946e68ba90d7c14906883ef31f663537dade5f617f804b8ce46dc316", "templateLength": 600, "topology": "linear", "coordinates": "1-based-inclusive-5prime-to-3prime", "forward": { "strand": "+", "start": 176, "end": 193, "length": 18 }, "reverse": { "strand": "-", "start": 469, "end": 450, "length": 20 }, "productId": "+:176:193|-:469:450", "method": "exact-pair-v1" }, "design": { "method": "bounded-flanks-v2", "target": { "start": 201, "end": 400 }, "capped": true, "ranking": { "tmDeviation": 0.3746413561051156, "lengthDeviation": 0.4, "deltaTm": 0.0405300140981808, "total": 0.8151713702032964 }, "counts": { "windows": 918, "boundary": 0, "excluded": 0, "gc": 40, "tm": 507, "validForward": 141, "validReverse": 230, "productSize": 0, "deltaTm": 0, "eligiblePairs": 576, "exactChecked": 5, "exactRefused": 0 }, "settings": { "target": { "start": 201, "end": 400 }, "excluded": [], "forwardTail": "", "reverseTail": "", "conditions": { "oligo_nM": 250, "na_mM": 50, "mg_mM": 1.5, "dntp_mM": 0.2, "model": "primer-excess", "saltCorrection": "owczarzy-2004" }, "flank": 50, "minLength": 18, "maxLength": 26, "targetLength": 20, "minTm": 55, "maxTm": 68, "targetTm": 60.95, "maxDeltaTm": 3, "minGc": 30, "maxGc": 70, "minProduct": 180, "maxProduct": 420 }, "structures": [ { "kind": "forward hairpin", "evaluated": false, "dG37": null, "detail": "Not evaluated in this hand-authored reader-contract example." }, { "kind": "reverse hairpin", "evaluated": false, "dG37": null, "detail": "Not evaluated in this hand-authored reader-contract example." }, { "kind": "forward self-dimer", "evaluated": false, "dG37": null, "detail": "Not evaluated in this hand-authored reader-contract example." }, { "kind": "reverse self-dimer", "evaluated": false, "dG37": null, "detail": "Not evaluated in this hand-authored reader-contract example." }, { "kind": "cross-dimer", "evaluated": false, "dG37": null, "detail": "Not evaluated in this hand-authored reader-contract example." } ], "limitations": [ "Reader-contract fixture: no secondary structure calculation is represented." ], "temperatures": { "forward": { "value": 61.15758568510165, "method": "oligo-tm-nearest-neighbour", "version": "1.0.0", "saltCorrection": "owczarzy-2004", "conditions": { "oligo_nM": 250, "na_mM": 50, "k_mM": 0, "tris_mM": 0, "mg_mM": 1.5, "dntp_mM": 0.2, "model": "primer-excess", "saltCorrection": "owczarzy-2004" }, "limit": "Magnesium correction: Owczarzy 2008. Its free Mg²⁺ range, recalled as 0.5 to 600 mM, is Unverified: not yet checked against Owczarzy 2008.", "outside": [] }, "reverse": { "value": 61.11705567100347, "method": "oligo-tm-nearest-neighbour", "version": "1.0.0", "saltCorrection": "owczarzy-2008", "conditions": { "oligo_nM": 250, "na_mM": 50, "k_mM": 0, "tris_mM": 0, "mg_mM": 1.5, "dntp_mM": 0.2, "model": "primer-excess", "saltCorrection": "owczarzy-2008" }, "limit": "Magnesium correction: Owczarzy 2008. Its free Mg²⁺ range, recalled as 0.5 to 600 mM, is Unverified: not yet checked against Owczarzy 2008.", "outside": [] } } } } ], "expectedAccepted": false, "reason": "Retained correction is a literal scientific claim, not a request. Re-normalizing it would hide this contradiction." }, { "id": "mg-forward-wrong-mg_mM", "input": [ { "v": 1, "id": "effective-salt-design-lac-mg", "label": "Independent effective-salt reader example", "createdAt": "2026-10-11T00:00:00.000Z", "notes": "", "forward": { "annealing": "AAACGCGGGAAAAAGTGG", "tail": "" }, "reverse": { "annealing": "GGTCATCCAGCGGATAGTTA", "tail": "" }, "conditions": { "oligo_nM": 250, "na_mM": 50, "mg_mM": 1.5, "dntp_mM": 0.2, "model": "primer-excess", "saltCorrection": "owczarzy-2008" }, "witness": { "templateHash": "fd182829946e68ba90d7c14906883ef31f663537dade5f617f804b8ce46dc316", "templateLength": 600, "topology": "linear", "coordinates": "1-based-inclusive-5prime-to-3prime", "forward": { "strand": "+", "start": 176, "end": 193, "length": 18 }, "reverse": { "strand": "-", "start": 469, "end": 450, "length": 20 }, "productId": "+:176:193|-:469:450", "method": "exact-pair-v1" }, "design": { "method": "bounded-flanks-v2", "target": { "start": 201, "end": 400 }, "capped": true, "ranking": { "tmDeviation": 0.3746413561051156, "lengthDeviation": 0.4, "deltaTm": 0.0405300140981808, "total": 0.8151713702032964 }, "counts": { "windows": 918, "boundary": 0, "excluded": 0, "gc": 40, "tm": 507, "validForward": 141, "validReverse": 230, "productSize": 0, "deltaTm": 0, "eligiblePairs": 576, "exactChecked": 5, "exactRefused": 0 }, "settings": { "target": { "start": 201, "end": 400 }, "excluded": [], "forwardTail": "", "reverseTail": "", "conditions": { "oligo_nM": 250, "na_mM": 50, "mg_mM": 1.5, "dntp_mM": 0.2, "model": "primer-excess", "saltCorrection": "owczarzy-2008" }, "flank": 50, "minLength": 18, "maxLength": 26, "targetLength": 20, "minTm": 55, "maxTm": 68, "targetTm": 60.95, "maxDeltaTm": 3, "minGc": 30, "maxGc": 70, "minProduct": 180, "maxProduct": 420 }, "structures": [ { "kind": "forward hairpin", "evaluated": false, "dG37": null, "detail": "Not evaluated in this hand-authored reader-contract example." }, { "kind": "reverse hairpin", "evaluated": false, "dG37": null, "detail": "Not evaluated in this hand-authored reader-contract example." }, { "kind": "forward self-dimer", "evaluated": false, "dG37": null, "detail": "Not evaluated in this hand-authored reader-contract example." }, { "kind": "reverse self-dimer", "evaluated": false, "dG37": null, "detail": "Not evaluated in this hand-authored reader-contract example." }, { "kind": "cross-dimer", "evaluated": false, "dG37": null, "detail": "Not evaluated in this hand-authored reader-contract example." } ], "limitations": [ "Reader-contract fixture: no secondary structure calculation is represented." ], "temperatures": { "forward": { "value": 61.15758568510165, "method": "oligo-tm-nearest-neighbour", "version": "1.0.0", "saltCorrection": "owczarzy-2008", "conditions": { "oligo_nM": 250, "na_mM": 50, "k_mM": 0, "tris_mM": 0, "mg_mM": 0, "dntp_mM": 0.2, "model": "primer-excess", "saltCorrection": "owczarzy-2008" }, "limit": "Magnesium correction: Owczarzy 2008. Its free Mg²⁺ range, recalled as 0.5 to 600 mM, is Unverified: not yet checked against Owczarzy 2008.", "outside": [] }, "reverse": { "value": 61.11705567100347, "method": "oligo-tm-nearest-neighbour", "version": "1.0.0", "saltCorrection": "owczarzy-2008", "conditions": { "oligo_nM": 250, "na_mM": 50, "k_mM": 0, "tris_mM": 0, "mg_mM": 1.5, "dntp_mM": 0.2, "model": "primer-excess", "saltCorrection": "owczarzy-2008" }, "limit": "Magnesium correction: Owczarzy 2008. Its free Mg²⁺ range, recalled as 0.5 to 600 mM, is Unverified: not yet checked against Owczarzy 2008.", "outside": [] } } } } ], "expectedAccepted": false, "reason": "Retained ionic conditions contradict the saved requested conditions; reject the complete pair." }, { "id": "mg-forward-wrong-dntp_mM", "input": [ { "v": 1, "id": "effective-salt-design-lac-mg", "label": "Independent effective-salt reader example", "createdAt": "2026-10-11T00:00:00.000Z", "notes": "", "forward": { "annealing": "AAACGCGGGAAAAAGTGG", "tail": "" }, "reverse": { "annealing": "GGTCATCCAGCGGATAGTTA", "tail": "" }, "conditions": { "oligo_nM": 250, "na_mM": 50, "mg_mM": 1.5, "dntp_mM": 0.2, "model": "primer-excess", "saltCorrection": "owczarzy-2008" }, "witness": { "templateHash": "fd182829946e68ba90d7c14906883ef31f663537dade5f617f804b8ce46dc316", "templateLength": 600, "topology": "linear", "coordinates": "1-based-inclusive-5prime-to-3prime", "forward": { "strand": "+", "start": 176, "end": 193, "length": 18 }, "reverse": { "strand": "-", "start": 469, "end": 450, "length": 20 }, "productId": "+:176:193|-:469:450", "method": "exact-pair-v1" }, "design": { "method": "bounded-flanks-v2", "target": { "start": 201, "end": 400 }, "capped": true, "ranking": { "tmDeviation": 0.3746413561051156, "lengthDeviation": 0.4, "deltaTm": 0.0405300140981808, "total": 0.8151713702032964 }, "counts": { "windows": 918, "boundary": 0, "excluded": 0, "gc": 40, "tm": 507, "validForward": 141, "validReverse": 230, "productSize": 0, "deltaTm": 0, "eligiblePairs": 576, "exactChecked": 5, "exactRefused": 0 }, "settings": { "target": { "start": 201, "end": 400 }, "excluded": [], "forwardTail": "", "reverseTail": "", "conditions": { "oligo_nM": 250, "na_mM": 50, "mg_mM": 1.5, "dntp_mM": 0.2, "model": "primer-excess", "saltCorrection": "owczarzy-2008" }, "flank": 50, "minLength": 18, "maxLength": 26, "targetLength": 20, "minTm": 55, "maxTm": 68, "targetTm": 60.95, "maxDeltaTm": 3, "minGc": 30, "maxGc": 70, "minProduct": 180, "maxProduct": 420 }, "structures": [ { "kind": "forward hairpin", "evaluated": false, "dG37": null, "detail": "Not evaluated in this hand-authored reader-contract example." }, { "kind": "reverse hairpin", "evaluated": false, "dG37": null, "detail": "Not evaluated in this hand-authored reader-contract example." }, { "kind": "forward self-dimer", "evaluated": false, "dG37": null, "detail": "Not evaluated in this hand-authored reader-contract example." }, { "kind": "reverse