{ "about": { "title": "Primer-design v2 retained qualification contract proposal", "recordedOn": "2026-10-11", "oracle": "Biopython", "oracleVersion": "1.88", "scriptSha256": "379a69993c91f4183772571403223d4290d33b23b3358142ec0fd1e822a2b591", "sourceFixture": { "path": "public/verification/sequence-toolkit/0.5.0/primer-design.json", "sha256": "ce1239c060a57c39399d12362e625221081484a761e367c48bf60cd69983c6ec", "method": "bounded-flanks-v1" }, "method": "bounded-flanks-v2", "tmTolerance_C": 1e-06, "rankingTolerance": 1e-06, "gcTolerance": 1e-09, "boundary": "Computational agreement and declared disclosure policy only. No experimental accuracy, amplification, fitted-range validation or genome-specificity claim.", "independence": "No TypeScript is executed/imported. Existing immutable Python-derived v1 fixture supplies unchanged candidate/count/product/ranking expectations; every retained temperature is independently recalculated by Biopython. Display policy is manually transcribed, not experimentally validated.", "recordScope": "Reader examples are hand-authored structural records with declared dispositions, not secondary-structure or design-engine outputs. Consistency checks must not rerun Tm or inject missing historical metadata.", "integration": "Publish in a new unused fixture version before changing readers. Preserve immutable v1 file and its existing tight numerical assertions. For v1 compatibility assert pinned old method and current v2 separately; do not weaken method matching to arbitrary union.", "numericalTemperaturesChecked": 62 }, "declarationPolicy": { "measuredMonovalentRange_mM": [ 69, 1020 ], "monovalentNoExtraWarningRange_mM": [ 20, 1020 ], "recalledUnverifiedFreeMagnesiumRange_mM": [ 0.5, 600 ], "limitText": { "owczarzy-2004": "Monovalent correction: Owczarzy 2004, fitted at 69 mM to 1.02 M Na⁺. It is also used from 20 to 69 mM, an extrapolation whose error has not been established here: Owczarzy 2008 places typical PCR buffers (20 to 100 mM monovalent) where this equation applies.", "owczarzy-2008": "Magnesium correction: Owczarzy 2008. Its free Mg²⁺ range, recalled as 0.5 to 600 mM, is Unverified: not yet checked against Owczarzy 2008.", "santalucia-1998": "Entropy correction: SantaLucia 1998. Its fitted range has not yet been read against the paper." } }, "designCases": [ { "id": "design-hand-unique", "input": { "templateName": "hand-24", "template": "ATGACCTAGCTATTCGCTAGTCAC", "topology": "linear", "settings": { "target": { "start": 9, "end": 16 }, "excluded": [], "forwardTail": "AA", "reverseTail": "CG", "conditions": { "oligo_nM": 250, "na_mM": 50, "mg_mM": 0, "dntp_mM": 0, "model": "primer-excess", "saltCorrection": "owczarzy-2004" }, "flank": 0, "minLength": 8, "maxLength": 8, "targetLength": 8, "minTm": 0, "maxTm": 100, "targetTm": 40, "maxDeltaTm": 30, "minGc": 0, "maxGc": 100, "minProduct": 24, "maxProduct": 30 } }, "expected": { "method": "bounded-flanks-v2", "pcrMethod": "exact-pair-v1", "templateHash": "2e921837395a2a3194a559cbbef1cea25f272da48e86448e889d2a93ada8e2bc", "topology": "linear", "templateLength": 24, "pairs": [ { "id": "+:1:8|-:24:17", "forward": { "annealing": "ATGACCTA", "tail": "AA", "start": 1, "end": 8, "tm": 8.925696836801308, "gc": 37.5, "penalty": 31.074303163198692, "tmReview": { "value": 8.925696836801308, "method": "oligo-tm-nearest-neighbour", "version": "1.0.0", "saltCorrection": "owczarzy-2004", "conditions": { "oligo_nM": 250, "na_mM": 50, "k_mM": 0, "tris_mM": 0, "mg_mM": 0, "dntp_mM": 0, "model": "primer-excess", "saltCorrection": "owczarzy-2004" }, "limit": "Monovalent correction: Owczarzy 2004, fitted at 69 mM to 1.02 M Na⁺. It is also used from 20 to 69 mM, an extrapolation whose error has not been established here: Owczarzy 2008 places typical PCR buffers (20 to 100 mM monovalent) where this equation applies.", "outside": [] } }, "reverse": { "annealing": "GTGACTAG", "tail": "CG", "start": 24, "end": 17, "tm": 12.24154515770067, "gc": 50.0, "penalty": 27.75845484229933, "tmReview": { "value": 12.24154515770067, "method": "oligo-tm-nearest-neighbour", "version": "1.0.0", "saltCorrection": "owczarzy-2004", "conditions": { "oligo_nM": 250, "na_mM": 50, "k_mM": 0, "tris_mM": 0, "mg_mM": 0, "dntp_mM": 0, "model": "primer-excess", "saltCorrection": "owczarzy-2004" }, "limit": "Monovalent correction: Owczarzy 2004, fitted at 69 mM to 1.02 M Na⁺. It is also used from 20 to 69 mM, an extrapolation whose error has not been established here: Owczarzy 2008 places typical PCR buffers (20 to 100 mM monovalent) where this equation applies.", "outside": [] } }, "product": { "id": "+:1:8|-:24:17", "sequence": "AAATGACCTAGCTATTCGCTAGTCACCG", "length": 28, "templateLength": 24, "templateSpan": 24, "orientation": "+", "crossesOrigin": false, "forward": { "strand": "+", "start": 1, "end": 8, "length": 8 }, "reverse": { "strand": "-", "start": 24, "end": 17, "length": 8 } }, "ranking": { "tmDeviation": 58.83275800549802, "lengthDeviation": 0.0, "deltaTm": 3.315848320899363, "total": 62.148606326397385 }, "exactSites": { "forward": 1, "reverse": 1 }, "exactProducts": 1 } ], "counts": { "windows": 2, "boundary": 0, "excluded": 0, "gc": 0, "tm": 0, "validForward": 1, "validReverse": 1, "productSize": 0, "deltaTm": 0, "eligiblePairs": 1, "exactChecked": 1, "exactRefused": 0 }, "capped": false } }, { "id": "design-lac-linear", "input": { "templateName": "J01636.1 1..600", "template": "GACACCATCGAATGGCGCAAAACCTTTCGCGGTATGGCATGATAGCGCCCGGAAGAGAGTCAATTCAGGGTGGTGAATGTGAAACCAGTAACGTTATACGATGTCGCAGAGTATGCCGGTGTCTCTTATCAGACCGTTTCCCGCGTGGTGAACCAGGCCAGCCACGTTTCTGCGAAAACGCGGGAAAAAGTGGAAGCGGCGATGGCGGAGCTGAATTACATTCCCAACCGCGTGGCACAACAACTGGCGGGCAAACAGTCGTTGCTGATTGGCGTTGCCACCTCCAGTCTGGCCCTGCACGCGCCGTCGCAAATTGTCGCGGCGATTAAATCTCGCGCCGATCAACTGGGTGCCAGCGTGGTGGTGTCGATGGTAGAACGAAGCGGCGTCGAAGCCTGTAAAGCGGCGGTGCACAATCTTCTCGCGCAACGCGTCAGTGGGCTGATCATTAACTATCCGCTGGATGACCAGGATGCCATTGCTGTGGAAGCTGCCTGCACTAATGTTCCGGCGTTATTTCTTGATGTCTCTGACCAGACACCCATCAACAGTATTATTTTCTCCCATGAAGACGGTACGCGACTGGGCGTGGAGCATCTG", "topology": "linear", "settings": { "target": { "start": 201, "end": 400 }, "excluded": [], "forwardTail": "", "reverseTail": "", "conditions": { "oligo_nM": 250, "na_mM": 50, "mg_mM": 0, "dntp_mM": 0, "model": "primer-excess", "saltCorrection": "owczarzy-2004" }, "flank": 50, "minLength": 18, "maxLength": 26, "targetLength": 20, "minTm": 55, "maxTm": 68, "targetTm": 59.95, "maxDeltaTm": 3, "minGc": 30, "maxGc": 70, "minProduct": 180, "maxProduct": 420 } }, "expected": { "method": "bounded-flanks-v2", "pcrMethod": "exact-pair-v1", "templateHash": "fd182829946e68ba90d7c14906883ef31f663537dade5f617f804b8ce46dc316", "topology": "linear", "templateLength": 600, "pairs": [ { "id": "+:158:177|-:428:409", "forward": { "annealing": "CCAGCCACGTTTCTGCGAAA", "tail": "", "start": 158, "end": 177, "tm": 59.99861335790035, "gc": 55.0, "penalty": 0.04861335790035071, "tmReview": { "value": 59.99861335790035, "method": "oligo-tm-nearest-neighbour", "version": "1.0.0", "saltCorrection": "owczarzy-2004", "conditions": { "oligo_nM": 250, "na_mM": 50, "k_mM": 0, "tris_mM": 0, "mg_mM": 0, "dntp_mM": 0, "model": "primer-excess", "saltCorrection": "owczarzy-2004" }, "limit": "Monovalent correction: Owczarzy 2004, fitted at 69 mM to 1.02 M Na⁺. It is also used from 20 to 69 mM, an extrapolation whose error has not been established here: Owczarzy 2008 places typical PCR buffers (20 to 100 mM monovalent) where this equation applies.", "outside": [] } }, "reverse": { "annealing": "TGCGCGAGAAGATTGTGCAC", "tail": "", "start": 428, "end": 409, "tm": 59.96600984591282, "gc": 55.0, "penalty": 0.016009845912819287, "tmReview": { "value": 59.96600984591282, "method": "oligo-tm-nearest-neighbour", "version": "1.0.0", "saltCorrection": "owczarzy-2004", "conditions": { "oligo_nM": 250, "na_mM": 50, "k_mM": 0, "tris_mM": 0, "mg_mM": 0, "dntp_mM": 0, "model": "primer-excess", "saltCorrection": "owczarzy-2004" }, "limit": "Monovalent correction: Owczarzy 2004, fitted at 69 mM to 1.02 M Na⁺. It is also used from 20 to 69 mM, an extrapolation whose error has not been established here: Owczarzy 2008 places typical PCR buffers (20 to 100 mM monovalent) where this equation applies.", "outside": [] } }, "product": { "id": "+:158:177|-:428:409", "sequence": "CCAGCCACGTTTCTGCGAAAACGCGGGAAAAAGTGGAAGCGGCGATGGCGGAGCTGAATTACATTCCCAACCGCGTGGCACAACAACTGGCGGGCAAACAGTCGTTGCTGATTGGCGTTGCCACCTCCAGTCTGGCCCTGCACGCGCCGTCGCAAATTGTCGCGGCGATTAAATCTCGCGCCGATCAACTGGGTGCCAGCGTGGTGGTGTCGATGGTAGAACGAAGCGGCGTCGAAGCCTGTAAAGCGGCGGTGCACAATCTTCTCGCGCA", "length": 271, "templateLength": 600, "templateSpan": 271, "orientation": "+", "crossesOrigin": false, "forward": { "strand": "+", "start": 158, "end": 177, "length": 20 }, "reverse": { "strand": "-", "start": 428, "end": 409, "length": 20 } }, "ranking": { "tmDeviation": 0.06462320381317, "lengthDeviation": 0.0, "deltaTm": 0.03260351198753142, "total": 0.09722671580070141 }, "exactSites": { "forward": 1, "reverse": 1 }, "exactProducts": 1 }, { "id": "+:158:178|-:428:409", "forward": { "annealing": "CCAGCCACGTTTCTGCGAAAA", "tail": "", "start": 158, "end": 178, "tm": 59.93537222125224, "gc": 52.38095238095238, "penalty": 0.21462777874776579, "tmReview": { "value": 59.93537222125224, "method": "oligo-tm-nearest-neighbour", "version": "1.0.0", "saltCorrection": "owczarzy-2004", "conditions": { "oligo_nM": 250, "na_mM": 50, "k_mM": 0, "tris_mM": 0, "mg_mM": 0, "dntp_mM": 0, "model": "primer-excess", "saltCorrection": "owczarzy-2004" }, "limit": "Monovalent correction: Owczarzy 2004, fitted at 69 mM to 1.02 M Na⁺. It is also used from 20 to 69 mM, an extrapolation whose error has not been established here: Owczarzy 2008 places typical PCR buffers (20 to 100 mM monovalent) where this equation applies.", "outside": [] } }, "reverse": { "annealing": "TGCGCGAGAAGATTGTGCAC", "tail": "", "start": 428, "end": 409, "tm": 59.96600984591282, "gc": 55.0, "penalty": 0.016009845912819287, "tmReview": { "value": 59.96600984591282, "method": "oligo-tm-nearest-neighbour", "version": "1.0.0", "saltCorrection": "owczarzy-2004", "conditions": { "oligo_nM": 250, "na_mM": 50, "k_mM": 0, "tris_mM": 0, "mg_mM": 0, "dntp_mM": 0, "model": "primer-excess", "saltCorrection": "owczarzy-2004" }, "limit": "Monovalent correction: Owczarzy 2004, fitted at 69 mM to 1.02 M Na⁺. It is also used from 20 to 69 mM, an extrapolation whose error has not been established here: Owczarzy 2008 places typical PCR buffers (20 to 100 mM monovalent) where this equation applies.", "outside": [] } }, "product": { "id": "+:158:178|-:428:409", "sequence": "CCAGCCACGTTTCTGCGAAAACGCGGGAAAAAGTGGAAGCGGCGATGGCGGAGCTGAATTACATTCCCAACCGCGTGGCACAACAACTGGCGGGCAAACAGTCGTTGCTGATTGGCGTTGCCACCTCCAGTCTGGCCCTGCACGCGCCGTCGCAAATTGTCGCGGCGATTAAATCTCGCGCCGATCAACTGGGTGCCAGCGTGGTGGTGTCGATGGTAGAACGAAGCGGCGTCGAAGCCTGTAAAGCGGCGGTGCACAATCTTCTCGCGCA", "length": 271, "templateLength": 600, "templateSpan": 271, "orientation": "+", "crossesOrigin": false, "forward": { "strand": "+", "start": 158, "end": 178, "length": 21 }, "reverse": { "strand": "-", "start": 428, "end": 409, "length": 20 } }, "ranking": { "tmDeviation": 0.03063762466058506, "lengthDeviation": 0.2, "deltaTm": 0.03063762466058506, "total": 0.26127524932117013 }, "exactSites": { "forward": 1, "reverse": 1 }, "exactProducts": 1 }, { "id": "+:178:197|-:428:409", "forward": { "annealing": "ACGCGGGAAAAAGTGGAAGC", "tail": "", "start": 178, "end": 197, "tm": 60.09860053729648, "gc": 55.0, "penalty": 0.14860053729647404, "tmReview": { "value": 60.09860053729648, "method": "oligo-tm-nearest-neighbour", "version": "1.0.0", "saltCorrection": "owczarzy-2004", "conditions": { "oligo_nM": 250, "na_mM": 50, "k_mM": 0, "tris_mM": 0, "mg_mM": 0, "dntp_mM": 0, "model": "primer-excess", "saltCorrection": "owczarzy-2004" }, "limit": "Monovalent correction: Owczarzy 2004, fitted at 69 mM to 1.02 M Na⁺. It is also used from 20 to 69 mM, an extrapolation whose error has not been established here: Owczarzy 2008 places typical PCR buffers (20 to 100 mM monovalent) where this equation applies.", "outside": [] } }, "reverse": { "annealing": "TGCGCGAGAAGATTGTGCAC", "tail": "", "start": 428, "end": 409, "tm": 59.96600984591282, "gc": 55.0, "penalty": 0.016009845912819287, "tmReview": { "value": 59.96600984591282, "method": "oligo-tm-nearest-neighbour", "version": "1.0.0", "saltCorrection": "owczarzy-2004", "conditions": { "oligo_nM": 250, "na_mM": 50, "k_mM": 0, "tris_mM": 0, "mg_mM": 0, "dntp_mM": 0, "model": "primer-excess", "saltCorrection": "owczarzy-2004" }, "limit": "Monovalent correction: Owczarzy 2004, fitted at 69 mM to 1.02 M Na⁺. It is also used from 20 to 69 mM, an extrapolation whose error has not been established here: Owczarzy 2008 places typical PCR buffers (20 to 100 mM monovalent) where this equation applies.", "outside": [] } }, "product": { "id": "+:178:197|-:428:409", "sequence": "ACGCGGGAAAAAGTGGAAGCGGCGATGGCGGAGCTGAATTACATTCCCAACCGCGTGGCACAACAACTGGCGGGCAAACAGTCGTTGCTGATTGGCGTTGCCACCTCCAGTCTGGCCCTGCACGCGCCGTCGCAAATTGTCGCGGCGATTAAATCTCGCGCCGATCAACTGGGTGCCAGCGTGGTGGTGTCGATGGTAGAACGAAGCGGCGTCGAAGCCTGTAAAGCGGCGGTGCACAATCTTCTCGCGCA", "length": 251, "templateLength": 600, "templateSpan": 251, "orientation": "+", "crossesOrigin": false, "forward": { "strand": "+", "start": 178, "end": 197, "length": 20 }, "reverse": { "strand": "-", "start": 428, "end": 409, "length": 20 } }, "ranking": { "tmDeviation": 0.16461038320929333, "lengthDeviation": 0.0, "deltaTm": 0.13259069138365476, "total": 0.2972010745929481 }, "exactSites": { "forward": 1, "reverse": 1 }, "exactProducts": 1 }, { "id": "+:177:197|-:428:409", "forward": { "annealing": "AACGCGGGAAAAAGTGGAAGC", "tail": "", "start": 177, "end": 197, "tm": 60.03263800822515, "gc": 52.38095238095238, "penalty": 0.2826380082251461, "tmReview": { "value": 60.03263800822515, "method": "oligo-tm-nearest-neighbour", "version": "1.0.0", "saltCorrection": "owczarzy-2004", "conditions": { "oligo_nM": 250, "na_mM": 50, "k_mM": 0, "tris_mM": 0, "mg_mM": 0, "dntp_mM": 0, "model": "primer-excess", "saltCorrection": "owczarzy-2004" }, "limit": "Monovalent correction: Owczarzy 2004, fitted at 69 mM to 1.02 M Na⁺. It is also used from 20 to 69 mM, an extrapolation whose error has not been established here: Owczarzy 2008 places typical PCR buffers (20 to 100 mM monovalent) where this equation applies.", "outside": [] } }, "reverse": { "annealing": "TGCGCGAGAAGATTGTGCAC", "tail": "", "start": 428, "end": 409, "tm": 59.96600984591282, "gc": 55.0, "penalty": 0.016009845912819287, "tmReview": { "value": 59.96600984591282, "method": "oligo-tm-nearest-neighbour", "version": "1.0.0", "saltCorrection": "owczarzy-2004", "conditions": { "oligo_nM": 250, "na_mM": 50, "k_mM": 0, "tris_mM": 0, "mg_mM": 0, "dntp_mM": 0, "model": "primer-excess", "saltCorrection": "owczarzy-2004" }, "limit": "Monovalent correction: Owczarzy 2004, fitted at 69 mM to 1.02 M Na⁺. It is also used from 20 to 69 mM, an extrapolation whose error has not been established here: Owczarzy 2008 places typical PCR buffers (20 to 100 mM monovalent) where this equation applies.", "outside": [] } }, "product": { "id": "+:177:197|-:428:409", "sequence": "AACGCGGGAAAAAGTGGAAGCGGCGATGGCGGAGCTGAATTACATTCCCAACCGCGTGGCACAACAACTGGCGGGCAAACAGTCGTTGCTGATTGGCGTTGCCACCTCCAGTCTGGCCCTGCACGCGCCGTCGCAAATTGTCGCGGCGATTAAATCTCGCGCCGATCAACTGGGTGCCAGCGTGGTGGTGTCGATGGTAGAACGAAGCGGCGTCGAAGCCTGTAAAGCGGCGGTGCACAATCTTCTCGCGCA", "length": 252, "templateLength": 600, "templateSpan": 252, "orientation": "+", "crossesOrigin": false, "forward": { "strand": "+", "start": 177, "end": 197, "length": 21 }, "reverse": { "strand": "-", "start": 428, "end": 409, "length": 20 } }, "ranking": { "tmDeviation": 0.0986478541379654, "lengthDeviation": 0.2, "deltaTm": 0.06662816231232682, "total": 0.36527601645029223 }, "exactSites": { "forward": 1, "reverse": 1 }, "exactProducts": 1 }, { "id": "+:158:177|-:422:404", "forward": { "annealing": "CCAGCCACGTTTCTGCGAAA", "tail": "", "start": 158, "end": 177, "tm": 59.99861335790035, "gc": 55.0, "penalty": 0.04861335790035071, "tmReview": { "value": 59.99861335790035, "method": "oligo-tm-nearest-neighbour", "version": "1.0.0", "saltCorrection": "owczarzy-2004", "conditions": { "oligo_nM": 250, "na_mM": 50, "k_mM": 0, "tris_mM": 0, "mg_mM": 0, "dntp_mM": 0, "model": "primer-excess", "saltCorrection": "owczarzy-2004" }, "limit": "Monovalent correction: Owczarzy 2004, fitted at 69 mM to 1.02 M Na⁺. It is also used from 20 to 69 mM, an extrapolation whose error has not been established here: Owczarzy 2008 places typical PCR buffers (20 to 100 mM monovalent) where this equation applies.", "outside": [] } }, "reverse": { "annealing": "AGAAGATTGTGCACCGCCG", "tail": "", "start": 422, "end": 404, "tm": 59.914723905422534, "gc": 57.89473684210526, "penalty": 0.23527609457746906, "tmReview": { "value": 59.914723905422534, "method": "oligo-tm-nearest-neighbour", "version": "1.0.0", "saltCorrection": "owczarzy-2004", "conditions": { "oligo_nM": 250, "na_mM": 50, "k_mM": 0, "tris_mM": 0, "mg_mM": 0, "dntp_mM": 0, "model": "primer-excess", "saltCorrection": "owczarzy-2004" }, "limit": "Monovalent correction: Owczarzy 2004, fitted at 69 mM to 1.02 M Na⁺. It is also used from 20 to 69 mM, an extrapolation whose error has not been established here: Owczarzy 2008 places typical PCR buffers (20 to 100 mM monovalent) where this equation applies.", "outside": [] } }, "product": { "id": "+:158:177|-:422:404", "sequence": "CCAGCCACGTTTCTGCGAAAACGCGGGAAAAAGTGGAAGCGGCGATGGCGGAGCTGAATTACATTCCCAACCGCGTGGCACAACAACTGGCGGGCAAACAGTCGTTGCTGATTGGCGTTGCCACCTCCAGTCTGGCCCTGCACGCGCCGTCGCAAATTGTCGCGGCGATTAAATCTCGCGCCGATCAACTGGGTGCCAGCGTGGTGGTGTCGATGGTAGAACGAAGCGGCGTCGAAGCCTGTAAAGCGGCGGTGCACAATCTTCT", "length": 265, "templateLength": 600, "templateSpan": 265, "orientation": "+", "crossesOrigin": false, "forward": { "strand": "+", "start": 158, "end": 177, "length": 20 }, "reverse": { "strand": "-", "start": 422, "end": 404, "length": 19 } }, "ranking": { "tmDeviation": 0.08388945247781976, "lengthDeviation": 0.2, "deltaTm": 0.08388945247781976, "total": 0.36777890495563953 }, "exactSites": { "forward": 1, "reverse": 1 }, "exactProducts": 1 } ], "counts": { "windows": 918, "boundary": 0, "excluded": 0, "gc": 40, "tm": 234, "validForward": 353, "validReverse": 291, "productSize": 0, "deltaTm": 0, "eligiblePairs": 576, "exactChecked": 5, "exactRefused": 0 }, "capped": true } }, { "id": "design-lac-excluded", "input": { "templateName": "J01636.1 1..600", "template": "GACACCATCGAATGGCGCAAAACCTTTCGCGGTATGGCATGATAGCGCCCGGAAGAGAGTCAATTCAGGGTGGTGAATGTGAAACCAGTAACGTTATACGATGTCGCAGAGTATGCCGGTGTCTCTTATCAGACCGTTTCCCGCGTGGTGAACCAGGCCAGCCACGTTTCTGCGAAAACGCGGGAAAAAGTGGAAGCGGCGATGGCGGAGCTGAATTACATTCCCAACCGCGTGGCACAACAACTGGCGGGCAAACAGTCGTTGCTGATTGGCGTTGCCACCTCCAGTCTGGCCCTGCACGCGCCGTCGCAAATTGTCGCGGCGATTAAATCTCGCGCCGATCAACTGGGTGCCAGCGTGGTGGTGTCGATGGTAGAACGAAGCGGCGTCGAAGCCTGTAAAGCGGCGGTGCACAATCTTCTCGCGCAACGCGTCAGTGGGCTGATCATTAACTATCCGCTGGATGACCAGGATGCCATTGCTGTGGAAGCTGCCTGCACTAATGTTCCGGCGTTATTTCTTGATGTCTCTGACCAGACACCCATCAACAGTATTATTTTCTCCCATGAAGACGGTACGCGACTGGGCGTGGAGCATCTG", "topology": "linear", "settings": { "target": { "start": 201, "end": 400 }, "excluded": [ { "start": 120, "end": 170 }, { "start": 420, "end": 470 } ], "forwardTail": "", "reverseTail": "", "conditions": { "oligo_nM": 250, "na_mM": 50, "mg_mM": 0, "dntp_mM": 0, "model": "primer-excess", "saltCorrection": "owczarzy-2004" }, "flank": 50, "minLength": 18, "maxLength": 26, "targetLength": 20, "minTm": 55, "maxTm": 68, "targetTm": 62.0, "maxDeltaTm": 3, "minGc": 30, "maxGc": 70, "minProduct": 180, "maxProduct": 420 } }, "expected": { "method": "bounded-flanks-v2", "pcrMethod": "exact-pair-v1", "templateHash": "fd182829946e68ba90d7c14906883ef31f663537dade5f617f804b8ce46dc316", "topology": "linear", "templateLength": 600, "pairs": [ { "id": "+:172:194|-:419:401", "forward": { "annealing": "GCGAAAACGCGGGAAAAAGTGGA", "tail": "", "start": 172, "end": 194, "tm": 62.14537329359223, "gc": 52.17391304347826, "penalty": 0.745373293592229, "tmReview": { "value": 62.14537329359223, "method": "oligo-tm-nearest-neighbour", "version": "1.0.0", "saltCorrection": "owczarzy-2004", "conditions": { "oligo_nM": 250, "na_mM": 50, "k_mM": 0, "tris_mM": 0, "mg_mM": 0, "dntp_mM": 0, "model": "primer-excess", "saltCorrection": "owczarzy-2004" }, "limit": "Monovalent correction: Owczarzy 2004, fitted at 69 mM to 1.02 M Na⁺. It is also used from 20 to 69 mM, an extrapolation whose error has not been established here: Owczarzy 2008 places typical PCR buffers (20 to 100 mM monovalent) where this equation applies.", "outside": [] } }, "reverse": { "annealing": "AGATTGTGCACCGCCGCTT", "tail": "", "start": 419, "end": 401, "tm": 62.113664810140506, "gc": 