self-dimer", "evaluated": false, "dG37": null, "detail": "Not evaluated in this hand-authored reader-contract example." }, { "kind": "cross-dimer", "evaluated": false, "dG37": null, "detail": "Not evaluated in this hand-authored reader-contract example." } ], "limitations": [ "Reader-contract fixture: no secondary structure calculation is represented." ], "temperatures": { "forward": { "value": 61.15758568510165, "method": "oligo-tm-nearest-neighbour", "version": "1.0.0", "saltCorrection": "owczarzy-2008", "conditions": { "oligo_nM": 250, "na_mM": 50, "k_mM": 0, "tris_mM": 0, "mg_mM": 1.5, "dntp_mM": 0, "model": "primer-excess", "saltCorrection": "owczarzy-2008" }, "limit": "Magnesium correction: Owczarzy 2008. Its free Mg²⁺ range, recalled as 0.5 to 600 mM, is Unverified: not yet checked against Owczarzy 2008.", "outside": [] }, "reverse": { "value": 61.11705567100347, "method": "oligo-tm-nearest-neighbour", "version": "1.0.0", "saltCorrection": "owczarzy-2008", "conditions": { "oligo_nM": 250, "na_mM": 50, "k_mM": 0, "tris_mM": 0, "mg_mM": 1.5, "dntp_mM": 0.2, "model": "primer-excess", "saltCorrection": "owczarzy-2008" }, "limit": "Magnesium correction: Owczarzy 2008. Its free Mg²⁺ range, recalled as 0.5 to 600 mM, is Unverified: not yet checked against Owczarzy 2008.", "outside": [] } } } } ], "expectedAccepted": false, "reason": "Retained ionic conditions contradict the saved requested conditions; reject the complete pair." }, { "id": "mg-reverse-retained-top-level-2004", "input": [ { "v": 1, "id": "effective-salt-design-lac-mg", "label": "Independent effective-salt reader example", "createdAt": "2026-10-11T00:00:00.000Z", "notes": "", "forward": { "annealing": "AAACGCGGGAAAAAGTGG", "tail": "" }, "reverse": { "annealing": "GGTCATCCAGCGGATAGTTA", "tail": "" }, "conditions": { "oligo_nM": 250, "na_mM": 50, "mg_mM": 1.5, "dntp_mM": 0.2, "model": "primer-excess", "saltCorrection": "owczarzy-2004" }, "witness": { "templateHash": "fd182829946e68ba90d7c14906883ef31f663537dade5f617f804b8ce46dc316", "templateLength": 600, "topology": "linear", "coordinates": "1-based-inclusive-5prime-to-3prime", "forward": { "strand": "+", "start": 176, "end": 193, "length": 18 }, "reverse": { "strand": "-", "start": 469, "end": 450, "length": 20 }, "productId": "+:176:193|-:469:450", "method": "exact-pair-v1" }, "design": { "method": "bounded-flanks-v2", "target": { "start": 201, "end": 400 }, "capped": true, "ranking": { "tmDeviation": 0.3746413561051156, "lengthDeviation": 0.4, "deltaTm": 0.0405300140981808, "total": 0.8151713702032964 }, "counts": { "windows": 918, "boundary": 0, "excluded": 0, "gc": 40, "tm": 507, "validForward": 141, "validReverse": 230, "productSize": 0, "deltaTm": 0, "eligiblePairs": 576, "exactChecked": 5, "exactRefused": 0 }, "settings": { "target": { "start": 201, "end": 400 }, "excluded": [], "forwardTail": "", "reverseTail": "", "conditions": { "oligo_nM": 250, "na_mM": 50, "mg_mM": 1.5, "dntp_mM": 0.2, "model": "primer-excess", "saltCorrection": "owczarzy-2004" }, "flank": 50, "minLength": 18, "maxLength": 26, "targetLength": 20, "minTm": 55, "maxTm": 68, "targetTm": 60.95, "maxDeltaTm": 3, "minGc": 30, "maxGc": 70, "minProduct": 180, "maxProduct": 420 }, "structures": [ { "kind": "forward hairpin", "evaluated": false, "dG37": null, "detail": "Not evaluated in this hand-authored reader-contract example." }, { "kind": "reverse hairpin", "evaluated": false, "dG37": null, "detail": "Not evaluated in this hand-authored reader-contract example." }, { "kind": "forward self-dimer", "evaluated": false, "dG37": null, "detail": "Not evaluated in this hand-authored reader-contract example." }, { "kind": "reverse self-dimer", "evaluated": false, "dG37": null, "detail": "Not evaluated in this hand-authored reader-contract example." }, { "kind": "cross-dimer", "evaluated": false, "dG37": null, "detail": "Not evaluated in this hand-authored reader-contract example." } ], "limitations": [ "Reader-contract fixture: no secondary structure calculation is represented." ], "temperatures": { "forward": { "value": 61.15758568510165, "method": "oligo-tm-nearest-neighbour", "version": "1.0.0", "saltCorrection": "owczarzy-2008", "conditions": { "oligo_nM": 250, "na_mM": 50, "k_mM": 0, "tris_mM": 0, "mg_mM": 1.5, "dntp_mM": 0.2, "model": "primer-excess", "saltCorrection": "owczarzy-2008" }, "limit": "Magnesium correction: Owczarzy 2008. Its free Mg²⁺ range, recalled as 0.5 to 600 mM, is Unverified: not yet checked against Owczarzy 2008.", "outside": [] }, "reverse": { "value": 61.11705567100347, "method": "oligo-tm-nearest-neighbour", "version": "1.0.0", "saltCorrection": "owczarzy-2004", "conditions": { "oligo_nM": 250, "na_mM": 50, "k_mM": 0, "tris_mM": 0, "mg_mM": 1.5, "dntp_mM": 0.2, "model": "primer-excess", "saltCorrection": "owczarzy-2008" }, "limit": "Magnesium correction: Owczarzy 2008. Its free Mg²⁺ range, recalled as 0.5 to 600 mM, is Unverified: not yet checked against Owczarzy 2008.", "outside": [] } } } } ], "expectedAccepted": false, "reason": "Retained correction is a literal scientific claim, not a request. Re-normalizing it would hide this contradiction." }, { "id": "mg-reverse-retained-nested-2004", "input": [ { "v": 1, "id": "effective-salt-design-lac-mg", "label": "Independent effective-salt reader example", "createdAt": "2026-10-11T00:00:00.000Z", "notes": "", "forward": { "annealing": "AAACGCGGGAAAAAGTGG", "tail": "" }, "reverse": { "annealing": "GGTCATCCAGCGGATAGTTA", "tail": "" }, "conditions": { "oligo_nM": 250, "na_mM": 50, "mg_mM": 1.5, "dntp_mM": 0.2, "model": "primer-excess", "saltCorrection": "owczarzy-2004" }, "witness": { "templateHash": "fd182829946e68ba90d7c14906883ef31f663537dade5f617f804b8ce46dc316", "templateLength": 600, "topology": "linear", "coordinates": "1-based-inclusive-5prime-to-3prime", "forward": { "strand": "+", "start": 176, "end": 193, "length": 18 }, "reverse": { "strand": "-", "start": 469, "end": 450, "length": 20 }, "productId": "+:176:193|-:469:450", "method": "exact-pair-v1" }, "design": { "method": "bounded-flanks-v2", "target": { "start": 201, "end": 400 }, "capped": true, "ranking": { "tmDeviation": 0.3746413561051156, "lengthDeviation": 0.4, "deltaTm": 0.0405300140981808, "total": 0.8151713702032964 }, "counts": { "windows": 918, "boundary": 0, "excluded": 0, "gc": 40, "tm": 507, "validForward": 141, "validReverse": 230, "productSize": 0, "deltaTm": 0, "eligiblePairs": 576, "exactChecked": 5, "exactRefused": 0 }, "settings": { "target": { "start": 201, "end": 400 }, "excluded": [], "forwardTail": "", "reverseTail": "", "conditions": { "oligo_nM": 250, "na_mM": 50, "mg_mM": 1.5, "dntp_mM": 0.2, "model": "primer-excess", "saltCorrection": "owczarzy-2004" }, "flank": 50, "minLength": 18, "maxLength": 26, "targetLength": 20, "minTm": 55, "maxTm": 68, "targetTm": 60.95, "maxDeltaTm": 3, "minGc": 30, "maxGc": 70, "minProduct": 180, "maxProduct": 420 }, "structures": [ { "kind": "forward hairpin", "evaluated": false, "dG37": null, "detail": "Not evaluated in this hand-authored reader-contract example." }, { "kind": "reverse hairpin", "evaluated": false, "dG37": null, "detail": "Not evaluated in this hand-authored reader-contract example." }, { "kind": "forward self-dimer", "evaluated": false, "dG37": null, "detail": "Not evaluated in this hand-authored reader-contract example." }, { "kind": "reverse self-dimer", "evaluated": false, "dG37": null, "detail": "Not evaluated in this hand-authored reader-contract example." }, { "kind": "cross-dimer", "evaluated": false, "dG37": null, "detail": "Not evaluated in this hand-authored reader-contract example." } ], "limitations": [ "Reader-contract fixture: no secondary structure calculation is represented." ], "temperatures": { "forward": { "value": 61.15758568510165, "method": "oligo-tm-nearest-neighbour", "version": "1.0.0", "saltCorrection": "owczarzy-2008", "conditions": { "oligo_nM": 250, "na_mM": 50, "k_mM": 0, "tris_mM": 0, "mg_mM": 1.5, "dntp_mM": 0.2, "model": "primer-excess", "saltCorrection": "owczarzy-2008" }, "limit": "Magnesium correction: Owczarzy 2008. Its free Mg²⁺ range, recalled as 0.5 to 600 mM, is Unverified: not yet checked against Owczarzy 2008.", "outside": [] }, "reverse": { "value": 61.11705567100347, "method": "oligo-tm-nearest-neighbour", "version": "1.0.0", "saltCorrection": "owczarzy-2008", "conditions": { "oligo_nM": 250, "na_mM": 50, "k_mM": 0, "tris_mM": 0, "mg_mM": 1.5, "dntp_mM": 0.2, "model": "primer-excess", "saltCorrection": "owczarzy-2004" }, "limit": "Magnesium correction: Owczarzy 2008. Its free Mg²⁺ range, recalled as 0.5 to 600 mM, is Unverified: not yet checked against Owczarzy 2008.", "outside": [] } } } } ], "expectedAccepted": false, "reason": "Retained correction is a literal scientific claim, not a request. Re-normalizing it would hide this contradiction." }, { "id": "mg-reverse-retained-both-2004", "input": [ { "v": 1, "id": "effective-salt-design-lac-mg", "label": "Independent effective-salt reader