57.89473684210526, "penalty": 0.3136648101405058, "tmReview": { "value": 62.113664810140506, "method": "oligo-tm-nearest-neighbour", "version": "1.0.0", "saltCorrection": "owczarzy-2004", "conditions": { "oligo_nM": 250, "na_mM": 50, "k_mM": 0, "tris_mM": 0, "mg_mM": 0, "dntp_mM": 0, "model": "primer-excess", "saltCorrection": "owczarzy-2004" }, "limit": "Monovalent correction: Owczarzy 2004, fitted at 69 mM to 1.02 M Na⁺. It is also used from 20 to 69 mM, an extrapolation whose error has not been established here: Owczarzy 2008 places typical PCR buffers (20 to 100 mM monovalent) where this equation applies.", "outside": [] } }, "product": { "id": "+:172:194|-:419:401", "sequence": "GCGAAAACGCGGGAAAAAGTGGAAGCGGCGATGGCGGAGCTGAATTACATTCCCAACCGCGTGGCACAACAACTGGCGGGCAAACAGTCGTTGCTGATTGGCGTTGCCACCTCCAGTCTGGCCCTGCACGCGCCGTCGCAAATTGTCGCGGCGATTAAATCTCGCGCCGATCAACTGGGTGCCAGCGTGGTGGTGTCGATGGTAGAACGAAGCGGCGTCGAAGCCTGTAAAGCGGCGGTGCACAATCT", "length": 248, "templateLength": 600, "templateSpan": 248, "orientation": "+", "crossesOrigin": false, "forward": { "strand": "+", "start": 172, "end": 194, "length": 23 }, "reverse": { "strand": "-", "start": 419, "end": 401, "length": 19 } }, "ranking": { "tmDeviation": 0.2590381037327347, "lengthDeviation": 0.8, "deltaTm": 0.03170848345172317, "total": 1.090746587184458 }, "exactSites": { "forward": 1, "reverse": 1 }, "exactProducts": 1 }, { "id": "+:176:198|-:419:401", "forward": { "annealing": "AAACGCGGGAAAAAGTGGAAGCG", "tail": "", "start": 176, "end": 198, "tm": 62.18249482665317, "gc": 52.17391304347826, "penalty": 0.7824948266531693, "tmReview": { "value": 62.18249482665317, "method": "oligo-tm-nearest-neighbour", "version": "1.0.0", "saltCorrection": "owczarzy-2004", "conditions": { "oligo_nM": 250, "na_mM": 50, "k_mM": 0, "tris_mM": 0, "mg_mM": 0, "dntp_mM": 0, "model": "primer-excess", "saltCorrection": "owczarzy-2004" }, "limit": "Monovalent correction: Owczarzy 2004, fitted at 69 mM to 1.02 M Na⁺. It is also used from 20 to 69 mM, an extrapolation whose error has not been established here: Owczarzy 2008 places typical PCR buffers (20 to 100 mM monovalent) where this equation applies.", "outside": [] } }, "reverse": { "annealing": "AGATTGTGCACCGCCGCTT", "tail": "", "start": 419, "end": 401, "tm": 62.113664810140506, "gc": 57.89473684210526, "penalty": 0.3136648101405058, "tmReview": { "value": 62.113664810140506, "method": "oligo-tm-nearest-neighbour", "version": "1.0.0", "saltCorrection": "owczarzy-2004", "conditions": { "oligo_nM": 250, "na_mM": 50, "k_mM": 0, "tris_mM": 0, "mg_mM": 0, "dntp_mM": 0, "model": "primer-excess", "saltCorrection": "owczarzy-2004" }, "limit": "Monovalent correction: Owczarzy 2004, fitted at 69 mM to 1.02 M Na⁺. It is also used from 20 to 69 mM, an extrapolation whose error has not been established here: Owczarzy 2008 places typical PCR buffers (20 to 100 mM monovalent) where this equation applies.", "outside": [] } }, "product": { "id": "+:176:198|-:419:401", "sequence": "AAACGCGGGAAAAAGTGGAAGCGGCGATGGCGGAGCTGAATTACATTCCCAACCGCGTGGCACAACAACTGGCGGGCAAACAGTCGTTGCTGATTGGCGTTGCCACCTCCAGTCTGGCCCTGCACGCGCCGTCGCAAATTGTCGCGGCGATTAAATCTCGCGCCGATCAACTGGGTGCCAGCGTGGTGGTGTCGATGGTAGAACGAAGCGGCGTCGAAGCCTGTAAAGCGGCGGTGCACAATCT", "length": 244, "templateLength": 600, "templateSpan": 244, "orientation": "+", "crossesOrigin": false, "forward": { "strand": "+", "start": 176, "end": 198, "length": 23 }, "reverse": { "strand": "-", "start": 419, "end": 401, "length": 19 } }, "ranking": { "tmDeviation": 0.29615963679367496, "lengthDeviation": 0.8, "deltaTm": 0.0688300165126634, "total": 1.1649896533063384 }, "exactSites": { "forward": 1, "reverse": 1 }, "exactProducts": 1 }, { "id": "+:175:198|-:419:401", "forward": { "annealing": "AAAACGCGGGAAAAAGTGGAAGCG", "tail": "", "start": 175, "end": 198, "tm": 62.03527481139599, "gc": 50.0, "penalty": 0.8352748113959934, "tmReview": { "value": 62.03527481139599, "method": "oligo-tm-nearest-neighbour", "version": "1.0.0", "saltCorrection": "owczarzy-2004", "conditions": { "oligo_nM": 250, "na_mM": 50, "k_mM": 0, "tris_mM": 0, "mg_mM": 0, "dntp_mM": 0, "model": "primer-excess", "saltCorrection": "owczarzy-2004" }, "limit": "Monovalent correction: Owczarzy 2004, fitted at 69 mM to 1.02 M Na⁺. It is also used from 20 to 69 mM, an extrapolation whose error has not been established here: Owczarzy 2008 places typical PCR buffers (20 to 100 mM monovalent) where this equation applies.", "outside": [] } }, "reverse": { "annealing": "AGATTGTGCACCGCCGCTT", "tail": "", "start": 419, "end": 401, "tm": 62.113664810140506, "gc": 57.89473684210526, "penalty": 0.3136648101405058, "tmReview": { "value": 62.113664810140506, "method": "oligo-tm-nearest-neighbour", "version": "1.0.0", "saltCorrection": "owczarzy-2004", "conditions": { "oligo_nM": 250, "na_mM": 50, "k_mM": 0, "tris_mM": 0, "mg_mM": 0, "dntp_mM": 0, "model": "primer-excess", "saltCorrection": "owczarzy-2004" }, "limit": "Monovalent correction: Owczarzy 2004, fitted at 69 mM to 1.02 M Na⁺. It is also used from 20 to 69 mM, an extrapolation whose error has not been established here: Owczarzy 2008 places typical PCR buffers (20 to 100 mM monovalent) where this equation applies.", "outside": [] } }, "product": { "id": "+:175:198|-:419:401", "sequence": "AAAACGCGGGAAAAAGTGGAAGCGGCGATGGCGGAGCTGAATTACATTCCCAACCGCGTGGCACAACAACTGGCGGGCAAACAGTCGTTGCTGATTGGCGTTGCCACCTCCAGTCTGGCCCTGCACGCGCCGTCGCAAATTGTCGCGGCGATTAAATCTCGCGCCGATCAACTGGGTGCCAGCGTGGTGGTGTCGATGGTAGAACGAAGCGGCGTCGAAGCCTGTAAAGCGGCGGTGCACAATCT", "length": 245, "templateLength": 600, "templateSpan": 245, "orientation": "+", "crossesOrigin": false, "forward": { "strand": "+", "start": 175, "end": 198, "length": 24 }, "reverse": { "strand": "-", "start": 419, "end": 401, "length": 19 } }, "ranking": { "tmDeviation": 0.1489396215364991, "lengthDeviation": 1.0, "deltaTm": 0.07838999874451247, "total": 1.2273296202810116 }, "exactSites": { "forward": 1, "reverse": 1 }, "exactProducts": 1 }, { "id": "+:172:195|-:419:401", "forward": { "annealing": "GCGAAAACGCGGGAAAAAGTGGAA", "tail": "", "start": 172, "end": 195, "tm": 61.99935292676395, "gc": 50.0, "penalty": 0.8006470732360527, "tmReview": { "value": 61.99935292676395, "method": "oligo-tm-nearest-neighbour", "version": "1.0.0", "saltCorrection": "owczarzy-2004", "conditions": { "oligo_nM": 250, "na_mM": 50, "k_mM": 0, "tris_mM": 0, "mg_mM": 0, "dntp_mM": 0, "model": "primer-excess", "saltCorrection": "owczarzy-2004" }, "limit": "Monovalent correction: Owczarzy 2004, fitted at 69 mM to 1.02 M Na⁺. It is also used from 20 to 69 mM, an extrapolation whose error has not been established here: Owczarzy 2008 places typical PCR buffers (20 to 100 mM monovalent) where this equation applies.", "outside": [] } }, "reverse": { "annealing": "AGATTGTGCACCGCCGCTT", "tail": "", "start": 419, "end": 401, "tm": 62.113664810140506, "gc": 57.89473684210526, "penalty": 0.3136648101405058, "tmReview": { "value": 62.113664810140506, "method": "oligo-tm-nearest-neighbour", "version": "1.0.0", "saltCorrection": "owczarzy-2004", "conditions": { "oligo_nM": 250, "na_mM": 50, "k_mM": 0, "tris_mM": 0, "mg_mM": 0, "dntp_mM": 0, "model": "primer-excess", "saltCorrection": "owczarzy-2004" }, "limit": "Monovalent correction: Owczarzy 2004, fitted at 69 mM to 1.02 M Na⁺. It is also used from 20 to 69 mM, an extrapolation whose error has not been established here: Owczarzy 2008 places typical PCR buffers (20 to 100 mM monovalent) where this equation applies.", "outside": [] } }, "product": { "id": "+:172:195|-:419:401", "sequence": "GCGAAAACGCGGGAAAAAGTGGAAGCGGCGATGGCGGAGCTGAATTACATTCCCAACCGCGTGGCACAACAACTGGCGGGCAAACAGTCGTTGCTGATTGGCGTTGCCACCTCCAGTCTGGCCCTGCACGCGCCGTCGCAAATTGTCGCGGCGATTAAATCTCGCGCCGATCAACTGGGTGCCAGCGTGGTGGTGTCGATGGTAGAACGAAGCGGCGTCGAAGCCTGTAAAGCGGCGGTGCACAATCT", "length": 248, "templateLength": 600, "templateSpan": 248, "orientation": "+", "crossesOrigin": false, "forward": { "strand": "+", "start": 172, "end": 195, "length": 24 }, "reverse": { "strand": "-", "start": 419, "end": 401, "length": 19 } }, "ranking": { "tmDeviation": 0.1143118833765584, "lengthDeviation": 1.0, "deltaTm": 0.1143118833765584, "total": 1.2286237667531168 }, "exactSites": { "forward": 1, "reverse": 1 }, "exactProducts": 1 }, { "id": "+:177:198|-:419:401", "forward": { "annealing": "AACGCGGGAAAAAGTGGAAGCG", "tail": "", "start": 177, "end": 198, "tm": 62.34357931563284, "gc": 54.54545454545455, "penalty": 0.7435793156328373, "tmReview": { "value": 62.34357931563284, "method": "oligo-tm-nearest-neighbour", "version": "1.0.0", "saltCorrection": "owczarzy-2004", "conditions": { "oligo_nM": 250, "na_mM": 50, "k_mM": 0, "tris_mM": 0, "mg_mM": 0, "dntp_mM": 0, "model": "primer-excess", "saltCorrection": "owczarzy-2004" }, "limit": "Monovalent correction: Owczarzy 2004, fitted at 69 mM to 1.02 M Na⁺. It is also used from 20 to 69 mM, an extrapolation whose error has not been established here: Owczarzy 2008 places typical PCR buffers (20 to 100 mM monovalent) where this equation applies.", "outside": [] } }, "reverse": { "annealing": "AGATTGTGCACCGCCGCTT", "tail": "", "start": 419, "end": 401, "tm": 62.113664810140506, "gc": 57.89473684210526, "penalty": 0.3136648101405058, "tmReview": { "value": 62.113664810140506, "method": "oligo-tm-nearest-neighbour", "version": "1.0.0", "saltCorrection": "owczarzy-2004", "conditions": { "oligo_nM": 250, "na_mM": 50, "k_mM": 0, "tris_mM": 0, "mg_mM": 0, "dntp_mM": 0, "model": "primer-excess", "saltCorrection": "owczarzy-2004" }, "limit": "Monovalent correction: Owczarzy 2004, fitted at 69 mM to 1.02 M Na⁺. It is also used from 20 to 69 mM, an extrapolation whose error has not been established here: Owczarzy 2008 places typical PCR buffers (20 to 100 mM monovalent) where this equation applies.", "outside": [] } }, "product": { "id": "+:177:198|-:419:401", "sequence": "AACGCGGGAAAAAGTGGAAGCGGCGATGGCGGAGCTGAATTACATTCCCAACCGCGTGGCACAACAACTGGCGGGCAAACAGTCGTTGCTGATTGGCGTTGCCACCTCCAGTCTGGCCCTGCACGCGCCGTCGCAAATTGTCGCGGCGATTAAATCTCGCGCCGATCAACTGGGTGCCAGCGTGGTGGTGTCGATGGTAGAACGAAGCGGCGTCGAAGCCTGTAAAGCGGCGGTGCACAATCT", "length": 243, "templateLength": 600, "templateSpan": 243, "orientation": "+", "crossesOrigin": false, "forward": { "strand": "+", "start": 177, "end": 198, "length": 22 }, "reverse": { "strand": "-", "start": 419, "end": 401, "length": 19 } }, "ranking": { "tmDeviation": 0.45724412577334306, "lengthDeviation": 0.6000000000000001, "deltaTm": 0.2299145054923315, "total": 1.2871586312656746 }, "exactSites": { "forward": 1, "reverse": 1 }, "exactProducts": 1 } ], "counts": { "windows": 918, "boundary": 0, "excluded": 834, "gc": 0, "tm": 6, "validForward": 75, "validReverse": 3, "productSize": 0, "deltaTm": 0, "eligiblePairs": 72, "exactChecked": 5, "exactRefused": 0 }, "capped": true } }, { "id": "design-lac-tails", "input": { "templateName": "J01636.1 1..600", "template": "GACACCATCGAATGGCGCAAAACCTTTCGCGGTATGGCATGATAGCGCCCGGAAGAGAGTCAATTCAGGGTGGTGAATGTGAAACCAGTAACGTTATACGATGTCGCAGAGTATGCCGGTGTCTCTTATCAGACCGTTTCCCGCGTGGTGAACCAGGCCAGCCACGTTTCTGCGAAAACGCGGGAAAAAGTGGAAGCGGCGATGGCGGAGCTGAATTACATTCCCAACCGCGTGGCACAACAACTGGCGGGCAAACAGTCGTTGCTGATTGGCGTTGCCACCTCCAGTCTGGCCCTGCACGCGCCGTCGCAAATTGTCGCGGCGATTAAATCTCGCGCCGATCAACTGGGTGCCAGCGTGGTGGTGTCGATGGTAGAACGAAGCGGCGTCGAAGCCTGTAAAGCGGCGGTGCACAATCTTCTCGCGCAACGCGTCAGTGGGCTGATCATTAACTATCCGCTGGATGACCAGGATGCCATTGCTGTGGAAGCTGCCTGCACTAATGTTCCGGCGTTATTTCTTGATGTCTCTGACCAGACACCCATCAACAGTATTATTTTCTCCCATGAAGACGGTACGCGACTGGGCGTGGAGCATCTG", "topology": "linear", "settings": { "target": { "start": 201, "end": 400 }, "excluded": [], "forwardTail": "GCGAATTC", "reverseTail": "GCAAGCTT", "conditions": { "oligo_nM": 250, "na_mM": 50, "mg_mM": 0, "dntp_mM": 0, "model": "primer-excess", "saltCorrection": "owczarzy-2004" }, "flank": 50, "minLength": 18, "maxLength": 26, "targetLength": 20, "minTm": 55, "maxTm": 68, "targetTm": 59.95, "maxDeltaTm": 3, "minGc": 30, "maxGc": 70, "minProduct": 190, "maxProduct": 440 } }, "expected": { "method": "bounded-flanks-v2", "pcrMethod": "exact-pair-v1", "templateHash": "fd182829946e68ba90d7c14906883ef31f663537dade5f617f804b8ce46dc316", "topology": "linear", "templateLength": 600, "pairs": [ { "id": "+:158:177|-:428:409", "forward": { "annealing": "CCAGCCACGTTTCTGCGAAA", "tail": "GCGAATTC", "start": 158, "end": 177, "tm": 59.99861335790035, "gc": 55.0, "penalty": 0.04861335790035071, "tmReview": { "value": 59.99861335790035, "method": "oligo-tm-nearest-neighbour", "version": "1.0.0", "saltCorrection": "owczarzy-2004", "conditions": { "oligo_nM": 250, "na_mM": 50, "k_mM": 0, "tris_mM": 0, "mg_mM": 0, "dntp_mM": 0, "model": "primer-excess", "saltCorrection": "owczarzy-2004" }, "limit": "Monovalent correction: Owczarzy 2004, fitted at 69 mM to 1.02 M Na⁺. It is also used from 20 to 69 mM, an extrapolation whose error has not been established here: Owczarzy 2008 places typical PCR buffers (20 to 100 mM monovalent) where this equation applies.", "outside": [] } }, "reverse": { "annealing": "TGCGCGAGAAGATTGTGCAC", "tail": "GCAAGCTT", "start": 428, "end": 409, "tm": 59.96600984591282, "gc": 55.0, "penalty": 0.016009845912819287, "tmReview": { "value": 59.96600984591282, "method": "oligo-tm-nearest-neighbour", "version": "1.0.0", "saltCorrection": "owczarzy-2004", "conditions": { "oligo_nM": 250, "na_mM": 50, "k_mM": 0, "tris_mM": 0, "mg_mM": 0, "dntp_mM": 0, "model": "primer-excess", "saltCorrection": "owczarzy-2004" }, "limit": "Monovalent correction: Owczarzy 2004, fitted at 69 mM to 1.02 M Na⁺. It is also used from 20 to 69 mM, an extrapolation whose error has not been established here: Owczarzy 2008 places typical PCR buffers (20 to 100 mM monovalent) where this equation applies.", "outside": [] } }, "product": { "id": "+:158:177|-:428:409", "sequence": "GCGAATTCCCAGCCACGTTTCTGCGAAAACGCGGGAAAAAGTGGAAGCGGCGATGGCGGAGCTGAATTACATTCCCAACCGCGTGGCACAACAACTGGCGGGCAAACAGTCGTTGCTGATTGGCGTTGCCACCTCCAGTCTGGCCCTGCACGCGCCGTCGCAAATTGTCGCGGCGATTAAATCTCGCGCCGATCAACTGGGTGCCAGCGTGGTGGTGTCGATGGTAGAACGAAGCGGCGTCGAAGCCTGTAAAGCGGCGGTGCACAATCTTCTCGCGCAAAGCTTGC", "length": 287, "templateLength": 600, "templateSpan": 271, "orientation": "+", "crossesOrigin": false, "forward": { "strand": "+", "start": 158, "end": 177, "length": 20 }, "reverse": { "strand": "-", "start": 428, "end": 409, "length": 20 } }, "ranking": { "tmDeviation": 0.06462320381317, "lengthDeviation": 0.0, "deltaTm": 0.03260351198753142, "total": 0.09722671580070141 }, "exactSites": { "forward": 1, "reverse": 1 }, "exactProducts": 1 }, { "id": "+:158:178|-:428:409", "forward": { "annealing": "CCAGCCACGTTTCTGCGAAAA", "tail": "GCGAATTC", "start": 158, "end": 178, "tm": 59.93537222125224, "gc": 52.38095238095238, "penalty": 0.21462777874776579, "tmReview": { "value": 59.93537222125224, "method": "oligo-tm-nearest-neighbour", "version": "1.0.0", "saltCorrection": "owczarzy-2004", "conditions": { "oligo_nM": 250, "na_mM": 50, "k_mM": 0, "tris_mM": 0, "mg_mM": 0, "dntp_mM": 0, "model": "primer-excess", "saltCorrection": "owczarzy-2004" }, "limit": "Monovalent correction: Owczarzy 2004, fitted at 69 mM to 1.02 M Na⁺. It is also used from 20 to 69 mM, an extrapolation whose error has not been established here: Owczarzy 2008 places typical PCR buffers (20 to 100 mM monovalent) where this equation applies.", "outside": [] } }, "reverse": { "annealing": "TGCGCGAGAAGATTGTGCAC", "tail": "GCAAGCTT", "start": 428, "end": 409, "tm": 59.96600984591282, "gc": 55.0, "penalty": 0.016009845912819287, "tmReview": { "value": 59.96600984591282, "method": "oligo-tm-nearest-neighbour", "version": "1.0.0", "saltCorrection": "owczarzy-2004", "conditions": { "oligo_nM": 250, "na_mM": 50, "k_mM": 0, "tris_mM": 0, "mg_mM": 0, "dntp_mM": 0, "model": "primer-excess", "saltCorrection": "owczarzy-2004" }, "limit": "Monovalent correction: Owczarzy 2004, fitted at 69 mM to 1.02 M Na⁺. It is also used from 20 to 69 mM, an extrapolation whose error has not been established here: Owczarzy 2008 places typical PCR buffers (20 to 100 mM monovalent) where this equation applies.", "outside": [] } }, "product": { "id": "+:158:178|-:428:409", "sequence": "GCGAATTCCCAGCCACGTTTCTGCGAAAACGCGGGAAAAAGTGGAAGCGGCGATGGCGGAGCTGAATTACATTCCCAACCGCGTGGCACAACAACTGGCGGGCAAACAGTCGTTGCTGATTGGCGTTGCCACCTCCAGTCTGGCCCTGCACGCGCCGTCGCAAATTGTCGCGGCGATTAAATCTCGCGCCGATCAACTGGGTGCCAGCGTGGTGGTGTCGATGGTAGAACGAAGCGGCGTCGAAGCCTGTAAAGCGGCGGTGCACAATCTTCTCGCGCAAAGCTTGC", "length": 287, "templateLength": 600, "templateSpan": 271, "orientation": "+", "crossesOrigin": false, "forward": { "strand": "+", "start": 158, "end": 178, "length": 21 }, "reverse": { "strand": "-", "start": 428, "end": 409, "length": 20 } }, "ranking": { "tmDeviation": 0.03063762466058506, "lengthDeviation": 0.2, "deltaTm": 0.03063762466058506, "total": 0.26127524932117013 }, "exactSites": { "forward": 1, "reverse": 1 }, "exactProducts": 1 }, { "id": "+:178:197|-:428:409", "forward": { "annealing": "ACGCGGGAAAAAGTGGAAGC", "tail": "GCGAATTC", "start": 178, "end": 197, "tm": 60.09860053729648, "gc": 55.0, "penalty": 0.14860053729647404, "tmReview": { "value": 60.09860053729648, "method": "oligo-tm-nearest-neighbour", "version": "1.0.0", "saltCorrection": "owczarzy-2004", "conditions": { "oligo_nM": 250, "na_mM": 50, "k_mM": 0, "tris_mM": 0, "mg_mM": 0, "dntp_mM": 0, "model": "primer-excess", "saltCorrection": "owczarzy-2004" }, "limit": "Monovalent correction: Owczarzy 2004, fitted at 69 mM to 1.02 M Na⁺. It is also used from 20 to 69 mM, an extrapolation whose error has not been established here: Owczarzy 2008 places typical PCR buffers (20 to 100 mM monovalent) where this equation applies.", "outside": [] } }, "reverse": { "annealing": "TGCGCGAGAAGATTGTGCAC", "tail": "GCAAGCTT", "start": 428, "end": 409, "tm": 59.96600984591282, "gc": 55.0, "penalty": 0.016009845912819287, "tmReview": { "value": 59.96600984591282, "method": "oligo-tm-nearest-neighbour", "version": "1.0.0", "saltCorrection": "owczarzy-2004", "conditions": { "oligo_nM": 250, "na_mM": 50, "k_mM": 0, "tris_mM": 0, "mg_mM": 0, "dntp_mM": 0, "model": "primer-excess", "saltCorrection": "owczarzy-2004" }, "limit": "Monovalent correction: Owczarzy 2004, fitted at 69 mM to 1.02 M Na⁺. It is also used from 20 to 69 mM, an extrapolation whose error has not been established here: Owczarzy 2008 places typical PCR buffers (20 to 100 mM monovalent) where this equation applies.", "outside": [] } }, "product": { "id": "+:178:197|-:428:409", "sequence": "GCGAATTCACGCGGGAAAAAGTGGAAGCGGCGATGGCGGAGCTGAATTACATTCCCAACCGCGTGGCACAACAACTGGCGGGCAAACAGTCGTTGCTGATTGGCGTTGCCACCTCCAGTCTGGCCCTGCACGCGCCGTCGCAAATTGTCGCGGCGATTAAATCTCGCGCCGATCAACTGGGTGCCAGCGTGGTGGTGTCGATGGTAGAACGAAGCGGCGTCGAAGCCTGTAAAGCGGCGGTGCACAATCTTCTCGCGCAAAGCTTGC", "length": 267, "templateLength": 600, "templateSpan": 251, "orientation": "+", "crossesOrigin": false, "forward": { "strand": "+", "start": 178, "end": 197, "length": 20 }, "reverse": { "strand": "-", "start": 428, "end": 409, "length": 20 } }, "ranking": { "tmDeviation": 0.16461038320929333, "lengthDeviation": 0.0, "deltaTm": 0.13259069138365476, "total": 0.2972010745929481 }, "exactSites": { "forward": 1, "reverse": 1 }, "exactProducts": 1 }, { "id": "+:177:197|-:428:409", "forward": { "annealing": "AACGCGGGAAAAAGTGGAAGC", "tail": "GCGAATTC", "start": 177, "end": 197, "tm": 60.03263800822515, "gc": 52.38095238095238, "penalty": 0.2826380082251461, "tmReview": { "value": 60.03263800822515, "method": "oligo-tm-nearest-neighbour", "version": "1.0.0", "saltCorrection": "owczarzy-2004", "conditions": { "oligo_nM": 250, "na_mM": 50, "k_mM": 0, "tris_mM": 0, "mg_mM": 0, "dntp_mM": 0, "model": "primer-excess", "saltCorrection": "owczarzy-2004" }, "limit": "Monovalent correction: Owczarzy 2004, fitted at 69 mM to 1.02 M Na⁺. It is also used from 20 to 69 mM, an extrapolation whose error has not been established here: Owczarzy 2008 places typical PCR buffers (20 to 100 mM monovalent) where this equation applies.", "outside": [] } }, "reverse": { "annealing": "TGCGCGAGAAGATTGTGCAC", "tail": "GCAAGCTT", "start": 428, "end": 409, "tm": 59.96600984591282, "gc": 55.0, "penalty": 0.016009845912819287, "tmReview": { "value": 59.96600984591282, "method": "oligo-tm-nearest-neighbour", "version": "1.0.0", "saltCorrection": "owczarzy-2004", "conditions": { "oligo_nM": 250, "na_mM": 50, "k_mM": 0, "tris_mM": 0, "mg_mM": 0, "dntp_mM": 0, "model": "primer-excess", "saltCorrection": "owczarzy-2004" }, "limit": "Monovalent correction: Owczarzy 2004, fitted at 69 mM to 1.02 M Na⁺. It is also used from 20 to 69 mM, an extrapolation whose error has not been established here: Owczarzy 2008 places typical PCR buffers (20 to 100 mM monovalent) where this equation