example", "createdAt": "2026-10-11T00:00:00.000Z", "notes": "", "forward": { "annealing": "AAACGCGGGAAAAAGTGG", "tail": "" }, "reverse": { "annealing": "GGTCATCCAGCGGATAGTTA", "tail": "" }, "conditions": { "oligo_nM": 250, "na_mM": 50, "mg_mM": 1.5, "dntp_mM": 0.2, "model": "primer-excess", "saltCorrection": "owczarzy-2004" }, "witness": { "templateHash": "fd182829946e68ba90d7c14906883ef31f663537dade5f617f804b8ce46dc316", "templateLength": 600, "topology": "linear", "coordinates": "1-based-inclusive-5prime-to-3prime", "forward": { "strand": "+", "start": 176, "end": 193, "length": 18 }, "reverse": { "strand": "-", "start": 469, "end": 450, "length": 20 }, "productId": "+:176:193|-:469:450", "method": "exact-pair-v1" }, "design": { "method": "bounded-flanks-v2", "target": { "start": 201, "end": 400 }, "capped": true, "ranking": { "tmDeviation": 0.3746413561051156, "lengthDeviation": 0.4, "deltaTm": 0.0405300140981808, "total": 0.8151713702032964 }, "counts": { "windows": 918, "boundary": 0, "excluded": 0, "gc": 40, "tm": 507, "validForward": 141, "validReverse": 230, "productSize": 0, "deltaTm": 0, "eligiblePairs": 576, "exactChecked": 5, "exactRefused": 0 }, "settings": { "target": { "start": 201, "end": 400 }, "excluded": [], "forwardTail": "", "reverseTail": "", "conditions": { "oligo_nM": 250, "na_mM": 50, "mg_mM": 1.5, "dntp_mM": 0.2, "model": "primer-excess", "saltCorrection": "owczarzy-2004" }, "flank": 50, "minLength": 18, "maxLength": 26, "targetLength": 20, "minTm": 55, "maxTm": 68, "targetTm": 60.95, "maxDeltaTm": 3, "minGc": 30, "maxGc": 70, "minProduct": 180, "maxProduct": 420 }, "structures": [ { "kind": "forward hairpin", "evaluated": false, "dG37": null, "detail": "Not evaluated in this hand-authored reader-contract example." }, { "kind": "reverse hairpin", "evaluated": false, "dG37": null, "detail": "Not evaluated in this hand-authored reader-contract example." }, { "kind": "forward self-dimer", "evaluated": false, "dG37": null, "detail": "Not evaluated in this hand-authored reader-contract example." }, { "kind": "reverse self-dimer", "evaluated": false, "dG37": null, "detail": "Not evaluated in this hand-authored reader-contract example." }, { "kind": "cross-dimer", "evaluated": false, "dG37": null, "detail": "Not evaluated in this hand-authored reader-contract example." } ], "limitations": [ "Reader-contract fixture: no secondary structure calculation is represented." ], "temperatures": { "forward": { "value": 61.15758568510165, "method": "oligo-tm-nearest-neighbour", "version": "1.0.0", "saltCorrection": "owczarzy-2008", "conditions": { "oligo_nM": 250, "na_mM": 50, "k_mM": 0, "tris_mM": 0, "mg_mM": 1.5, "dntp_mM": 0.2, "model": "primer-excess", "saltCorrection": "owczarzy-2008" }, "limit": "Magnesium correction: Owczarzy 2008. Its free Mg²⁺ range, recalled as 0.5 to 600 mM, is Unverified: not yet checked against Owczarzy 2008.", "outside": [] }, "reverse": { "value": 61.11705567100347, "method": "oligo-tm-nearest-neighbour", "version": "1.0.0", "saltCorrection": "owczarzy-2004", "conditions": { "oligo_nM": 250, "na_mM": 50, "k_mM": 0, "tris_mM": 0, "mg_mM": 1.5, "dntp_mM": 0.2, "model": "primer-excess", "saltCorrection": "owczarzy-2004" }, "limit": "Magnesium correction: Owczarzy 2008. Its free Mg²⁺ range, recalled as 0.5 to 600 mM, is Unverified: not yet checked against Owczarzy 2008.", "outside": [] } } } } ], "expectedAccepted": false, "reason": "Retained correction is a literal scientific claim, not a request. Re-normalizing it would hide this contradiction." }, { "id": "mg-reverse-wrong-mg_mM", "input": [ { "v": 1, "id": "effective-salt-design-lac-mg", "label": "Independent effective-salt reader example", "createdAt": "2026-10-11T00:00:00.000Z", "notes": "", "forward": { "annealing": "AAACGCGGGAAAAAGTGG", "tail": "" }, "reverse": { "annealing": "GGTCATCCAGCGGATAGTTA", "tail": "" }, "conditions": { "oligo_nM": 250, "na_mM": 50, "mg_mM": 1.5, "dntp_mM": 0.2, "model": "primer-excess", "saltCorrection": "owczarzy-2008" }, "witness": { "templateHash": "fd182829946e68ba90d7c14906883ef31f663537dade5f617f804b8ce46dc316", "templateLength": 600, "topology": "linear", "coordinates": "1-based-inclusive-5prime-to-3prime", "forward": { "strand": "+", "start": 176, "end": 193, "length": 18 }, "reverse": { "strand": "-", "start": 469, "end": 450, "length": 20 }, "productId": "+:176:193|-:469:450", "method": "exact-pair-v1" }, "design": { "method": "bounded-flanks-v2", "target": { "start": 201, "end": 400 }, "capped": true, "ranking": { "tmDeviation": 0.3746413561051156, "lengthDeviation": 0.4, "deltaTm": 0.0405300140981808, "total": 0.8151713702032964 }, "counts": { "windows": 918, "boundary": 0, "excluded": 0, "gc": 40, "tm": 507, "validForward": 141, "validReverse": 230, "productSize": 0, "deltaTm": 0, "eligiblePairs": 576, "exactChecked": 5, "exactRefused": 0 }, "settings": { "target": { "start": 201, "end": 400 }, "excluded": [], "forwardTail": "", "reverseTail": "", "conditions": { "oligo_nM": 250, "na_mM": 50, "mg_mM": 1.5, "dntp_mM": 0.2, "model": "primer-excess", "saltCorrection": "owczarzy-2008" }, "flank": 50, "minLength": 18, "maxLength": 26, "targetLength": 20, "minTm": 55, "maxTm": 68, "targetTm": 60.95, "maxDeltaTm": 3, "minGc": 30, "maxGc": 70, "minProduct": 180, "maxProduct": 420 }, "structures": [ { "kind": "forward hairpin", "evaluated": false, "dG37": null, "detail": "Not evaluated in this hand-authored reader-contract example." }, { "kind": "reverse hairpin", "evaluated": false, "dG37": null, "detail": "Not evaluated in this hand-authored reader-contract example." }, { "kind": "forward self-dimer", "evaluated": false, "dG37": null, "detail": "Not evaluated in this hand-authored reader-contract example." }, { "kind": "reverse self-dimer", "evaluated": false, "dG37": null, "detail": "Not evaluated in this hand-authored reader-contract example." }, { "kind": "cross-dimer", "evaluated": false, "dG37": null, "detail": "Not evaluated in this hand-authored reader-contract example." } ], "limitations": [ "Reader-contract fixture: no secondary structure calculation is represented." ], "temperatures": { "forward": { "value": 61.15758568510165, "method": "oligo-tm-nearest-neighbour", "version": "1.0.0", "saltCorrection": "owczarzy-2008", "conditions": { "oligo_nM": 250, "na_mM": 50, "k_mM": 0, "tris_mM": 0, "mg_mM": 1.5, "dntp_mM": 0.2, "model": "primer-excess", "saltCorrection": "owczarzy-2008" }, "limit": "Magnesium correction: Owczarzy 2008. Its free Mg²⁺ range, recalled as 0.5 to 600 mM, is Unverified: not yet checked against Owczarzy 2008.", "outside": [] }, "reverse": { "value": 61.11705567100347, "method": "oligo-tm-nearest-neighbour", "version": "1.0.0", "saltCorrection": "owczarzy-2008", "conditions": { "oligo_nM": 250, "na_mM": 50, "k_mM": 0, "tris_mM": 0, "mg_mM": 0, "dntp_mM": 0.2, "model": "primer-excess", "saltCorrection": "owczarzy-2008" }, "limit": "Magnesium correction: Owczarzy 2008. Its free Mg²⁺ range, recalled as 0.5 to 600 mM, is Unverified: not yet checked against Owczarzy 2008.", "outside": [] } } } } ], "expectedAccepted": false, "reason": "Retained ionic conditions contradict the saved requested conditions; reject the complete pair." }, { "id": "mg-reverse-wrong-dntp_mM", "input": [ { "v": 1, "id": "effective-salt-design-lac-mg", "label": "Independent effective-salt reader example", "createdAt": "2026-10-11T00:00:00.000Z", "notes": "", "forward": { "annealing": "AAACGCGGGAAAAAGTGG", "tail": "" }, "reverse": { "annealing": "GGTCATCCAGCGGATAGTTA", "tail": "" }, "conditions": { "oligo_nM": 250, "na_mM": 50, "mg_mM": 1.5, "dntp_mM": 0.2, "model": "primer-excess", "saltCorrection": "owczarzy-2008" }, "witness": { "templateHash": "fd182829946e68ba90d7c14906883ef31f663537dade5f617f804b8ce46dc316", "templateLength": 600, "topology": "linear", "coordinates": "1-based-inclusive-5prime-to-3prime", "forward": { "strand": "+", "start": 176, "end": 193, "length": 18 }, "reverse": { "strand": "-", "start": 469, "end": 450, "length": 20 }, "productId": "+:176:193|-:469:450", "method": "exact-pair-v1" }, "design": { "method": "bounded-flanks-v2", "target": { "start": 201, "end": 400 }, "capped": true, "ranking": { "tmDeviation": 0.3746413561051156, "lengthDeviation": 0.4, "deltaTm": 0.0405300140981808, "total": 0.8151713702032964 }, "counts": { "windows": 918, "boundary": 0, "excluded": 0, "gc": 40, "tm": 507, "validForward": 141, "validReverse": 230, "productSize": 0, "deltaTm": 0, "eligiblePairs": 576, "exactChecked": 5, "exactRefused": 0 }, "settings": { "target": { "start": 201, "end": 400 }, "excluded": [], "forwardTail": "", "reverseTail": "", "conditions": { "oligo_nM": 250, "na_mM": 50, "mg_mM": 1.5, "dntp_mM": 0.2, "model": "primer-excess", "saltCorrection": "owczarzy-2008" }, "flank": 50, "minLength": 18, "maxLength": 26, "targetLength": 20, "minTm": 55, "maxTm": 68, "targetTm": 60.95, "maxDeltaTm": 3, "minGc": 30, "maxGc": 70, "minProduct": 180, "maxProduct": 420 }, "structures": [ { "kind": "forward hairpin", "evaluated": false, "dG37": null, "detail": "Not evaluated in this hand-authored reader-contract example." }, { "kind": "reverse hairpin", "evaluated": false, "dG37": null, "detail": "Not evaluated in this hand-authored reader-contract example." }, { "kind": "forward self-dimer", "evaluated": false, "dG37": null, "detail": "Not evaluated in this hand-authored reader-contract example." }, { "kind": "reverse self-dimer", "evaluated": false, "dG37": null, "detail": "Not evaluated in this hand-authored reader-contract example." }, { "kind": "cross-dimer", "evaluated": false, "dG37": null, "detail": "Not evaluated in this hand-authored reader-contract example." } ], "limitations": [ "Reader-contract fixture: no secondary structure calculation is represented." ], "temperatures": { "forward": { "value": 61.15758568510165, "method": "oligo-tm-nearest-neighbour", "version": "1.0.0", "saltCorrection": "owczarzy-2008", "conditions": { "oligo_nM": 250, "na_mM": 50, "k_mM": 0, "tris_mM": 0, "mg_mM": 1.5, "dntp_mM": 0.2, "model": "primer-excess", "saltCorrection": "owczarzy-2008" }, "limit": "Magnesium correction: Owczarzy 2008. Its free Mg²⁺ range, recalled as 0.5 to 600 mM, is Unverified: not yet checked against Owczarzy 2008.", "outside": [] }, "reverse": { "value": 61.11705567100347, "method": "oligo-tm-nearest-neighbour", "version": "1.0.0", "saltCorrection": "owczarzy-2008", "conditions": { "oligo_nM": 250, "na_mM": 50, "k_mM": 0, "tris_mM": 0, "mg_mM": 1.5, "dntp_mM": 0, "model": "primer-excess", "saltCorrection": "owczarzy-2008" }, "limit": "Magnesium correction: Owczarzy 2008. Its free Mg²⁺ range, recalled as 0.5 to 600 mM, is Unverified: not yet checked against Owczarzy 2008.", "outside": [] } } } } ], "expectedAccepted": false, "reason": "Retained ionic conditions contradict the saved requested conditions; reject the complete pair." }, { "id": "zero-mg-request-2008-retains-2004", "input": [ { "v": 1, "id": "effective-salt-design-lac-linear", "label": "Independent effective-salt reader example", "createdAt": "2026-10-11T00:00:00.000Z", "notes": "", "forward": { "annealing": "CCAGCCACGTTTCTGCGAAA", "tail": "" }, "reverse": { "annealing": "TGCGCGAGAAGATTGTGCAC", "tail": "" }, "conditions": { "oligo_nM": 250, "na_mM": 50, "mg_mM": 0, "dntp_mM": 0, "model": "primer-excess", "saltCorrection": "owczarzy-2008" }, "witness": { "templateHash": "fd182829946e68ba90d7c14906883ef31f663537dade5f617f804b8ce46dc316", "templateLength": 600, "topology": "linear", "coordinates": "1-based-inclusive-5prime-to-3prime", "forward": { "strand": "+", "start": 158, "end": 177, "length": 20 }, "reverse": { "strand": "-", "start": 428, "end": 409, "length": 20 }, "productId": "+:158:177|-:428:409", "method": "exact-pair-v1" }, "design": { "method": "bounded-flanks-v2", "target": { "start": 201, "end": 400 }, "capped": true, "ranking": { "tmDeviation": 0.06462320381317, "lengthDeviation": 0.0, "deltaTm": 0.03260351198753142, "total": 0.09722671580070141 }, "counts": { "windows": 918, "boundary": 0, "excluded": 0, "gc": 40, "tm": 234, "validForward": 353, "validReverse": 291, "productSize": 0, "deltaTm": 0, "eligiblePairs": 576, "exactChecked": 5, "exactRefused": 0 }, "settings": { "target": { "start": 201, "end": 400 }, "excluded": [], "forwardTail": "", "reverseTail": "", "conditions": { "oligo_nM": 250, "na_mM": 50, "mg_mM": 0, "dntp_mM": 0, "model": "primer-excess", "saltCorrection": "owczarzy-2008" }, "flank": 50, "minLength": 18, "maxLength": 26, "targetLength": 20, "minTm": 55, "maxTm": 68, "targetTm": 59.95, "maxDeltaTm": 3, "minGc": 30, "maxGc": 70, "minProduct": 180, "maxProduct": 420 }, "structures": [ { "kind": "forward hairpin", "evaluated": false, "dG37": null, "detail": "Not evaluated in this hand-authored reader-contract example." }, { "kind": "reverse hairpin", "evaluated": false, "dG37": null, "detail": "Not evaluated in this hand-authored reader-contract example." }, { "kind": "forward self-dimer", "evaluated": false, "dG37": null, "detail": "Not evaluated in this hand-authored reader-contract example." }, { "kind": "reverse self-dimer", "evaluated": false, "dG37": null, "detail": "Not evaluated in this hand-authored reader-contract example." }, { "kind": "cross-dimer", "evaluated": false, "dG37": null, "detail": "Not evaluated in this hand-authored reader-contract example." } ], "limitations": [ "Reader-contract fixture: no secondary structure calculation is represented." ], "temperatures": { "forward": { "value": 59.99861335790035, "method": "oligo-tm-nearest-neighbour", "version": "1.0.0", "saltCorrection": "owczarzy-2004", "conditions": { "oligo_nM": 250, "na_mM": 50, "k_mM": 0, "tris_mM": 0, "mg_mM": 0, "dntp_mM": 0, "model": "primer-excess", "saltCorrection": "owczarzy-2004" }, "limit": "Monovalent correction: Owczarzy 2004, fitted at 69 mM to 1.02 M Na⁺. It is also used from 20 to 69 mM, an extrapolation whose error has not been established here: Owczarzy 2008 places typical PCR buffers (20 to 100 mM monovalent) where this equation applies.", "outside": [] }, "reverse": { "value": 59.96600984591282, "method": "oligo-tm-nearest-neighbour", "version": "1.0.0", "saltCorrection": "owczarzy-2004", "conditions": { "oligo_nM": 250, "na_mM": 50, "k_mM": 0, "tris_mM": 0, "mg_mM": 0, "dntp_mM": 0, "model": "primer-excess", "saltCorrection": "owczarzy-2004" }, "limit": "Monovalent correction: Owczarzy 2004, fitted at 69 mM to 1.02 M Na⁺. It is also used from 20 to 69 mM, an extrapolation whose error has not been established here: Owczarzy 2008 places typical PCR buffers (20 to 100 mM monovalent) where this equation applies.", "outside": [] } } } } ], "expectedAccepted": true, "reason": "With zero Mg the requested 2008 correction effective-selects 2004; both retained literal claims correctly say 2004.", "expectedRead": [ { "v": 1, "id": "effective-salt-design-lac-linear", "label": "Independent effective-salt reader example", "createdAt": "2026-10-11T00:00:00.000Z", "notes": "", "forward": { "annealing": "CCAGCCACGTTTCTGCGAAA", "tail": "" }, "reverse": { "annealing": "TGCGCGAGAAGATTGTGCAC", "tail": "" }, "conditions": { "oligo_nM": 250, "na_mM": 50, "mg_mM": 0, "dntp_mM": 0, "model": "primer-excess", "saltCorrection": "owczarzy-2008" }, "witness": { "templateHash": "fd182829946e68ba90d7c14906883ef31f663537dade5f617f804b8ce46dc316", "templateLength": 600, "topology": "linear", "coordinates": "1-based-inclusive-5prime-to-3prime", "forward": { "strand": "+", "start": 158, "end": 177, "length": 20 }, "reverse": { "strand": "-", "start": 428, "end": 409, "length": 20 }, "productId": "+:158:177|-:428:409", "method": "exact-pair-v1" }, "design": { "method": "bounded-flanks-v2", "target": { "start": 201, "end": 400 }, "capped": true, "ranking": { "tmDeviation": 0.06462320381317, "lengthDeviation": 0.0, "deltaTm": 0.03260351198753142, "total": 0.09722671580070141 }, "counts": { "windows": 918, "boundary": 0, "excluded": 0, "gc": 40, "tm": 234, "validForward": 353, "validReverse": 291, "productSize": 0, "deltaTm": 0, "eligiblePairs": 576, "exactChecked": 5, "exactRefused": 0 }, "settings": { "target": { "start": 201, "end": 400 }, "excluded": [], "forwardTail": "", "reverseTail": "", "conditions": { "oligo_nM": 250, "na_mM": 50, "mg_mM": 0, "dntp_mM": 0, "model": "primer-excess", "saltCorrection": "owczarzy-2008" }, "flank": 50, "minLength": 18, "maxLength": 26, "targetLength": 20, "minTm": 55, "maxTm": 68, "targetTm": 59.95, "maxDeltaTm": 3, "minGc": 30, "maxGc": 70, "minProduct": 180, "maxProduct": 420 }, "structures": [ { "kind": "forward hairpin", "evaluated": false, "dG37": null, "detail": "Not evaluated in this hand-authored reader-contract example." }, { "kind": "reverse hairpin", "evaluated": false, "dG37": null, "detail": "Not evaluated in this hand-authored reader-contract example." }, { "kind": "forward self-dimer", "evaluated": false, "dG37": null, "detail": "Not evaluated in this hand-authored reader-contract example." }, { "kind": "reverse self-dimer", "evaluated": false, "dG37": null, "detail": "Not evaluated in this hand-authored reader-contract example." }, { "kind": "cross-dimer", "evaluated": false, "dG37": null, "detail": "Not evaluated in this hand-authored reader-contract example." } ], "limitations": [ "Reader-contract fixture: no secondary structure calculation is represented." ], "temperatures": { "forward": { "value": 59.99861335790035, "method": "oligo-tm-nearest-neighbour", "version": "1.0.0", "saltCorrection": "owczarzy-2004", "conditions": { "oligo_nM": 250, "na_mM": 50, "k_mM": 0, "tris_mM": 0, "mg_mM": 0, "dntp_mM": 0, "model": "primer-excess", "saltCorrection": "owczarzy-2004" }, "limit": "Monovalent correction: Owczarzy 2004, fitted at 69 mM to 1.02 M Na⁺. It is also used from 20 to 69 mM, an extrapolation whose error has not been established here: Owczarzy 2008 places typical PCR buffers (20 to 100 mM monovalent) where this equation applies.", "outside": [] }, "reverse": { "value": 59.96600984591282, "method": "oligo-tm-nearest-neighbour", "version": "1.0.0", "saltCorrection": "owczarzy-2004", "conditions": { "oligo_nM": 250, "na_mM": 50, "k_mM": 0, "tris_mM": 