applies.", "outside": [] } }, "product": { "id": "+:177:197|-:428:409", "sequence": "GCGAATTCAACGCGGGAAAAAGTGGAAGCGGCGATGGCGGAGCTGAATTACATTCCCAACCGCGTGGCACAACAACTGGCGGGCAAACAGTCGTTGCTGATTGGCGTTGCCACCTCCAGTCTGGCCCTGCACGCGCCGTCGCAAATTGTCGCGGCGATTAAATCTCGCGCCGATCAACTGGGTGCCAGCGTGGTGGTGTCGATGGTAGAACGAAGCGGCGTCGAAGCCTGTAAAGCGGCGGTGCACAATCTTCTCGCGCAAAGCTTGC", "length": 268, "templateLength": 600, "templateSpan": 252, "orientation": "+", "crossesOrigin": false, "forward": { "strand": "+", "start": 177, "end": 197, "length": 21 }, "reverse": { "strand": "-", "start": 428, "end": 409, "length": 20 } }, "ranking": { "tmDeviation": 0.0986478541379654, "lengthDeviation": 0.2, "deltaTm": 0.06662816231232682, "total": 0.36527601645029223 }, "exactSites": { "forward": 1, "reverse": 1 }, "exactProducts": 1 }, { "id": "+:158:177|-:422:404", "forward": { "annealing": "CCAGCCACGTTTCTGCGAAA", "tail": "GCGAATTC", "start": 158, "end": 177, "tm": 59.99861335790035, "gc": 55.0, "penalty": 0.04861335790035071, "tmReview": { "value": 59.99861335790035, "method": "oligo-tm-nearest-neighbour", "version": "1.0.0", "saltCorrection": "owczarzy-2004", "conditions": { "oligo_nM": 250, "na_mM": 50, "k_mM": 0, "tris_mM": 0, "mg_mM": 0, "dntp_mM": 0, "model": "primer-excess", "saltCorrection": "owczarzy-2004" }, "limit": "Monovalent correction: Owczarzy 2004, fitted at 69 mM to 1.02 M Na⁺. It is also used from 20 to 69 mM, an extrapolation whose error has not been established here: Owczarzy 2008 places typical PCR buffers (20 to 100 mM monovalent) where this equation applies.", "outside": [] } }, "reverse": { "annealing": "AGAAGATTGTGCACCGCCG", "tail": "GCAAGCTT", "start": 422, "end": 404, "tm": 59.914723905422534, "gc": 57.89473684210526, "penalty": 0.23527609457746906, "tmReview": { "value": 59.914723905422534, "method": "oligo-tm-nearest-neighbour", "version": "1.0.0", "saltCorrection": "owczarzy-2004", "conditions": { "oligo_nM": 250, "na_mM": 50, "k_mM": 0, "tris_mM": 0, "mg_mM": 0, "dntp_mM": 0, "model": "primer-excess", "saltCorrection": "owczarzy-2004" }, "limit": "Monovalent correction: Owczarzy 2004, fitted at 69 mM to 1.02 M Na⁺. It is also used from 20 to 69 mM, an extrapolation whose error has not been established here: Owczarzy 2008 places typical PCR buffers (20 to 100 mM monovalent) where this equation applies.", "outside": [] } }, "product": { "id": "+:158:177|-:422:404", "sequence": "GCGAATTCCCAGCCACGTTTCTGCGAAAACGCGGGAAAAAGTGGAAGCGGCGATGGCGGAGCTGAATTACATTCCCAACCGCGTGGCACAACAACTGGCGGGCAAACAGTCGTTGCTGATTGGCGTTGCCACCTCCAGTCTGGCCCTGCACGCGCCGTCGCAAATTGTCGCGGCGATTAAATCTCGCGCCGATCAACTGGGTGCCAGCGTGGTGGTGTCGATGGTAGAACGAAGCGGCGTCGAAGCCTGTAAAGCGGCGGTGCACAATCTTCTAAGCTTGC", "length": 281, "templateLength": 600, "templateSpan": 265, "orientation": "+", "crossesOrigin": false, "forward": { "strand": "+", "start": 158, "end": 177, "length": 20 }, "reverse": { "strand": "-", "start": 422, "end": 404, "length": 19 } }, "ranking": { "tmDeviation": 0.08388945247781976, "lengthDeviation": 0.2, "deltaTm": 0.08388945247781976, "total": 0.36777890495563953 }, "exactSites": { "forward": 1, "reverse": 1 }, "exactProducts": 1 } ], "counts": { "windows": 918, "boundary": 0, "excluded": 0, "gc": 40, "tm": 234, "validForward": 353, "validReverse": 291, "productSize": 0, "deltaTm": 0, "eligiblePairs": 576, "exactChecked": 5, "exactRefused": 0 }, "capped": true } }, { "id": "design-lac-mg", "input": { "templateName": "J01636.1 1..600", "template": "GACACCATCGAATGGCGCAAAACCTTTCGCGGTATGGCATGATAGCGCCCGGAAGAGAGTCAATTCAGGGTGGTGAATGTGAAACCAGTAACGTTATACGATGTCGCAGAGTATGCCGGTGTCTCTTATCAGACCGTTTCCCGCGTGGTGAACCAGGCCAGCCACGTTTCTGCGAAAACGCGGGAAAAAGTGGAAGCGGCGATGGCGGAGCTGAATTACATTCCCAACCGCGTGGCACAACAACTGGCGGGCAAACAGTCGTTGCTGATTGGCGTTGCCACCTCCAGTCTGGCCCTGCACGCGCCGTCGCAAATTGTCGCGGCGATTAAATCTCGCGCCGATCAACTGGGTGCCAGCGTGGTGGTGTCGATGGTAGAACGAAGCGGCGTCGAAGCCTGTAAAGCGGCGGTGCACAATCTTCTCGCGCAACGCGTCAGTGGGCTGATCATTAACTATCCGCTGGATGACCAGGATGCCATTGCTGTGGAAGCTGCCTGCACTAATGTTCCGGCGTTATTTCTTGATGTCTCTGACCAGACACCCATCAACAGTATTATTTTCTCCCATGAAGACGGTACGCGACTGGGCGTGGAGCATCTG", "topology": "linear", "settings": { "target": { "start": 201, "end": 400 }, "excluded": [], "forwardTail": "", "reverseTail": "", "conditions": { "oligo_nM": 250, "na_mM": 50, "mg_mM": 1.5, "dntp_mM": 0.2, "model": "primer-excess", "saltCorrection": "owczarzy-2008" }, "flank": 50, "minLength": 18, "maxLength": 26, "targetLength": 20, "minTm": 55, "maxTm": 68, "targetTm": 60.95, "maxDeltaTm": 3, "minGc": 30, "maxGc": 70, "minProduct": 180, "maxProduct": 420 } }, "expected": { "method": "bounded-flanks-v2", "pcrMethod": "exact-pair-v1", "templateHash": "fd182829946e68ba90d7c14906883ef31f663537dade5f617f804b8ce46dc316", "topology": "linear", "templateLength": 600, "pairs": [ { "id": "+:176:193|-:469:450", "forward": { "annealing": "AAACGCGGGAAAAAGTGG", "tail": "", "start": 176, "end": 193, "tm": 61.15758568510165, "gc": 50.0, "penalty": 0.6075856851016482, "tmReview": { "value": 61.15758568510165, "method": "oligo-tm-nearest-neighbour", "version": "1.0.0", "saltCorrection": "owczarzy-2008", "conditions": { "oligo_nM": 250, "na_mM": 50, "k_mM": 0, "tris_mM": 0, "mg_mM": 1.5, "dntp_mM": 0.2, "model": "primer-excess", "saltCorrection": "owczarzy-2008" }, "limit": "Magnesium correction: Owczarzy 2008. Its free Mg²⁺ range, recalled as 0.5 to 600 mM, is Unverified: not yet checked against Owczarzy 2008.", "outside": [] } }, "reverse": { "annealing": "GGTCATCCAGCGGATAGTTA", "tail": "", "start": 469, "end": 450, "tm": 61.11705567100347, "gc": 50.0, "penalty": 0.1670556710034674, "tmReview": { "value": 61.11705567100347, "method": "oligo-tm-nearest-neighbour", "version": "1.0.0", "saltCorrection": "owczarzy-2008", "conditions": { "oligo_nM": 250, "na_mM": 50, "k_mM": 0, "tris_mM": 0, "mg_mM": 1.5, "dntp_mM": 0.2, "model": "primer-excess", "saltCorrection": "owczarzy-2008" }, "limit": "Magnesium correction: Owczarzy 2008. Its free Mg²⁺ range, recalled as 0.5 to 600 mM, is Unverified: not yet checked against Owczarzy 2008.", "outside": [] } }, "product": { "id": "+:176:193|-:469:450", "sequence": "AAACGCGGGAAAAAGTGGAAGCGGCGATGGCGGAGCTGAATTACATTCCCAACCGCGTGGCACAACAACTGGCGGGCAAACAGTCGTTGCTGATTGGCGTTGCCACCTCCAGTCTGGCCCTGCACGCGCCGTCGCAAATTGTCGCGGCGATTAAATCTCGCGCCGATCAACTGGGTGCCAGCGTGGTGGTGTCGATGGTAGAACGAAGCGGCGTCGAAGCCTGTAAAGCGGCGGTGCACAATCTTCTCGCGCAACGCGTCAGTGGGCTGATCATTAACTATCCGCTGGATGACC", "length": 294, "templateLength": 600, "templateSpan": 294, "orientation": "+", "crossesOrigin": false, "forward": { "strand": "+", "start": 176, "end": 193, "length": 18 }, "reverse": { "strand": "-", "start": 469, "end": 450, "length": 20 } }, "ranking": { "tmDeviation": 0.3746413561051156, "lengthDeviation": 0.4, "deltaTm": 0.0405300140981808, "total": 0.8151713702032964 }, "exactSites": { "forward": 1, "reverse": 1 }, "exactProducts": 1 }, { "id": "+:176:193|-:454:434", "forward": { "annealing": "AAACGCGGGAAAAAGTGG", "tail": "", "start": 176, "end": 193, "tm": 61.15758568510165, "gc": 50.0, "penalty": 0.6075856851016482, "tmReview": { "value": 61.15758568510165, "method": "oligo-tm-nearest-neighbour", "version": "1.0.0", "saltCorrection": "owczarzy-2008", "conditions": { "oligo_nM": 250, "na_mM": 50, "k_mM": 0, "tris_mM": 0, "mg_mM": 1.5, "dntp_mM": 0.2, "model": "primer-excess", "saltCorrection": "owczarzy-2008" }, "limit": "Magnesium correction: Owczarzy 2008. Its free Mg²⁺ range, recalled as 0.5 to 600 mM, is Unverified: not yet checked against Owczarzy 2008.", "outside": [] } }, "reverse": { "annealing": "AGTTAATGATCAGCCCACTGA", "tail": "", "start": 454, "end": 434, "tm": 60.991115029483694, "gc": 42.857142857142854, "penalty": 0.2411150294836915, "tmReview": { "value": 60.991115029483694, "method": "oligo-tm-nearest-neighbour", "version": "1.0.0", "saltCorrection": "owczarzy-2008", "conditions": { "oligo_nM": 250, "na_mM": 50, "k_mM": 0, "tris_mM": 0, "mg_mM": 1.5, "dntp_mM": 0.2, "model": "primer-excess", "saltCorrection": "owczarzy-2008" }, "limit": "Magnesium correction: Owczarzy 2008. Its free Mg²⁺ range, recalled as 0.5 to 600 mM, is Unverified: not yet checked against Owczarzy 2008.", "outside": [] } }, "product": { "id": "+:176:193|-:454:434", "sequence": "AAACGCGGGAAAAAGTGGAAGCGGCGATGGCGGAGCTGAATTACATTCCCAACCGCGTGGCACAACAACTGGCGGGCAAACAGTCGTTGCTGATTGGCGTTGCCACCTCCAGTCTGGCCCTGCACGCGCCGTCGCAAATTGTCGCGGCGATTAAATCTCGCGCCGATCAACTGGGTGCCAGCGTGGTGGTGTCGATGGTAGAACGAAGCGGCGTCGAAGCCTGTAAAGCGGCGGTGCACAATCTTCTCGCGCAACGCGTCAGTGGGCTGATCATTAACT", "length": 279, "templateLength": 600, "templateSpan": 279, "orientation": "+", "crossesOrigin": false, "forward": { "strand": "+", "start": 176, "end": 193, "length": 18 }, "reverse": { "strand": "-", "start": 454, "end": 434, "length": 21 } }, "ranking": { "tmDeviation": 0.2487007145853397, "lengthDeviation": 0.6000000000000001, "deltaTm": 0.1664706556179567, "total": 1.0151713702032965 }, "exactSites": { "forward": 1, "reverse": 1 }, "exactProducts": 1 }, { "id": "+:182:199|-:469:450", "forward": { "annealing": "GGGAAAAAGTGGAAGCGG", "tail": "", "start": 182, "end": 199, "tm": 61.293900774555254, "gc": 55.55555555555556, "penalty": 0.7439007745552516, "tmReview": { "value": 61.293900774555254, "method": "oligo-tm-nearest-neighbour", "version": "1.0.0", "saltCorrection": "owczarzy-2008", "conditions": { "oligo_nM": 250, "na_mM": 50, "k_mM": 0, "tris_mM": 0, "mg_mM": 1.5, "dntp_mM": 0.2, "model": "primer-excess", "saltCorrection": "owczarzy-2008" }, "limit": "Magnesium correction: Owczarzy 2008. Its free Mg²⁺ range, recalled as 0.5 to 600 mM, is Unverified: not yet checked against Owczarzy 2008.", "outside": [] } }, "reverse": { "annealing": "GGTCATCCAGCGGATAGTTA", "tail": "", "start": 469, "end": 450, "tm": 61.11705567100347, "gc": 50.0, "penalty": 0.1670556710034674, "tmReview": { "value": 61.11705567100347, "method": "oligo-tm-nearest-neighbour", "version": "1.0.0", "saltCorrection": "owczarzy-2008", "conditions": { "oligo_nM": 250, "na_mM": 50, "k_mM": 0, "tris_mM": 0, "mg_mM": 1.5, "dntp_mM": 0.2, "model": "primer-excess", "saltCorrection": "owczarzy-2008" }, "limit": "Magnesium correction: Owczarzy 2008. Its free Mg²⁺ range, recalled as 0.5 to 600 mM, is Unverified: not yet checked against Owczarzy 2008.", "outside": [] } }, "product": { "id": "+:182:199|-:469:450", "sequence": "GGGAAAAAGTGGAAGCGGCGATGGCGGAGCTGAATTACATTCCCAACCGCGTGGCACAACAACTGGCGGGCAAACAGTCGTTGCTGATTGGCGTTGCCACCTCCAGTCTGGCCCTGCACGCGCCGTCGCAAATTGTCGCGGCGATTAAATCTCGCGCCGATCAACTGGGTGCCAGCGTGGTGGTGTCGATGGTAGAACGAAGCGGCGTCGAAGCCTGTAAAGCGGCGGTGCACAATCTTCTCGCGCAACGCGTCAGTGGGCTGATCATTAACTATCCGCTGGATGACC", "length": 