0, "mg_mM": 0, "dntp_mM": 0, "model": "primer-excess", "saltCorrection": "owczarzy-2004" }, "limit": "Monovalent correction: Owczarzy 2004, fitted at 69 mM to 1.02 M Na⁺. It is also used from 20 to 69 mM, an extrapolation whose error has not been established here: Owczarzy 2008 places typical PCR buffers (20 to 100 mM monovalent) where this equation applies.", "outside": [] } } } } ] }, { "id": "zero-mg-forward-retained-top-level-2008", "input": [ { "v": 1, "id": "effective-salt-design-lac-linear", "label": "Independent effective-salt reader example", "createdAt": "2026-10-11T00:00:00.000Z", "notes": "", "forward": { "annealing": "CCAGCCACGTTTCTGCGAAA", "tail": "" }, "reverse": { "annealing": "TGCGCGAGAAGATTGTGCAC", "tail": "" }, "conditions": { "oligo_nM": 250, "na_mM": 50, "mg_mM": 0, "dntp_mM": 0, "model": "primer-excess", "saltCorrection": "owczarzy-2008" }, "witness": { "templateHash": "fd182829946e68ba90d7c14906883ef31f663537dade5f617f804b8ce46dc316", "templateLength": 600, "topology": "linear", "coordinates": "1-based-inclusive-5prime-to-3prime", "forward": { "strand": "+", "start": 158, "end": 177, "length": 20 }, "reverse": { "strand": "-", "start": 428, "end": 409, "length": 20 }, "productId": "+:158:177|-:428:409", "method": "exact-pair-v1" }, "design": { "method": "bounded-flanks-v2", "target": { "start": 201, "end": 400 }, "capped": true, "ranking": { "tmDeviation": 0.06462320381317, "lengthDeviation": 0.0, "deltaTm": 0.03260351198753142, "total": 0.09722671580070141 }, "counts": { "windows": 918, "boundary": 0, "excluded": 0, "gc": 40, "tm": 234, "validForward": 353, "validReverse": 291, "productSize": 0, "deltaTm": 0, "eligiblePairs": 576, "exactChecked": 5, "exactRefused": 0 }, "settings": { "target": { "start": 201, "end": 400 }, "excluded": [], "forwardTail": "", "reverseTail": "", "conditions": { "oligo_nM": 250, "na_mM": 50, "mg_mM": 0, "dntp_mM": 0, "model": "primer-excess", "saltCorrection": "owczarzy-2008" }, "flank": 50, "minLength": 18, "maxLength": 26, "targetLength": 20, "minTm": 55, "maxTm": 68, "targetTm": 59.95, "maxDeltaTm": 3, "minGc": 30, "maxGc": 70, "minProduct": 180, "maxProduct": 420 }, "structures": [ { "kind": "forward hairpin", "evaluated": false, "dG37": null, "detail": "Not evaluated in this hand-authored reader-contract example." }, { "kind": "reverse hairpin", "evaluated": false, "dG37": null, "detail": "Not evaluated in this hand-authored reader-contract example." }, { "kind": "forward self-dimer", "evaluated": false, "dG37": null, "detail": "Not evaluated in this hand-authored reader-contract example." }, { "kind": "reverse self-dimer", "evaluated": false, "dG37": null, "detail": "Not evaluated in this hand-authored reader-contract example." }, { "kind": "cross-dimer", "evaluated": false, "dG37": null, "detail": "Not evaluated in this hand-authored reader-contract example." } ], "limitations": [ "Reader-contract fixture: no secondary structure calculation is represented." ], "temperatures": { "forward": { "value": 59.99861335790035, "method": "oligo-tm-nearest-neighbour", "version": "1.0.0", "saltCorrection": "owczarzy-2008", "conditions": { "oligo_nM": 250, "na_mM": 50, "k_mM": 0, "tris_mM": 0, "mg_mM": 0, "dntp_mM": 0, "model": "primer-excess", "saltCorrection": "owczarzy-2004" }, "limit": "Monovalent correction: Owczarzy 2004, fitted at 69 mM to 1.02 M Na⁺. It is also used from 20 to 69 mM, an extrapolation whose error has not been established here: Owczarzy 2008 places typical PCR buffers (20 to 100 mM monovalent) where this equation applies.", "outside": [] }, "reverse": { "value": 59.96600984591282, "method": "oligo-tm-nearest-neighbour", "version": "1.0.0", "saltCorrection": "owczarzy-2004", "conditions": { "oligo_nM": 250, "na_mM": 50, "k_mM": 0, "tris_mM": 0, "mg_mM": 0, "dntp_mM": 0, "model": "primer-excess", "saltCorrection": "owczarzy-2004" }, "limit": "Monovalent correction: Owczarzy 2004, fitted at 69 mM to 1.02 M Na⁺. It is also used from 20 to 69 mM, an extrapolation whose error has not been established here: Owczarzy 2008 places typical PCR buffers (20 to 100 mM monovalent) where this equation applies.", "outside": [] } } } } ], "expectedAccepted": false, "reason": "Zero Mg requires an effective 2004 retained claim; never normalize an inconsistent retained 2008 claim into acceptance." }, { "id": "zero-mg-forward-retained-nested-2008", "input": [ { "v": 1, "id": "effective-salt-design-lac-linear", "label": "Independent effective-salt reader example", "createdAt": "2026-10-11T00:00:00.000Z", "notes": "", "forward": { "annealing": "CCAGCCACGTTTCTGCGAAA", "tail": "" }, "reverse": { "annealing": "TGCGCGAGAAGATTGTGCAC", "tail": "" }, "conditions": { "oligo_nM": 250, "na_mM": 50, "mg_mM": 0, "dntp_mM": 0, "model": "primer-excess", "saltCorrection": "owczarzy-2008" }, "witness": { "templateHash": "fd182829946e68ba90d7c14906883ef31f663537dade5f617f804b8ce46dc316", "templateLength": 600, "topology": "linear", "coordinates": "1-based-inclusive-5prime-to-3prime", "forward": { "strand": "+", "start": 158, "end": 177, "length": 20 }, "reverse": { "strand": "-", "start": 428, "end": 409, "length": 20 }, "productId": "+:158:177|-:428:409", "method": "exact-pair-v1" }, "design": { "method": "bounded-flanks-v2", "target": { "start": 201, "end": 400 }, "capped": true, "ranking": { "tmDeviation": 0.06462320381317, "lengthDeviation": 0.0, "deltaTm": 0.03260351198753142, "total": 0.09722671580070141 }, "counts": { "windows": 918, "boundary": 0, "excluded": 0, "gc": 40, "tm": 234, "validForward": 353, "validReverse": 291, "productSize": 0, "deltaTm": 0, "eligiblePairs": 576, "exactChecked": 5, "exactRefused": 0 }, "settings": { "target": { "start": 201, "end": 400 }, "excluded": [], "forwardTail": "", "reverseTail": "", "conditions": { "oligo_nM": 250, "na_mM": 50, "mg_mM": 0, "dntp_mM": 0, "model": "primer-excess", "saltCorrection": "owczarzy-2008" }, "flank": 50, "minLength": 18, "maxLength": 26, "targetLength": 20, "minTm": 55, "maxTm": 68, "targetTm": 59.95, "maxDeltaTm": 3, "minGc": 30, "maxGc": 70, "minProduct": 180, "maxProduct": 420 }, "structures": [ { "kind": "forward hairpin", "evaluated": false, "dG37": null, "detail": "Not evaluated in this hand-authored reader-contract example." }, { "kind": "reverse hairpin", "evaluated": false, "dG37": null, "detail": "Not evaluated in this hand-authored reader-contract example." }, { "kind": "forward self-dimer", "evaluated": false, "dG37": null, "detail": "Not evaluated in this hand-authored reader-contract example." }, { "kind": "reverse self-dimer", "evaluated": false, "dG37": null, "detail": "Not evaluated in this hand-authored reader-contract example." }, { "kind": "cross-dimer", "evaluated": false, "dG37": null, "detail": "Not evaluated in this hand-authored reader-contract example." } ], "limitations": [ "Reader-contract fixture: no secondary structure calculation is represented." ], "temperatures": { "forward": { "value": 59.99861335790035, "method": "oligo-tm-nearest-neighbour", "version": "1.0.0", "saltCorrection": "owczarzy-2004", "conditions": { "oligo_nM": 250, "na_mM": 50, "k_mM": 0, "tris_mM": 0, "mg_mM": 0, "dntp_mM": 0, "model": "primer-excess", "saltCorrection": "owczarzy-2008" }, "limit": "Monovalent correction: Owczarzy 2004, fitted at 69 mM to 1.02 M Na⁺. It is also used from 20 to 69 mM, an extrapolation whose error has not been established here: Owczarzy 2008 places typical PCR buffers (20 to 100 mM monovalent) where this equation applies.", "outside": [] }, "reverse": { "value": 59.96600984591282, "method": "oligo-tm-nearest-neighbour", "version": "1.0.0", "saltCorrection": "owczarzy-2004", "conditions": { "oligo_nM": 250, "na_mM": 50, "k_mM": 0, "tris_mM": 0, "mg_mM": 0, "dntp_mM": 0, "model": "primer-excess", "saltCorrection": "owczarzy-2004" }, "limit": "Monovalent correction: Owczarzy 2004, fitted at 69 mM to 1.02 M Na⁺. It is also used from 20 to 69 mM, an extrapolation whose error has not been established here: Owczarzy 2008 places typical PCR buffers (20 to 100 mM monovalent) where this equation applies.", "outside": [] } } } } ], "expectedAccepted": false, "reason": "Zero Mg requires an effective 2004 retained claim; never normalize an inconsistent retained 2008 claim into acceptance." }, { "id": "zero-mg-forward-retained-both-2008", "input": [ { "v": 1, "id": "effective-salt-design-lac-linear", "label": "Independent effective-salt reader example", "createdAt": "2026-10-11T00:00:00.000Z", "notes": "", "forward": { "annealing": "CCAGCCACGTTTCTGCGAAA", "tail": "" }, "reverse": { "annealing": "TGCGCGAGAAGATTGTGCAC", "tail": "" }, "conditions": { "oligo_nM": 250, "na_mM": 50, "mg_mM": 0, "dntp_mM": 0, "model": "primer-excess", "saltCorrection": "owczarzy-2008" }, "witness": { "templateHash": "fd182829946e68ba90d7c14906883ef31f663537dade5f617f804b8ce46dc316", "templateLength": 600, "topology": "linear", "coordinates": "1-based-inclusive-5prime-to-3prime", "forward": { "strand": "+", "start": 158, "end": 177, "length": 20 }, "reverse": { "strand": "-", "start": 428, "end": 409, "length": 20 }, "productId": "+:158:177|-:428:409", "method": "exact-pair-v1" }, "design": { "method": "bounded-flanks-v2", "target": { "start": 201, "end": 400 }, "capped": true, "ranking": { "tmDeviation": 0.06462320381317, "lengthDeviation": 0.0, "deltaTm": 0.03260351198753142, "total": 0.09722671580070141 }, "counts": { "windows": 918, "boundary": 0, "excluded": 0, "gc": 40, "tm": 234, "validForward": 353, "validReverse": 291, "productSize": 0, "deltaTm": 0, "eligiblePairs": 576, "exactChecked": 5, "exactRefused": 0 }, "settings": { "target": { "start": 201, "end": 400 }, "excluded": [], "forwardTail": "", "reverseTail": "", "conditions": { "oligo_nM": 250, "na_mM": 50, "mg_mM": 0, "dntp_mM": 0, "model": "primer-excess", "saltCorrection": "owczarzy-2008" }, "flank": 50, "minLength": 18, "maxLength": 26, "targetLength": 20, "minTm": 55, "maxTm": 68, "targetTm": 59.95, "maxDeltaTm": 3, "minGc": 30, "maxGc": 70, "minProduct": 180, "maxProduct": 420 }, "structures": [ { "kind": "forward hairpin", "evaluated": false, "dG37": null, "detail": "Not evaluated in this hand-authored reader-contract example." }, { "kind": "reverse hairpin", "evaluated": false, "dG37": null, "detail": "Not evaluated in this hand-authored reader-contract example." }, { "kind": "forward self-dimer", "evaluated": false, "dG37": null, "detail": "Not evaluated in this hand-authored reader-contract example." }, { "kind": "reverse self-dimer", "evaluated": false, "dG37": null, "detail": "Not evaluated in this hand-authored reader-contract example." }, { "kind": "cross-dimer", "evaluated": false, "dG37": null, "detail": "Not evaluated in this hand-authored reader-contract example." } ], "limitations": [ "Reader-contract fixture: no secondary structure calculation is represented." ], "temperatures": { "forward": { "value": 59.99861335790035, "method": "oligo-tm-nearest-neighbour", "version": "1.0.0", "saltCorrection": "owczarzy-2008", "conditions": { "oligo_nM": 250, "na_mM": 50, "k_mM": 0, "tris_mM": 0, "mg_mM": 0, "dntp_mM": 0, "model": "primer-excess", "saltCorrection": "owczarzy-2008" }, "limit": "Monovalent correction: Owczarzy 2004, fitted at 69 mM to 1.02 M Na⁺. It is also used from 20 to 69 mM, an extrapolation whose error has not been established here: Owczarzy 2008 places typical PCR buffers (20 to 100 mM monovalent) where this equation applies.", "outside": [] }, "reverse": { "value": 59.96600984591282, "method": "oligo-tm-nearest-neighbour", "version": "1.0.0", "saltCorrection": "owczarzy-2004", "conditions": { "oligo_nM": 250, "na_mM": 50, "k_mM": 0, "tris_mM": 0, "mg_mM": 0, "dntp_mM": 0, "model": "primer-excess", "saltCorrection": "owczarzy-2004" }, "limit": "Monovalent correction: Owczarzy 2004, fitted at 69 mM to 1.02 M Na⁺. It is also used from 20 to 69 mM, an extrapolation whose error has not been established here: Owczarzy 2008 places typical PCR buffers (20 to 100 mM monovalent) where this equation applies.", "outside": [] } } } } ], "expectedAccepted": false, "reason": "Zero Mg requires an effective 2004 retained claim; never normalize an inconsistent retained 2008 claim into acceptance." }, { "id": "zero-mg-reverse-retained-top-level-2008", "input": [ { "v": 1, "id": "effective-salt-design-lac-linear", "label": "Independent effective-salt reader example", "createdAt": "2026-10-11T00:00:00.000Z", "notes": "", "forward": { "annealing": "CCAGCCACGTTTCTGCGAAA", "tail": "" }, "reverse": { "annealing": "TGCGCGAGAAGATTGTGCAC", "tail": "" }, "conditions": { "oligo_nM": 250, "na_mM": 50, "mg_mM": 0, "dntp_mM": 0, "model": "primer-excess", "saltCorrection": "owczarzy-2008" }, "witness": { "templateHash": "fd182829946e68ba90d7c14906883ef31f663537dade5f617f804b8ce46dc316", "templateLength": 600, "topology": "linear", "coordinates": "1-based-inclusive-5prime-to-3prime", "forward": { "strand": "+", "start": 158, "end": 177, "length": 20 }, "reverse": { "strand": "-", "start": 428, "end": 409, "length": 20 }, "productId": "+:158:177|-:428:409", "method": "exact-pair-v1" }, "design": { "method": "bounded-flanks-v2", "target": { "start": 201, "end": 400 }, "capped": true, "ranking": { "tmDeviation": 0.06462320381317, "lengthDeviation": 0.0, "deltaTm": 0.03260351198753142, "total": 0.09722671580070141 }, "counts": { "windows": 918, "boundary": 0, "excluded": 0, "gc": 40, "tm": 234, "validForward": 353, "validReverse": 291, "productSize": 0, "deltaTm": 0, "eligiblePairs": 576, "exactChecked": 5, "exactRefused": 0 }, "settings": { "target": { "start": 201, "end": 400 }, "excluded": [], "forwardTail": "", "reverseTail": "", "conditions": { "oligo_nM": 250, "na_mM": 50, "mg_mM": 0, "dntp_mM": 0, "model": "primer-excess", "saltCorrection": "owczarzy-2008" }, "flank": 50, "minLength": 18, "maxLength": 26, "targetLength": 20, "minTm": 55, "maxTm": 68, "targetTm": 59.95, "maxDeltaTm": 3, "minGc": 30, "maxGc": 70, "minProduct": 180, "maxProduct": 420 }, "structures": [ { "kind": "forward hairpin", "evaluated": false, "dG37": null, "detail": "Not evaluated in this hand-authored reader-contract example." }, { "kind": "reverse hairpin", "evaluated": false, "dG37": null, "detail": "Not evaluated in this hand-authored reader-contract example." }, { "kind": "forward self-dimer", "evaluated": false, "dG37": null, "detail": "Not evaluated in this hand-authored reader-contract example." }, { "kind": "reverse self-dimer", "evaluated": false, "dG37": null, "detail": "Not evaluated in this hand-authored reader-contract example." }, { "kind": "cross-dimer", "evaluated": false, "dG37": null, "detail": "Not evaluated in this hand-authored reader-contract example." } ], "limitations": [ "Reader-contract fixture: no secondary structure calculation is represented." ], "temperatures": { "forward": { "value": 59.99861335790035, "method": "oligo-tm-nearest-neighbour", "version": "1.0.0", "saltCorrection": "owczarzy-2004", "conditions": { "oligo_nM": 250, "na_mM": 50, "k_mM": 0, "tris_mM": 0, "mg_mM": 0, "dntp_mM": 0, "model": "primer-excess", "saltCorrection": "owczarzy-2004" }, "limit": "Monovalent correction: Owczarzy 2004, fitted at 69 mM to 1.02 M Na⁺. It is also used from 20 to 69 mM, an extrapolation whose error has not been established here: Owczarzy 2008 places typical PCR buffers (20 to 100 mM monovalent) where this equation applies.", "outside": [] }, "reverse": { "value": 59.96600984591282, "method": "oligo-tm-nearest-neighbour", "version": "1.0.0", "saltCorrection": "owczarzy-2008", "conditions": { "oligo_nM": 250, "na_mM": 50, "k_mM": 0, "tris_mM": 0, "mg_mM": 0, "dntp_mM": 0, "model": "primer-excess", "saltCorrection": "owczarzy-2004" }, "limit": "Monovalent correction: Owczarzy 2004, fitted at 69 mM to 1.02 M Na⁺. It is also used from 20 to 69 mM, an extrapolation whose error has not been established here: Owczarzy 2008 places typical PCR buffers (20 to 100 mM monovalent) where this equation applies.", "outside": [] } } } } ], "expectedAccepted": false, "reason": "Zero Mg requires an effective 2004 retained claim; never normalize an inconsistent retained 2008 claim into acceptance." }, { "id": "zero-mg-reverse-retained-nested-2008", "input": [ { "v": 1, "id": "effective-salt-design-lac-linear", "label": "Independent effective-salt reader example", "createdAt": "2026-10-11T00:00:00.000Z", "notes": "", "forward": { "annealing": "CCAGCCACGTTTCTGCGAAA", "tail": "" }, "reverse": { "annealing": "TGCGCGAGAAGATTGTGCAC", "tail": "" }, "conditions": { "oligo_nM": 250, "na_mM": 50, "mg_mM": 0, "dntp_mM": 0, "model": "primer-excess", "saltCorrection": "owczarzy-2008" }, "witness": { "templateHash": "fd182829946e68ba90d7c14906883ef31f663537dade5f617f804b8ce46dc316", "templateLength": 600, "topology": "linear", "coordinates": "1-based-inclusive-5prime-to-3prime", "forward": { "strand": "+", "start": 158, "end": 177, "length": 20 }, "reverse": { "strand": "-", "start": 428, "end": 409, "length": 20 }, "productId": "+:158:177|-:428:409", "method": "exact-pair-v1" }, "design": { "method": "bounded-flanks-v2", "target": { "start": 201, "end": 400 }, "capped": true, "ranking": { "tmDeviation": 0.06462320381317, "lengthDeviation": 0.0, "deltaTm": 0.03260351198753142, "total": 0.09722671580070141 }, "counts": { "windows": 918, "boundary": 0, "excluded": 0, "gc": 40, "tm": 234, "validForward": 353, "validReverse": 291, "productSize": 0, "deltaTm": 0, "eligiblePairs": 576, "exactChecked": 5, "exactRefused": 0 }, "settings": { "target": { "start": 201, "end": 400 }, "excluded": [], "forwardTail": "", "reverseTail": "", "conditions": { "oligo_nM": 250, "na_mM": 50, "mg_mM": 0, "dntp_mM": 0, "model": "primer-excess", "saltCorrection": "owczarzy-2008" }, "flank": 50, "minLength": 18, "maxLength": 26, "targetLength": 20, "minTm": 55, "maxTm": 68, "targetTm": 59.95, "maxDeltaTm": 3, "minGc": 30, "maxGc": 70, "minProduct": 180, "maxProduct": 420 }, "structures": [ { "kind": "forward hairpin", "evaluated": false, "dG37": null, "detail": "Not evaluated in this hand-authored reader-contract example." }, { "kind": "reverse