288, "templateLength": 600, "templateSpan": 288, "orientation": "+", "crossesOrigin": false, "forward": { "strand": "+", "start": 182, "end": 199, "length": 18 }, "reverse": { "strand": "-", "start": 469, "end": 450, "length": 20 } }, "ranking": { "tmDeviation": 0.510956445558719, "lengthDeviation": 0.4, "deltaTm": 0.17684510355178418, "total": 1.087801549110503 }, "exactSites": { "forward": 1, "reverse": 1 }, "exactProducts": 1 }, { "id": "+:161:178|-:469:450", "forward": { "annealing": "GCCACGTTTCTGCGAAAA", "tail": "", "start": 161, "end": 178, "tm": 61.3660651215726, "gc": 50.0, "penalty": 0.8160651215726006, "tmReview": { "value": 61.3660651215726, "method": "oligo-tm-nearest-neighbour", "version": "1.0.0", "saltCorrection": "owczarzy-2008", "conditions": { "oligo_nM": 250, "na_mM": 50, "k_mM": 0, "tris_mM": 0, "mg_mM": 1.5, "dntp_mM": 0.2, "model": "primer-excess", "saltCorrection": "owczarzy-2008" }, "limit": "Magnesium correction: Owczarzy 2008. Its free Mg²⁺ range, recalled as 0.5 to 600 mM, is Unverified: not yet checked against Owczarzy 2008.", "outside": [] } }, "reverse": { "annealing": "GGTCATCCAGCGGATAGTTA", "tail": "", "start": 469, "end": 450, "tm": 61.11705567100347, "gc": 50.0, "penalty": 0.1670556710034674, "tmReview": { "value": 61.11705567100347, "method": "oligo-tm-nearest-neighbour", "version": "1.0.0", "saltCorrection": "owczarzy-2008", "conditions": { "oligo_nM": 250, "na_mM": 50, "k_mM": 0, "tris_mM": 0, "mg_mM": 1.5, "dntp_mM": 0.2, "model": "primer-excess", "saltCorrection": "owczarzy-2008" }, "limit": "Magnesium correction: Owczarzy 2008. Its free Mg²⁺ range, recalled as 0.5 to 600 mM, is Unverified: not yet checked against Owczarzy 2008.", "outside": [] } }, "product": { "id": "+:161:178|-:469:450", "sequence": "GCCACGTTTCTGCGAAAACGCGGGAAAAAGTGGAAGCGGCGATGGCGGAGCTGAATTACATTCCCAACCGCGTGGCACAACAACTGGCGGGCAAACAGTCGTTGCTGATTGGCGTTGCCACCTCCAGTCTGGCCCTGCACGCGCCGTCGCAAATTGTCGCGGCGATTAAATCTCGCGCCGATCAACTGGGTGCCAGCGTGGTGGTGTCGATGGTAGAACGAAGCGGCGTCGAAGCCTGTAAAGCGGCGGTGCACAATCTTCTCGCGCAACGCGTCAGTGGGCTGATCATTAACTATCCGCTGGATGACC", "length": 309, "templateLength": 600, "templateSpan": 309, "orientation": "+", "crossesOrigin": false, "forward": { "strand": "+", "start": 161, "end": 178, "length": 18 }, "reverse": { "strand": "-", "start": 469, "end": 450, "length": 20 } }, "ranking": { "tmDeviation": 0.583120792576068, "lengthDeviation": 0.4, "deltaTm": 0.24900945056913315, "total": 1.232130243145201 }, "exactSites": { "forward": 1, "reverse": 1 }, "exactProducts": 1 }, { "id": "+:176:193|-:453:433", "forward": { "annealing": "AAACGCGGGAAAAAGTGG", "tail": "", "start": 176, "end": 193, "tm": 61.15758568510165, "gc": 50.0, "penalty": 0.6075856851016482, "tmReview": { "value": 61.15758568510165, "method": "oligo-tm-nearest-neighbour", "version": "1.0.0", "saltCorrection": "owczarzy-2008", "conditions": { "oligo_nM": 250, "na_mM": 50, "k_mM": 0, "tris_mM": 0, "mg_mM": 1.5, "dntp_mM": 0.2, "model": "primer-excess", "saltCorrection": "owczarzy-2008" }, "limit": "Magnesium correction: Owczarzy 2008. Its free Mg²⁺ range, recalled as 0.5 to 600 mM, is Unverified: not yet checked against Owczarzy 2008.", "outside": [] } }, "reverse": { "annealing": "GTTAATGATCAGCCCACTGAC", "tail": "", "start": 453, "end": 433, "tm": 60.81993868631338, "gc": 47.61904761904762, "penalty": 0.33006131368662467, "tmReview": { "value": 60.81993868631338, "method": "oligo-tm-nearest-neighbour", "version": "1.0.0", "saltCorrection": "owczarzy-2008", "conditions": { "oligo_nM": 250, "na_mM": 50, "k_mM": 0, "tris_mM": 0, "mg_mM": 1.5, "dntp_mM": 0.2, "model": "primer-excess", "saltCorrection": "owczarzy-2008" }, "limit": "Magnesium correction: Owczarzy 2008. Its free Mg²⁺ range, recalled as 0.5 to 600 mM, is Unverified: not yet checked against Owczarzy 2008.", "outside": [] } }, "product": { "id": "+:176:193|-:453:433", "sequence": "AAACGCGGGAAAAAGTGGAAGCGGCGATGGCGGAGCTGAATTACATTCCCAACCGCGTGGCACAACAACTGGCGGGCAAACAGTCGTTGCTGATTGGCGTTGCCACCTCCAGTCTGGCCCTGCACGCGCCGTCGCAAATTGTCGCGGCGATTAAATCTCGCGCCGATCAACTGGGTGCCAGCGTGGTGGTGTCGATGGTAGAACGAAGCGGCGTCGAAGCCTGTAAAGCGGCGGTGCACAATCTTCTCGCGCAACGCGTCAGTGGGCTGATCATTAAC", "length": 278, "templateLength": 600, "templateSpan": 278, "orientation": "+", "crossesOrigin": false, "forward": { "strand": "+", "start": 176, "end": 193, "length": 18 }, "reverse": { "strand": "-", "start": 453, "end": 433, "length": 21 } }, "ranking": { "tmDeviation": 0.33764699878827287, "lengthDeviation": 0.6000000000000001, "deltaTm": 0.33764699878827287, "total": 1.2752939975765458 }, "exactSites": { "forward": 1, "reverse": 1 }, "exactProducts": 1 } ], "counts": { "windows": 918, "boundary": 0, "excluded": 0, "gc": 40, "tm": 507, "validForward": 141, "validReverse": 230, "productSize": 0, "deltaTm": 0, "eligiblePairs": 576, "exactChecked": 5, "exactRefused": 0 }, "capped": true } }, { "id": "design-lac-capped", "input": { "templateName": "J01636.1 1..600", "template": "GACACCATCGAATGGCGCAAAACCTTTCGCGGTATGGCATGATAGCGCCCGGAAGAGAGTCAATTCAGGGTGGTGAATGTGAAACCAGTAACGTTATACGATGTCGCAGAGTATGCCGGTGTCTCTTATCAGACCGTTTCCCGCGTGGTGAACCAGGCCAGCCACGTTTCTGCGAAAACGCGGGAAAAAGTGGAAGCGGCGATGGCGGAGCTGAATTACATTCCCAACCGCGTGGCACAACAACTGGCGGGCAAACAGTCGTTGCTGATTGGCGTTGCCACCTCCAGTCTGGCCCTGCACGCGCCGTCGCAAATTGTCGCGGCGATTAAATCTCGCGCCGATCAACTGGGTGCCAGCGTGGTGGTGTCGATGGTAGAACGAAGCGGCGTCGAAGCCTGTAAAGCGGCGGTGCACAATCTTCTCGCGCAACGCGTCAGTGGGCTGATCATTAACTATCCGCTGGATGACCAGGATGCCATTGCTGTGGAAGCTGCCTGCACTAATGTTCCGGCGTTATTTCTTGATGTCTCTGACCAGACACCCATCAACAGTATTATTTTCTCCCATGAAGACGGTACGCGACTGGGCGTGGAGCATCTG", "topology": "linear", "settings": { "target": { "start": 201, "end": 400 }, "excluded": [], "forwardTail": "", "reverseTail": "", "conditions": { "oligo_nM": 250, "na_mM": 50, "mg_mM": 0, "dntp_mM": 0, "model": "primer-excess", "saltCorrection": "owczarzy-2004" }, "flank": 200, "minLength": 18, "maxLength": 26, "targetLength": 20, "minTm": 55, "maxTm": 68, "targetTm": 61.05, "maxDeltaTm": 3, "minGc": 30, "maxGc": 70, "minProduct": 180, "maxProduct": 800 } }, "expected": { "method": "bounded-flanks-v2", "pcrMethod": "exact-pair-v1", "templateHash": "fd182829946e68ba90d7c14906883ef31f663537dade5f617f804b8ce46dc316", "topology": "linear", "templateLength": 600, "pairs": [ { "id": "+:12:31|-:586:567", "forward": { "annealing": "ATGGCGCAAAACCTTTCGCG", "tail": "", "start": 12, "end": 31, "tm": 61.065643199402075, "gc": 55.0, "penalty": 0.015643199402077812, "tmReview": { "value": 61.065643199402075, "method": "oligo-tm-nearest-neighbour", "version": "1.0.0", "saltCorrection": "owczarzy-2004", "conditions": { "oligo_nM": 250, "na_mM": 50, "k_mM": 0, "tris_mM": 0, "mg_mM": 0, "dntp_mM": 0, "model": "primer-excess", "saltCorrection": "owczarzy-2004" }, "limit": "Monovalent correction: Owczarzy 2004, fitted at 69 mM to 1.02 M Na⁺. It is also used from 20 to 69 mM, an extrapolation whose error has not been established here: Owczarzy 2008 places typical PCR buffers (20 to 100 mM monovalent) where this equation applies.", "outside": [] } }, "reverse": { "annealing": "CCAGTCGCGTACCGTCTTCA", "tail": "", "start": 586, "end": 567, "tm": 61.0566792127554, "gc": 60.0, "penalty": 0.006679212755400954, "tmReview": { "value": 61.0566792127554, "method": "oligo-tm-nearest-neighbour", "version": "1.0.0", "saltCorrection": "owczarzy-2004", "conditions": { "oligo_nM": 250, "na_mM": 50, "k_mM": 0, "tris_mM": 0, "mg_mM": 0, "dntp_mM": 0, "model": "primer-excess", "saltCorrection": "owczarzy-2004" }, "limit": "Monovalent correction: Owczarzy 2004, fitted at 69 mM to 1.02 M Na⁺. It is also used from 20 to 69 mM, an extrapolation whose error has not been established here: Owczarzy 2008 places typical PCR buffers (20 to 100 mM monovalent) where this equation applies.", "outside": [] } }, "product": { "id": "+:12:31|-:586:567", "sequence": "ATGGCGCAAAACCTTTCGCGGTATGGCATGATAGCGCCCGGAAGAGAGTCAATTCAGGGTGGTGAATGTGAAACCAGTAACGTTATACGATGTCGCAGAGTATGCCGGTGTCTCTTATCAGACCGTTTCCCGCGTGGTGAACCAGGCCAGCCACGTTTCTGCGAAAACGCGGGAAAAAGTGGAAGCGGCGATGGCGGAGCTGAATTACATTCCCAACCGCGTGGCACAACAACTGGCGGGCAAACAGTCGTTGCTGATTGGCGTTGCCACCTCCAGTCTGGCCCTGCACGCGCCGTCGCAAATTGTCGCGGCGATTAAATCTCGCGCCGATCAACTGGGTGCCAGCGTGGTGGTGTCGATGGTAGAACGAAGCGGCGTCGAAGCCTGTAAAGCGGCGGTGCACAATCTTCTCGCGCAACGCGTCAGTGGGCTGATCATTAACTATCCGCTGGATGACCAGGATGCCATTGCTGTGGAAGCTGCCTGCACTAATGTTCCGGCGTTATTTCTTGATGTCTCTGACCAGACACCCATCAACAGTATTATTTTCTCCCATGAAGACGGTACGCGACTGG", "length": 575, "templateLength": 600, "templateSpan": 575, "orientation": "+", "crossesOrigin": false, "forward": { "strand": "+", "start": 12, "end": 31, "length": 20 }, "reverse": { "strand": "-", "start": 586, "end": 567, "length": 20 } }, "ranking": { "tmDeviation": 0.022322412157478766, "lengthDeviation": 0.0, "deltaTm": 0.008963986646676858, "total": 0.031286398804155624 }, "exactSites": { "forward": 1, "reverse": 1 }, "exactProducts": 1 }, { "id": "+:12:31|-:475:456", "forward": { "annealing": "ATGGCGCAAAACCTTTCGCG", "tail": "", "start": 12, "end": 31, "tm": 61.065643199402075, "gc": 55.0, "penalty": 0.015643199402077812, "tmReview": { "value": 61.065643199402075, "method": "oligo-tm-nearest-neighbour", "version": "1.0.0", "saltCorrection": "owczarzy-2004", "conditions": { "oligo_nM": 250, "na_mM": 50, "k_mM": 0, "tris_mM": 0, "mg_mM": 0, "dntp_mM": 0, "model": "primer-excess", "saltCorrection": "owczarzy-2004" }, "limit": "Monovalent correction: Owczarzy 2004, fitted at 69 mM to 1.02 M Na⁺. It is also used from 20 to 69 mM, an extrapolation whose error has not been established here: Owczarzy 2008 places typical PCR buffers (20 to 100 mM monovalent) where this equation applies.", "outside": [] } }, "reverse": { "annealing": "CATCCTGGTCATCCAGCGGA", "tail": "", "start": 475, "end": 456, "tm": 61.04745311032701, "gc": 60.0, "penalty": 0.0025468896729847756, "tmReview": { "value": 61.04745311032701, "method": "oligo-tm-nearest-neighbour", "version": "1.0.0", "saltCorrection": "owczarzy-2004", "conditions": { "oligo_nM": 250, "na_mM": 50, "k_mM": 0, "tris_mM": 0, "mg_mM": 0, "dntp_mM": 0, "model": "primer-excess", "saltCorrection": "owczarzy-2004" }, "limit": "Monovalent correction: Owczarzy 2004, fitted at 69 mM to 1.02 M Na⁺. It is also used from 20 to 69 mM, an extrapolation whose error has not been established here: Owczarzy 2008 places typical PCR buffers (20 to 100 mM