hairpin", "evaluated": false, "dG37": null, "detail": "Not evaluated in this hand-authored reader-contract example." }, { "kind": "forward self-dimer", "evaluated": false, "dG37": null, "detail": "Not evaluated in this hand-authored reader-contract example." }, { "kind": "reverse self-dimer", "evaluated": false, "dG37": null, "detail": "Not evaluated in this hand-authored reader-contract example." }, { "kind": "cross-dimer", "evaluated": false, "dG37": null, "detail": "Not evaluated in this hand-authored reader-contract example." } ], "limitations": [ "Reader-contract fixture: no secondary structure calculation is represented." ], "temperatures": { "forward": { "value": 59.99861335790035, "method": "oligo-tm-nearest-neighbour", "version": "1.0.0", "saltCorrection": "owczarzy-2004", "conditions": { "oligo_nM": 250, "na_mM": 50, "k_mM": 0, "tris_mM": 0, "mg_mM": 0, "dntp_mM": 0, "model": "primer-excess", "saltCorrection": "owczarzy-2004" }, "limit": "Monovalent correction: Owczarzy 2004, fitted at 69 mM to 1.02 M Na⁺. It is also used from 20 to 69 mM, an extrapolation whose error has not been established here: Owczarzy 2008 places typical PCR buffers (20 to 100 mM monovalent) where this equation applies.", "outside": [] }, "reverse": { "value": 59.96600984591282, "method": "oligo-tm-nearest-neighbour", "version": "1.0.0", "saltCorrection": "owczarzy-2004", "conditions": { "oligo_nM": 250, "na_mM": 50, "k_mM": 0, "tris_mM": 0, "mg_mM": 0, "dntp_mM": 0, "model": "primer-excess", "saltCorrection": "owczarzy-2008" }, "limit": "Monovalent correction: Owczarzy 2004, fitted at 69 mM to 1.02 M Na⁺. It is also used from 20 to 69 mM, an extrapolation whose error has not been established here: Owczarzy 2008 places typical PCR buffers (20 to 100 mM monovalent) where this equation applies.", "outside": [] } } } } ], "expectedAccepted": false, "reason": "Zero Mg requires an effective 2004 retained claim; never normalize an inconsistent retained 2008 claim into acceptance." }, { "id": "zero-mg-reverse-retained-both-2008", "input": [ { "v": 1, "id": "effective-salt-design-lac-linear", "label": "Independent effective-salt reader example", "createdAt": "2026-10-11T00:00:00.000Z", "notes": "", "forward": { "annealing": "CCAGCCACGTTTCTGCGAAA", "tail": "" }, "reverse": { "annealing": "TGCGCGAGAAGATTGTGCAC", "tail": "" }, "conditions": { "oligo_nM": 250, "na_mM": 50, "mg_mM": 0, "dntp_mM": 0, "model": "primer-excess", "saltCorrection": "owczarzy-2008" }, "witness": { "templateHash": "fd182829946e68ba90d7c14906883ef31f663537dade5f617f804b8ce46dc316", "templateLength": 600, "topology": "linear", "coordinates": "1-based-inclusive-5prime-to-3prime", "forward": { "strand": "+", "start": 158, "end": 177, "length": 20 }, "reverse": { "strand": "-", "start": 428, "end": 409, "length": 20 }, "productId": "+:158:177|-:428:409", "method": "exact-pair-v1" }, "design": { "method": "bounded-flanks-v2", "target": { "start": 201, "end": 400 }, "capped": true, "ranking": { "tmDeviation": 0.06462320381317, "lengthDeviation": 0.0, "deltaTm": 0.03260351198753142, "total": 0.09722671580070141 }, "counts": { "windows": 918, "boundary": 0, "excluded": 0, "gc": 40, "tm": 234, "validForward": 353, "validReverse": 291, "productSize": 0, "deltaTm": 0, "eligiblePairs": 576, "exactChecked": 5, "exactRefused": 0 }, "settings": { "target": { "start": 201, "end": 400 }, "excluded": [], "forwardTail": "", "reverseTail": "", "conditions": { "oligo_nM": 250, "na_mM": 50, "mg_mM": 0, "dntp_mM": 0, "model": "primer-excess", "saltCorrection": "owczarzy-2008" }, "flank": 50, "minLength": 18, "maxLength": 26, "targetLength": 20, "minTm": 55, "maxTm": 68, "targetTm": 59.95, "maxDeltaTm": 3, "minGc": 30, "maxGc": 70, "minProduct": 180, "maxProduct": 420 }, "structures": [ { "kind": "forward hairpin", "evaluated": false, "dG37": null, "detail": "Not evaluated in this hand-authored reader-contract example." }, { "kind": "reverse hairpin", "evaluated": false, "dG37": null, "detail": "Not evaluated in this hand-authored reader-contract example." }, { "kind": "forward self-dimer", "evaluated": false, "dG37": null, "detail": "Not evaluated in this hand-authored reader-contract example." }, { "kind": "reverse self-dimer", "evaluated": false, "dG37": null, "detail": "Not evaluated in this hand-authored reader-contract example." }, { "kind": "cross-dimer", "evaluated": false, "dG37": null, "detail": "Not evaluated in this hand-authored reader-contract example." } ], "limitations": [ "Reader-contract fixture: no secondary structure calculation is represented." ], "temperatures": { "forward": { "value": 59.99861335790035, "method": "oligo-tm-nearest-neighbour", "version": "1.0.0", "saltCorrection": "owczarzy-2004", "conditions": { "oligo_nM": 250, "na_mM": 50, "k_mM": 0, "tris_mM": 0, "mg_mM": 0, "dntp_mM": 0, "model": "primer-excess", "saltCorrection": "owczarzy-2004" }, "limit": "Monovalent correction: Owczarzy 2004, fitted at 69 mM to 1.02 M Na⁺. It is also used from 20 to 69 mM, an extrapolation whose error has not been established here: Owczarzy 2008 places typical PCR buffers (20 to 100 mM monovalent) where this equation applies.", "outside": [] }, "reverse": { "value": 59.96600984591282, "method": "oligo-tm-nearest-neighbour", "version": "1.0.0", "saltCorrection": "owczarzy-2008", "conditions": { "oligo_nM": 250, "na_mM": 50, "k_mM": 0, "tris_mM": 0, "mg_mM": 0, "dntp_mM": 0, "model": "primer-excess", "saltCorrection": "owczarzy-2008" }, "limit": "Monovalent correction: Owczarzy 2004, fitted at 69 mM to 1.02 M Na⁺. It is also used from 20 to 69 mM, an extrapolation whose error has not been established here: Owczarzy 2008 places typical PCR buffers (20 to 100 mM monovalent) where this equation applies.", "outside": [] } } } } ], "expectedAccepted": false, "reason": "Zero Mg requires an effective 2004 retained claim; never normalize an inconsistent retained 2008 claim into acceptance." }, { "id": "historical-v1-magnesium-no-injection", "input": [ { "v": 1, "id": "effective-salt-design-lac-mg", "label": "Independent effective-salt reader example", "createdAt": "2026-10-11T00:00:00.000Z", "notes": "", "forward": { "annealing": "AAACGCGGGAAAAAGTGG", "tail": "" }, "reverse": { "annealing": "GGTCATCCAGCGGATAGTTA", "tail": "" }, "conditions": { "oligo_nM": 250, "na_mM": 50, "mg_mM": 1.5, "dntp_mM": 0.2, "model": "primer-excess", "saltCorrection": "owczarzy-2004" }, "witness": { "templateHash": "fd182829946e68ba90d7c14906883ef31f663537dade5f617f804b8ce46dc316", "templateLength": 600, "topology": "linear", "coordinates": "1-based-inclusive-5prime-to-3prime", "forward": { "strand": "+", "start": 176, "end": 193, "length": 18 }, "reverse": { "strand": "-", "start": 469, "end": 450, "length": 20 }, "productId": "+:176:193|-:469:450", "method": "exact-pair-v1" }, "design": { "method": "bounded-flanks-v1", "target": { "start": 201, "end": 400 }, "capped": true, "ranking": { "tmDeviation": 0.3746413561051156, "lengthDeviation": 0.4, "deltaTm": 0.0405300140981808, "total": 0.8151713702032964 }, "counts": { "windows": 918, "boundary": 0, "excluded": 0, "gc": 40, "tm": 507, "validForward": 141, "validReverse": 230, "productSize": 0, "deltaTm": 0, "eligiblePairs": 576, "exactChecked": 5, "exactRefused": 0 }, "settings": { "target": { "start": 201, "end": 400 }, "excluded": [], "forwardTail": "", "reverseTail": "", "conditions": { "oligo_nM": 250, "na_mM": 50, "mg_mM": 1.5, "dntp_mM": 0.2, "model": "primer-excess", "saltCorrection": "owczarzy-2004" }, "flank": 50, "minLength": 18, "maxLength": 26, "targetLength": 20, "minTm": 55, "maxTm": 68, "targetTm": 60.95, "maxDeltaTm": 3, "minGc": 30, "maxGc": 70, "minProduct": 180, "maxProduct": 420 }, "structures": [ { "kind": "forward hairpin", "evaluated": false, "dG37": null, "detail": "Not evaluated in this hand-authored reader-contract example." }, { "kind": "reverse hairpin", "evaluated": false, "dG37": null, "detail": "Not evaluated in this hand-authored reader-contract example." }, { "kind": "forward self-dimer", "evaluated": false, "dG37": null, "detail": "Not evaluated in this hand-authored reader-contract example." }, { "kind": "reverse self-dimer", "evaluated": false, "dG37": null, "detail": "Not evaluated in this hand-authored reader-contract example." }, { "kind": "cross-dimer", "evaluated": false, "dG37": null, "detail": "Not evaluated in this hand-authored reader-contract example." } ], "limitations": [ "Reader-contract fixture: no secondary structure calculation is represented." ] } } ], "expectedAccepted": true, "reason": "Historical v1 lacking retained temperatures remains unchanged; never recompute or inject a current block.", "expectedRead": [ { "v": 1, "id": "effective-salt-design-lac-mg", "label": "Independent effective-salt reader example", "createdAt": "2026-10-11T00:00:00.000Z", "notes": "", "forward": { "annealing": "AAACGCGGGAAAAAGTGG", "tail": "" }, "reverse": { "annealing": "GGTCATCCAGCGGATAGTTA", "tail": "" }, "conditions": { "oligo_nM": 250, "na_mM": 50, "mg_mM": 1.5, "dntp_mM": 