monovalent) where this equation applies.", "outside": [] } }, "product": { "id": "+:12:31|-:475:456", "sequence": "ATGGCGCAAAACCTTTCGCGGTATGGCATGATAGCGCCCGGAAGAGAGTCAATTCAGGGTGGTGAATGTGAAACCAGTAACGTTATACGATGTCGCAGAGTATGCCGGTGTCTCTTATCAGACCGTTTCCCGCGTGGTGAACCAGGCCAGCCACGTTTCTGCGAAAACGCGGGAAAAAGTGGAAGCGGCGATGGCGGAGCTGAATTACATTCCCAACCGCGTGGCACAACAACTGGCGGGCAAACAGTCGTTGCTGATTGGCGTTGCCACCTCCAGTCTGGCCCTGCACGCGCCGTCGCAAATTGTCGCGGCGATTAAATCTCGCGCCGATCAACTGGGTGCCAGCGTGGTGGTGTCGATGGTAGAACGAAGCGGCGTCGAAGCCTGTAAAGCGGCGGTGCACAATCTTCTCGCGCAACGCGTCAGTGGGCTGATCATTAACTATCCGCTGGATGACCAGGATG", "length": 464, "templateLength": 600, "templateSpan": 464, "orientation": "+", "crossesOrigin": false, "forward": { "strand": "+", "start": 12, "end": 31, "length": 20 }, "reverse": { "strand": "-", "start": 475, "end": 456, "length": 20 } }, "ranking": { "tmDeviation": 0.018190089075062588, "lengthDeviation": 0.0, "deltaTm": 0.018190089075062588, "total": 0.036380178150125175 }, "exactSites": { "forward": 1, "reverse": 1 }, "exactProducts": 1 }, { "id": "+:12:31|-:512:493", "forward": { "annealing": "ATGGCGCAAAACCTTTCGCG", "tail": "", "start": 12, "end": 31, "tm": 61.065643199402075, "gc": 55.0, "penalty": 0.015643199402077812, "tmReview": { "value": 61.065643199402075, "method": "oligo-tm-nearest-neighbour", "version": "1.0.0", "saltCorrection": "owczarzy-2004", "conditions": { "oligo_nM": 250, "na_mM": 50, "k_mM": 0, "tris_mM": 0, "mg_mM": 0, "dntp_mM": 0, "model": "primer-excess", "saltCorrection": "owczarzy-2004" }, "limit": "Monovalent correction: Owczarzy 2004, fitted at 69 mM to 1.02 M Na⁺. It is also used from 20 to 69 mM, an extrapolation whose error has not been established here: Owczarzy 2008 places typical PCR buffers (20 to 100 mM monovalent) where this equation applies.", "outside": [] } }, "reverse": { "annealing": "GCCGGAACATTAGTGCAGGC", "tail": "", "start": 512, "end": 493, "tm": 60.94050494377336, "gc": 60.0, "penalty": 0.1094950562266348, "tmReview": { "value": 60.94050494377336, "method": "oligo-tm-nearest-neighbour", "version": "1.0.0", "saltCorrection": "owczarzy-2004", "conditions": { "oligo_nM": 250, "na_mM": 50, "k_mM": 0, "tris_mM": 0, "mg_mM": 0, "dntp_mM": 0, "model": "primer-excess", "saltCorrection": "owczarzy-2004" }, "limit": "Monovalent correction: Owczarzy 2004, fitted at 69 mM to 1.02 M Na⁺. It is also used from 20 to 69 mM, an extrapolation whose error has not been established here: Owczarzy 2008 places typical PCR buffers (20 to 100 mM monovalent) where this equation applies.", "outside": [] } }, "product": { "id": "+:12:31|-:512:493", "sequence": "ATGGCGCAAAACCTTTCGCGGTATGGCATGATAGCGCCCGGAAGAGAGTCAATTCAGGGTGGTGAATGTGAAACCAGTAACGTTATACGATGTCGCAGAGTATGCCGGTGTCTCTTATCAGACCGTTTCCCGCGTGGTGAACCAGGCCAGCCACGTTTCTGCGAAAACGCGGGAAAAAGTGGAAGCGGCGATGGCGGAGCTGAATTACATTCCCAACCGCGTGGCACAACAACTGGCGGGCAAACAGTCGTTGCTGATTGGCGTTGCCACCTCCAGTCTGGCCCTGCACGCGCCGTCGCAAATTGTCGCGGCGATTAAATCTCGCGCCGATCAACTGGGTGCCAGCGTGGTGGTGTCGATGGTAGAACGAAGCGGCGTCGAAGCCTGTAAAGCGGCGGTGCACAATCTTCTCGCGCAACGCGTCAGTGGGCTGATCATTAACTATCCGCTGGATGACCAGGATGCCATTGCTGTGGAAGCTGCCTGCACTAATGTTCCGGC", "length": 501, "templateLength": 600, "templateSpan": 501, "orientation": "+", "crossesOrigin": false, "forward": { "strand": "+", "start": 12, "end": 31, "length": 20 }, "reverse": { "strand": "-", "start": 512, "end": 493, "length": 20 } }, "ranking": { "tmDeviation": 0.1251382556287126, "lengthDeviation": 0.0, "deltaTm": 0.1251382556287126, "total": 0.2502765112574252 }, "exactSites": { "forward": 1, "reverse": 1 }, "exactProducts": 1 }, { "id": "+:98:118|-:586:567", "forward": { "annealing": "ACGATGTCGCAGAGTATGCCG", "tail": "", "start": 98, "end": 118, "tm": 61.09416535585274, "gc": 57.142857142857146, "penalty": 0.24416535585274063, "tmReview": { "value": 61.09416535585274, "method": "oligo-tm-nearest-neighbour", "version": "1.0.0", "saltCorrection": "owczarzy-2004", "conditions": { "oligo_nM": 250, "na_mM": 50, "k_mM": 0, "tris_mM": 0, "mg_mM": 0, "dntp_mM": 0, "model": "primer-excess", "saltCorrection": "owczarzy-2004" }, "limit": "Monovalent correction: Owczarzy 2004, fitted at 69 mM to 1.02 M Na⁺. It is also used from 20 to 69 mM, an extrapolation whose error has not been established here: Owczarzy 2008 places typical PCR buffers (20 to 100 mM monovalent) where this equation applies.", "outside": [] } }, "reverse": { "annealing": "CCAGTCGCGTACCGTCTTCA", "tail": "", "start": 586, "end": 567, "tm": 61.0566792127554, "gc": 60.0, "penalty": 0.006679212755400954, "tmReview": { "value": 61.0566792127554, "method": "oligo-tm-nearest-neighbour", "version": "1.0.0", "saltCorrection": "owczarzy-2004", "conditions": { "oligo_nM": 250, "na_mM": 50, "k_mM": 0, "tris_mM": 0, "mg_mM": 0, "dntp_mM": 0, "model": "primer-excess", "saltCorrection": "owczarzy-2004" }, "limit": "Monovalent correction: Owczarzy 2004, fitted at 69 mM to 1.02 M Na⁺. It is also used from 20 to 69 mM, an extrapolation whose error has not been established here: Owczarzy 2008 places typical PCR buffers (20 to 100 mM monovalent) where this equation applies.", "outside": [] } }, "product": { "id": "+:98:118|-:586:567", "sequence": "ACGATGTCGCAGAGTATGCCGGTGTCTCTTATCAGACCGTTTCCCGCGTGGTGAACCAGGCCAGCCACGTTTCTGCGAAAACGCGGGAAAAAGTGGAAGCGGCGATGGCGGAGCTGAATTACATTCCCAACCGCGTGGCACAACAACTGGCGGGCAAACAGTCGTTGCTGATTGGCGTTGCCACCTCCAGTCTGGCCCTGCACGCGCCGTCGCAAATTGTCGCGGCGATTAAATCTCGCGCCGATCAACTGGGTGCCAGCGTGGTGGTGTCGATGGTAGAACGAAGCGGCGTCGAAGCCTGTAAAGCGGCGGTGCACAATCTTCTCGCGCAACGCGTCAGTGGGCTGATCATTAACTATCCGCTGGATGACCAGGATGCCATTGCTGTGGAAGCTGCCTGCACTAATGTTCCGGCGTTATTTCTTGATGTCTCTGACCAGACACCCATCAACAGTATTATTTTCTCCCATGAAGACGGTACGCGACTGG", "length": 489, "templateLength": 600, "templateSpan": 489, "orientation": "+", "crossesOrigin": false, "forward": { "strand": "+", "start": 98, "end": 118, "length": 21 }, "reverse": { "strand": "-", "start": 586, "end": 567, "length": 20 } }, "ranking": { "tmDeviation": 0.05084456860814157, "lengthDeviation": 0.2, "deltaTm": 0.037486143097339664, "total": 0.28833071170548125 }, "exactSites": { "forward": 1, "reverse": 1 }, "exactProducts": 1 }, { "id": "+:98:118|-:475:456", "forward": { "annealing": "ACGATGTCGCAGAGTATGCCG", "tail": "", "start": 98, "end": 118, "tm": 61.09416535585274, "gc": 57.142857142857146, "penalty": 0.24416535585274063, "tmReview": { "value": 61.09416535585274, "method": "oligo-tm-nearest-neighbour", "version": "1.0.0", "saltCorrection": "owczarzy-2004", "conditions": { "oligo_nM": 250, "na_mM": 50, "k_mM": 0, "tris_mM": 0, "mg_mM": 0, "dntp_mM": 0, "model": "primer-excess", "saltCorrection": "owczarzy-2004" }, "limit": "Monovalent correction: Owczarzy 2004, fitted at 69 mM to 1.02 M Na⁺. It is also used from 20 to 69 mM, an extrapolation whose error has not been established here: Owczarzy 2008 places typical PCR buffers (20 to 100 mM monovalent) where this equation applies.", "outside": [] } }, "reverse": { "annealing": "CATCCTGGTCATCCAGCGGA", "tail": "", "start": 475, "end": 456, "tm": 61.04745311032701, "gc": 60.0, "penalty": 0.0025468896729847756, "tmReview": { "value": 61.04745311032701, "method": "oligo-tm-nearest-neighbour", "version": "1.0.0", "saltCorrection": "owczarzy-2004", "conditions": { "oligo_nM": 250, "na_mM": 50, "k_mM": 0, "tris_mM": 0, "mg_mM": 0, "dntp_mM": 0, "model": "primer-excess", "saltCorrection": "owczarzy-2004" }, "limit": "Monovalent correction: Owczarzy 2004, fitted at 69 mM to 1.02 M Na⁺. It is also used from 20 to 69 mM, an extrapolation whose error has not been established here: Owczarzy 2008 places typical PCR buffers (20 to 100 mM monovalent) where this equation applies.", "outside": [] } }, "product": { "id": "+:98:118|-:475:456", "sequence": "ACGATGTCGCAGAGTATGCCGGTGTCTCTTATCAGACCGTTTCCCGCGTGGTGAACCAGGCCAGCCACGTTTCTGCGAAAACGCGGGAAAAAGTGGAAGCGGCGATGGCGGAGCTGAATTACATTCCCAACCGCGTGGCACAACAACTGGCGGGCAAACAGTCGTTGCTGATTGGCGTTGCCACCTCCAGTCTGGCCCTGCACGCGCCGTCGCAAATTGTCGCGGCGATTAAATCTCGCGCCGATCAACTGGGTGCCAGCGTGGTGGTGTCGATGGTAGAACGAAGCGGCGTCGAAGCCTGTAAAGCGGCGGTGCACAATCTTCTCGCGCAACGCGTCAGTGGGCTGATCATTAACTATCCGCTGGATGACCAGGATG", "length": 378, "templateLength": 600, "templateSpan": 378, "orientation": "+", "crossesOrigin": false, "forward": { "strand": "+", "start": 98, "end": 118, "length": 21 }, "reverse": { "strand": "-", "start": 475, "end": 456, "length": 20 } }, "ranking": { "tmDeviation": 0.04671224552572539, "lengthDeviation": 0.2, "deltaTm": 0.04671224552572539, "total": 0.2934244910514508 }, "exactSites": { "forward": 1, "reverse": 1 }, "exactProducts": 1 } ], "counts": { "windows": 3618, "boundary": 396, "excluded": 0, "gc": 94, "tm": 962, "validForward": 1172, "validReverse": 994, "productSize": 0, "deltaTm": 0, "eligiblePairs": 576, "exactChecked": 5, "exactRefused": 0 }, "capped": true } }, { "id": "design-puc19-origin", "input": { "templateName": "L09137.2 (pUC19, circular)", "template": "TCGCGCGTTTCGGTGATGACGGTGAAAACCTCTGACACATGCAGCTCCCGGAGACGGTCACAGCTTGTCTGTAAGCGGATGCCGGGAGCAGACAAGCCCGTCAGGGCGCGTCAGCGGGTGTTGGCGGGTGTCGGGGCTGGCTTAACTATGCGGCATCAGAGCAGATTGTACTGAGAGTGCACCATATGCGGTGTGAAATACCGCACAGATGCGTAAGGAGAAAATACCGCATCAGGCGCCATTCGCCATTCAGGCTGCGCAACTGTTGGGAAGGGCGATCGGTGCGGGCCTCTTCGCTATTACGCCAGCTGGCGAAAGGGGGATGTGCTGCAAGGCGATTAAGTTGGGTAACGCCAGGGTTTTCCCAGTCACGACGTTGTAAAACGACGGCCAGTGAATTCGAGCTCGGTACCCGGGGATCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTGGCGTAATCATGGTCATAGCTGTTTCCTGTGTGAAATTGTTATCCGCTCACAATTCCACACAACATACGAGCCGGAAGCATAAAGTGTAAAGCCTGGGGTGCCTAATGAGTGAGCTAACTCACATTAATTGCGTTGCGCTCACTGCCCGCTTTCCAGTCGGGAAACCTGTCGTGCCAGCTGCATTAATGAATCGGCCAACGCGCGGGGAGAGGCGGTTTGCGTATTGGGCGCTCTTCCGCTTCCTCGCTCACTGACTCGCTGCGCTCGGTCGTTCGGCTGCGGCGAGCGGTATCAGCTCACTCAAAGGCGGTAATACGGTTATCCACAGAATCAGGGGATAACGCAGGAAAGAACATGTGAGCAAAAGGCCAGCAAAAGGCCAGGAACCGTAAAAAGGCCGCGTTGCTGGCGTTTTTCCATAGGCTCCGCCCCCCTGACGAGCATCACAAAAATCGACGCTCAAGTCAGAGGTGGCGAAACCCGACAGGACTATAAAGATACCAGGCGTTTCCCCCTGGAAGCTCCCTCGTGCGCTCTCCTGTTCCGACCCTGCCGCTTACCGGATACCTGTCCGCCTTTCTCCCTTCGGGAAGCGTGGCGCTTTCTCATAGCTCACGCTGTAGGTATCTCAGTTCGGTGTAGGTCGTTCGCTCCAAGCTGGGCTGTGTGCACGAACCCCCCGTTCAGCCCGACCGCTGCGCCTTATCCGGTAACTATCGTCTTGAGTCCAACCCGGTAAGACACGACTTATCGCCACTGGCAGCAGCCACTGGTAACAGGATTAGCAGAGCGAGGTATGTAGGCGGTGCTACAGAGTTCTTGAAGTGGTGGCCTAACTACGGCTACACTAGAAGAACAGTATTTGGTATCTGCGCTCTGCTGAAGCCAGTTACCTTCGGAAAAAGAGTTGGTAGCTCTTGATCCGGCAAACAAACCACCGCTGGTAGCGGTGGTTTTTTTGTTTGCAAGCAGCAGATTACGCGCAGAAAAAAAGGATCTCAAGAAGATCCTTTGATCTTTTCTACGGGGTCTGACGCTCAGTGGAACGAAAACTCACGTTAAGGGATTTTGGTCATGAGATTATCAAAAAGGATCTTCACCTAGATCCTTTTAAATTAAAAATGAAGTTTTAAATCAATCTAAAGTATATATGAGTAAACTTGGTCTGACAGTTACCAATGCTTAATCAGTGAGGCACCTATCTCAGCGATCTGTCTATTTCGTTCATCCATAGTTGCCTGACTCCCCGTCGTGTAGATAACTACGATACGGGAGGGCTTACCATCTGGCCCCAGTGCTGCAATGATACCGCGAGACCCACGCTCACCGGCTCCAGATTTATCAGCAATAAACCAGCCAGCCGGAAGGGCCGAGCGCAGAAGTGGTCCTGCAACTTTATCCGCCTCCATCCAGTCTATTAATTGTTGCCGGGAAGCTAGAGTAAGTAGTTCGCCAGTTAATAGTTTGCGCAACGTTGTTGCCATTGCTACAGGCATCGTGGTGTCACGCTCGTCGTTTGGTATGGCTTCATTCAGCTCCGGTTCCCAACGATCAAGGCGAGTTACATGATCCCCCATGTTGTGCAAAAAAGCGGTTAGCTCCTTCGGTCCTCCGATCGTTGTCAGAAGTAAGTTGGCCGCAGTGTTATCACTCATGGTTATGGCAGCACTGCATAATTCTCTTACTGTCATGCCATCCGTAAGATGCTTTTCTGTGACTGGTGAGTACTCAACCAAGTCATTCTGAGAATAGTGTATGCGGCGACCGAGTTGCTCTTGCCCGGCGTCAATACGGGATAATACCGCGCCACATAGCAGAACTTTAAAAGTGCTCATCATTGGAAAACGTTCTTCGGGGCGAAAACTCTCAAGGATCTTACCGCTGTTGAGATCCAGTTCGATGTAACCCACTCGTGCACCCAACTGATCTTCAGCATCTTTTACTTTCACCAGCGTTTCTGGGTGAGCAAAAACAGGAAGGCAAAATGCCGCAAAAAAGGGAATAAGGGCGACACGGAAATGTTGAATACTCATACTCTTCCTTTTTCAATATTATTGAAGCATTTATCAGGGTTATTGTCTCATGAGCGGATACATATTTGAATGTATTTAGAAAAATAAACAAATAGGGGTTCCGCGCACATTTCCCCGAAAAGTGCCACCTGACGTCTAAGAAACCATTATTATCATGACATTAACCTATAAAAATAGGCGTATCACGAGGCCCTTTCGTC", "topology": "circular", "settings": { "target": { "start": 