0.2, "model": "primer-excess", "saltCorrection": "owczarzy-2004" }, "witness": { "templateHash": "fd182829946e68ba90d7c14906883ef31f663537dade5f617f804b8ce46dc316", "templateLength": 600, "topology": "linear", "coordinates": "1-based-inclusive-5prime-to-3prime", "forward": { "strand": "+", "start": 176, "end": 193, "length": 18 }, "reverse": { "strand": "-", "start": 469, "end": 450, "length": 20 }, "productId": "+:176:193|-:469:450", "method": "exact-pair-v1" }, "design": { "method": "bounded-flanks-v1", "target": { "start": 201, "end": 400 }, "capped": true, "ranking": { "tmDeviation": 0.3746413561051156, "lengthDeviation": 0.4, "deltaTm": 0.0405300140981808, "total": 0.8151713702032964 }, "counts": { "windows": 918, "boundary": 0, "excluded": 0, "gc": 40, "tm": 507, "validForward": 141, "validReverse": 230, "productSize": 0, "deltaTm": 0, "eligiblePairs": 576, "exactChecked": 5, "exactRefused": 0 }, "settings": { "target": { "start": 201, "end": 400 }, "excluded": [], "forwardTail": "", "reverseTail": "", "conditions": { "oligo_nM": 250, "na_mM": 50, "mg_mM": 1.5, "dntp_mM": 0.2, "model": "primer-excess", "saltCorrection": "owczarzy-2004" }, "flank": 50, "minLength": 18, "maxLength": 26, "targetLength": 20, "minTm": 55, "maxTm": 68, "targetTm": 60.95, "maxDeltaTm": 3, "minGc": 30, "maxGc": 70, "minProduct": 180, "maxProduct": 420 }, "structures": [ { "kind": "forward hairpin", "evaluated": false, "dG37": null, "detail": "Not evaluated in this hand-authored reader-contract example." }, { "kind": "reverse hairpin", "evaluated": false, "dG37": null, "detail": "Not evaluated in this hand-authored reader-contract example." }, { "kind": "forward self-dimer", "evaluated": false, "dG37": null, "detail": "Not evaluated in this hand-authored reader-contract example." }, { "kind": "reverse self-dimer", "evaluated": false, "dG37": null, "detail": "Not evaluated in this hand-authored reader-contract example." }, { "kind": "cross-dimer", "evaluated": false, "dG37": null, "detail": "Not evaluated in this hand-authored reader-contract example." } ], "limitations": [ "Reader-contract fixture: no secondary structure calculation is represented." ] } } ] }, { "id": "magnesium-historical-text-unchanged", "input": [ { "v": 1, "id": "effective-salt-design-lac-mg", "label": "Independent effective-salt reader example", "createdAt": "2026-10-11T00:00:00.000Z", "notes": "", "forward": { "annealing": "AAACGCGGGAAAAAGTGG", "tail": "" }, "reverse": { "annealing": "GGTCATCCAGCGGATAGTTA", "tail": "" }, "conditions": { "oligo_nM": 250, "na_mM": 50, "mg_mM": 1.5, "dntp_mM": 0.2, "model": "primer-excess" }, "witness": { "templateHash": "fd182829946e68ba90d7c14906883ef31f663537dade5f617f804b8ce46dc316", "templateLength": 600, "topology": "linear", "coordinates": "1-based-inclusive-5prime-to-3prime", "forward": { "strand": "+", "start": 176, "end": 193, "length": 18 }, "reverse": { "strand": "-", "start": 469, "end": 450, "length": 20 }, "productId": "+:176:193|-:469:450", "method": "exact-pair-v1" }, "design": { "method": "bounded-flanks-v2", "target": { "start": 201, "end": 400 }, "capped": true, "ranking": { "tmDeviation": 0.3746413561051156, "lengthDeviation": 0.4, "deltaTm": 0.0405300140981808, "total": 0.8151713702032964 }, "counts": { "windows": 918, "boundary": 0, "excluded": 0, "gc": 40, "tm": 507, "validForward": 141, "validReverse": 230, "productSize": 0, "deltaTm": 0, "eligiblePairs": 576, "exactChecked": 5, "exactRefused": 0 }, "settings": { "target": { "start": 201, "end": 400 }, "excluded": [], "forwardTail": "", "reverseTail": "", "conditions": { "oligo_nM": 250, "na_mM": 50, "mg_mM": 1.5, "dntp_mM": 0.2, "model": "primer-excess" }, "flank": 50, "minLength": 18, "maxLength": 26, "targetLength": 20, "minTm": 55, "maxTm": 68, "targetTm": 60.95, "maxDeltaTm": 3, "minGc": 30, "maxGc": 70, "minProduct": 180, "maxProduct": 420 }, "structures": [ { "kind": "forward hairpin", "evaluated": false, "dG37": null, "detail": "Not evaluated in this hand-authored reader-contract example." }, { "kind": "reverse hairpin", "evaluated": false, "dG37": null, "detail": "Not evaluated in this hand-authored reader-contract example." }, { "kind": "forward self-dimer", "evaluated": false, "dG37": null, "detail": "Not evaluated in this hand-authored reader-contract example." }, { "kind": "reverse self-dimer", "evaluated": false, "dG37": null, "detail": "Not evaluated in this hand-authored reader-contract example." }, { "kind": "cross-dimer", "evaluated": false, "dG37": null, "detail": "Not evaluated in this hand-authored reader-contract example." } ], "limitations": [ "Reader-contract fixture: no secondary structure calculation is represented." ], "temperatures": { "forward": { "value": 61.15758568510165, "method": "oligo-tm-nearest-neighbour", "version": "1.0.0", "saltCorrection": "owczarzy-2008", "conditions": { "oligo_nM": 250, "na_mM": 50, "k_mM": 0, "tris_mM": 0, "mg_mM": 1.5, "dntp_mM": 0.2, "model": "primer-excess", "saltCorrection": "owczarzy-2008" }, "limit": "Historical magnesium qualification as saved.", "outside": [ "Historical note as saved." ] }, "reverse": { "value": 61.11705567100347, "method": "oligo-tm-nearest-neighbour", "version": "1.0.0", "saltCorrection": "owczarzy-2008", "conditions": { "oligo_nM": 250, "na_mM": 50, "k_mM": 0, "tris_mM": 0, "mg_mM": 1.5, "dntp_mM": 0.2, "model": "primer-excess", "saltCorrection": "owczarzy-2008" }, "limit": "Magnesium correction: Owczarzy 2008. Its free Mg²⁺ range, recalled as 0.5 to 600 mM, is Unverified: not yet checked against Owczarzy 2008.", "outside": [] } } } } ], "expectedAccepted": true, "reason": "Consistent retained conditions do not authorize rewriting saved qualification text or temperatures.", "expectedRead": [ { "v": 1, "id": "effective-salt-design-lac-mg", "label": "Independent effective-salt reader example", "createdAt": "2026-10-11T00:00:00.000Z", "notes": "", "forward": { "annealing": "AAACGCGGGAAAAAGTGG", "tail": "" }, "reverse": { "annealing": "GGTCATCCAGCGGATAGTTA", "tail": "" }, "conditions": { "oligo_nM": 250, "na_mM": 50, "mg_mM": 1.5, "dntp_mM": 0.2, "model": "primer-excess" }, "witness": { "templateHash": "fd182829946e68ba90d7c14906883ef31f663537dade5f617f804b8ce46dc316", "templateLength": 600, "topology": "linear", "coordinates": "1-based-inclusive-5prime-to-3prime", "forward": { "strand": "+", "start": 176, "end": 193, "length": 18 }, "reverse": { "strand": "-", "start": 469, "end": 450, "length": 20 }, "productId": "+:176:193|-:469:450", "method": "exact-pair-v1" }, "design": { "method": "bounded-flanks-v2", "target": { "start": 201, "end": 400 }, "capped": true, "ranking": { "tmDeviation": 0.3746413561051156, "lengthDeviation": 0.4, "deltaTm": 0.0405300140981808, "total": 0.8151713702032964 }, "counts": { "windows": 918, "boundary": 0, "excluded": 0, "gc": 40, "tm": 507, "validForward": 141, "validReverse": 230, "productSize": 0, "deltaTm": 0, "eligiblePairs": 576, "exactChecked": 5, "exactRefused": 0 }, "settings": { "target": { "start": 201, "end": 400 }, "excluded": [], "forwardTail": "", "reverseTail": "", "conditions": { "oligo_nM": 250, "na_mM": 50, "mg_mM": 1.5, "dntp_mM": 0.2, "model": "primer-excess" }, "flank": 50, "minLength": 18, "maxLength": 26, "targetLength": 20, "minTm": 55, "maxTm": 68, "targetTm": 60.95, "maxDeltaTm": 3, "minGc": 30, "maxGc": 70, "minProduct": 180, "maxProduct": 420 }, "structures": [ { "kind": "forward hairpin", "evaluated": false, "dG37": null, "detail": "Not evaluated in this hand-authored reader-contract example." }, { "kind": "reverse hairpin", "evaluated": false, "dG37": null, "detail": "Not evaluated in this hand-authored reader-contract example." }, { "kind": "forward self-dimer", "evaluated": false, "dG37": null, "detail": "Not evaluated in this hand-authored reader-contract example." }, { "kind": "reverse self-dimer", "evaluated": false, "dG37": null, "detail": "Not evaluated in this hand-authored reader-contract example." }, { "kind": "cross-dimer", "evaluated": false, "dG37": null, "detail": "Not evaluated in this hand-authored reader-contract example." } ], "limitations": [ "Reader-contract fixture: no secondary structure calculation is represented." ], "temperatures": { "forward": { "value": 61.15758568510165, "method": "oligo-tm-nearest-neighbour", "version": "1.0.0", "saltCorrection": "owczarzy-2008", "conditions": { "oligo_nM": 250, "na_mM": 50, "k_mM": 0, "tris_mM": 0, "mg_mM": 1.5, "dntp_mM": 0.2, "model": "primer-excess", "saltCorrection": "owczarzy-2008" }, "limit": "Historical magnesium qualification as saved.", "outside": [ "Historical note as saved." ] }, "reverse": { "value": 61.11705567100347, "method": "oligo-tm-nearest-neighbour", "version": "1.0.0", "saltCorrection": "owczarzy-2008", "conditions": { "oligo_nM": 250, "na_mM": 50, "k_mM": 0, "tris_mM": 0, "mg_mM": 1.5, "dntp_mM": 0.2, "model": "primer-excess", "saltCorrection": "owczarzy-2008" }, "limit": "Magnesium correction: Owczarzy 2008. Its free Mg²⁺ range, recalled as 0.5 to 600 mM, is Unverified: not yet checked against Owczarzy 2008.", "outside": [] } } } } ] } ] }