2660, "end": 40 }, "excluded": [], "forwardTail": "", "reverseTail": "", "conditions": { "oligo_nM": 250, "na_mM": 50, "mg_mM": 0, "dntp_mM": 0, "model": "primer-excess", "saltCorrection": "owczarzy-2004" }, "flank": 60, "minLength": 18, "maxLength": 26, "targetLength": 20, "minTm": 55, "maxTm": 68, "targetTm": 60.05, "maxDeltaTm": 3, "minGc": 30, "maxGc": 70, "minProduct": 120, "maxProduct": 400 } }, "expected": { "method": "bounded-flanks-v2", "pcrMethod": "exact-pair-v1", "templateHash": "8a205af08518dae1b0045c7b098986dca18824ef654e75233603602ab89cad04", "topology": "circular", "templateLength": 2686, "pairs": [ { "id": "+:2589:2609|-:84:64", "forward": { "annealing": "GCGCACATTTCCCCGAAAAGT", "tail": "", "start": 2589, "end": 2609, "tm": 60.09908493176272, "gc": 52.38095238095238, "penalty": 0.2490849317627209, "tmReview": { "value": 60.09908493176272, "method": "oligo-tm-nearest-neighbour", "version": "1.0.0", "saltCorrection": "owczarzy-2004", "conditions": { "oligo_nM": 250, "na_mM": 50, "k_mM": 0, "tris_mM": 0, "mg_mM": 0, "dntp_mM": 0, "model": "primer-excess", "saltCorrection": "owczarzy-2004" }, "limit": "Monovalent correction: Owczarzy 2004, fitted at 69 mM to 1.02 M Na⁺. It is also used from 20 to 69 mM, an extrapolation whose error has not been established here: Owczarzy 2008 places typical PCR buffers (20 to 100 mM monovalent) where this equation applies.", "outside": [] } }, "reverse": { "annealing": "CGGCATCCGCTTACAGACAAG", "tail": "", "start": 84, "end": 64, "tm": 59.961942060960894, "gc": 57.142857142857146, "penalty": 0.28805793903910343, "tmReview": { "value": 59.961942060960894, "method": "oligo-tm-nearest-neighbour", "version": "1.0.0", "saltCorrection": "owczarzy-2004", "conditions": { "oligo_nM": 250, "na_mM": 50, "k_mM": 0, "tris_mM": 0, "mg_mM": 0, "dntp_mM": 0, "model": "primer-excess", "saltCorrection": "owczarzy-2004" }, "limit": "Monovalent correction: Owczarzy 2004, fitted at 69 mM to 1.02 M Na⁺. It is also used from 20 to 69 mM, an extrapolation whose error has not been established here: Owczarzy 2008 places typical PCR buffers (20 to 100 mM monovalent) where this equation applies.", "outside": [] } }, "product": { "id": "+:2589:2609|-:84:64", "sequence": "GCGCACATTTCCCCGAAAAGTGCCACCTGACGTCTAAGAAACCATTATTATCATGACATTAACCTATAAAAATAGGCGTATCACGAGGCCCTTTCGTCTCGCGCGTTTCGGTGATGACGGTGAAAACCTCTGACACATGCAGCTCCCGGAGACGGTCACAGCTTGTCTGTAAGCGGATGCCG", "length": 182, "templateLength": 2686, "templateSpan": 182, "orientation": "+", "crossesOrigin": true, "forward": { "strand": "+", "start": 2589, "end": 2609, "length": 21 }, "reverse": { "strand": "-", "start": 84, "end": 64, "length": 21 } }, "ranking": { "tmDeviation": 0.1371428708018243, "lengthDeviation": 0.4, "deltaTm": 0.1371428708018243, "total": 0.6742857416036486 }, "exactSites": { "forward": 1, "reverse": 1 }, "exactProducts": 1 }, { "id": "+:2596:2615|-:69:50", "forward": { "annealing": "TTTCCCCGAAAAGTGCCACC", "tail": "", "start": 2596, "end": 2615, "tm": 59.731633561719605, "gc": 55.0, "penalty": 0.31836643828039257, "tmReview": { "value": 59.731633561719605, "method": "oligo-tm-nearest-neighbour", "version": "1.0.0", "saltCorrection": "owczarzy-2004", "conditions": { "oligo_nM": 250, "na_mM": 50, "k_mM": 0, "tris_mM": 0, "mg_mM": 0, "dntp_mM": 0, "model": "primer-excess", "saltCorrection": "owczarzy-2004" }, "limit": "Monovalent correction: Owczarzy 2004, fitted at 69 mM to 1.02 M Na⁺. It is also used from 20 to 69 mM, an extrapolation whose error has not been established here: Owczarzy 2008 places typical PCR buffers (20 to 100 mM monovalent) where this equation applies.", "outside": [] } }, "reverse": { "annealing": "GACAAGCTGTGACCGTCTCC", "tail": "", "start": 69, "end": 50, "tm": 59.67973345994426, "gc": 60.0, "penalty": 0.3702665400557379, "tmReview": { "value": 59.67973345994426, "method": "oligo-tm-nearest-neighbour", "version": "1.0.0", "saltCorrection": "owczarzy-2004", "conditions": { "oligo_nM": 250, "na_mM": 50, "k_mM": 0, "tris_mM": 0, "mg_mM": 0, "dntp_mM": 0, "model": "primer-excess", "saltCorrection": "owczarzy-2004" }, "limit": "Monovalent correction: Owczarzy 2004, fitted at 69 mM to 1.02 M Na⁺. It is also used from 20 to 69 mM, an extrapolation whose error has not been established here: Owczarzy 2008 places typical PCR buffers (20 to 100 mM monovalent) where this equation applies.", "outside": [] } }, "product": { "id": "+:2596:2615|-:69:50", "sequence": "TTTCCCCGAAAAGTGCCACCTGACGTCTAAGAAACCATTATTATCATGACATTAACCTATAAAAATAGGCGTATCACGAGGCCCTTTCGTCTCGCGCGTTTCGGTGATGACGGTGAAAACCTCTGACACATGCAGCTCCCGGAGACGGTCACAGCTTGTC", "length": 160, "templateLength": 2686, "templateSpan": 160, "orientation": "+", "crossesOrigin": true, "forward": { "strand": "+", "start": 2596, "end": 2615, "length": 20 }, "reverse": { "strand": "-", "start": 69, "end": 50, "length": 20 } }, "ranking": { "tmDeviation": 0.6886329783361305, "lengthDeviation": 0.0, "deltaTm": 0.05190010177534532, "total": 0.7405330801114758 }, "exactSites": { "forward": 1, "reverse": 1 }, "exactProducts": 1 }, { "id": "+:2589:2609|-:67:49", "forward": { "annealing": "GCGCACATTTCCCCGAAAAGT", "tail": "", "start": 2589, "end": 2609, "tm": 60.09908493176272, "gc": 52.38095238095238, "penalty": 0.2490849317627209, "tmReview": { "value": 60.09908493176272, "method": "oligo-tm-nearest-neighbour", "version": "1.0.0", "saltCorrection": "owczarzy-2004", "conditions": { "oligo_nM": 250, "na_mM": 50, "k_mM": 0, "tris_mM": 0, "mg_mM": 0, "dntp_mM": 0, "model": "primer-excess", "saltCorrection": "owczarzy-2004" }, "limit": "Monovalent correction: Owczarzy 2004, fitted at 69 mM to 1.02 M Na⁺. It is also used from 20 to 69 mM, an extrapolation whose error has not been established here: Owczarzy 2008 places typical PCR buffers (20 to 100 mM monovalent) where this equation applies.", "outside": [] } }, "reverse": { "annealing": "CAAGCTGTGACCGTCTCCG", "tail": "", "start": 67, "end": 49, "tm": 60.22135733315076, "gc": 63.1578947368421, "penalty": 0.3713573331507661, "tmReview": { "value": 60.22135733315076, "method": "oligo-tm-nearest-neighbour", "version": "1.0.0", "saltCorrection": "owczarzy-2004", "conditions": { "oligo_nM": 250, "na_mM": 50, "k_mM": 0, "tris_mM": 0, "mg_mM": 0, "dntp_mM": 0, "model": "primer-excess", "saltCorrection": "owczarzy-2004" }, "limit": "Monovalent correction: Owczarzy 2004, fitted at 69 mM to 1.02 M Na⁺. It is also used from 20 to 69 mM, an extrapolation whose error has not been established here: Owczarzy 2008 places typical PCR buffers (20 to 100 mM monovalent) where this equation applies.", "outside": [] } }, "product": { "id": "+:2589:2609|-:67:49", "sequence": "GCGCACATTTCCCCGAAAAGTGCCACCTGACGTCTAAGAAACCATTATTATCATGACATTAACCTATAAAAATAGGCGTATCACGAGGCCCTTTCGTCTCGCGCGTTTCGGTGATGACGGTGAAAACCTCTGACACATGCAGCTCCCGGAGACGGTCACAGCTTG", "length": 165, "templateLength": 2686, "templateSpan": 165, "orientation": "+", "crossesOrigin": true, "forward": { "strand": "+", "start": 2589, "end": 2609, "length": 21 }, "reverse": { "strand": "-", "start": 67, "end": 49, "length": 19 } }, "ranking": { "tmDeviation": 0.22044226491348695, "lengthDeviation": 0.4, "deltaTm": 0.12227240138804518, "total": 0.7427146663015322 }, "exactSites": { "forward": 1, "reverse": 1 }, "exactProducts": 1 }, { "id": "+:2596:2615|-:84:64", "forward": { "annealing": "TTTCCCCGAAAAGTGCCACC", "tail": "", "start": 2596, "end": 2615, "tm": 59.731633561719605, "gc": 55.0, "penalty": 0.31836643828039257, "tmReview": { "value": 59.731633561719605, "method": "oligo-tm-nearest-neighbour", "version": "1.0.0", "saltCorrection": "owczarzy-2004", "conditions": { "oligo_nM": 250, "na_mM": 50, "k_mM": 0, "tris_mM": 0, "mg_mM": 0, "dntp_mM": 0, "model": "primer-excess", "saltCorrection": "owczarzy-2004" }, "limit": "Monovalent correction: Owczarzy 2004, fitted at 69 mM to 1.02 M Na⁺. It is also used from 20 to 69 mM, an extrapolation whose error has not been established here: Owczarzy 2008 places typical PCR buffers (20 to 100 mM monovalent) where this equation applies.", "outside": [] } }, "reverse": { "annealing": "CGGCATCCGCTTACAGACAAG", "tail": "", "start": 84, "end": 64, "tm": 59.961942060960894, "gc": 57.142857142857146, "penalty": 0.28805793903910343, "tmReview": { "value": 59.961942060960894, "method": "oligo-tm-nearest-neighbour", "version": "1.0.0", "saltCorrection": "owczarzy-2004", "conditions": { "oligo_nM": 250, "na_mM": 50, "k_mM": 0, "tris_mM": 0, "mg_mM": 0, "dntp_mM": 0, "model": "primer-excess", "saltCorrection": "owczarzy-2004" }, "limit": "Monovalent correction: Owczarzy 2004, fitted at 69 mM to 1.02 M Na⁺. It is also used from 20 to 69 mM, an extrapolation whose error has not been established here: Owczarzy 2008 places typical PCR buffers (20 to 100 mM monovalent) where this equation applies.", "outside": [] } }, "product": { "id": "+:2596:2615|-:84:64", "sequence": "TTTCCCCGAAAAGTGCCACCTGACGTCTAAGAAACCATTATTATCATGACATTAACCTATAAAAATAGGCGTATCACGAGGCCCTTTCGTCTCGCGCGTTTCGGTGATGACGGTGAAAACCTCTGACACATGCAGCTCCCGGAGACGGTCACAGCTTGTCTGTAAGCGGATGCCG", "length": 175, "templateLength": 2686, "templateSpan": 175, "orientation": "+", "crossesOrigin": true, "forward": { "strand": "+", "start": 2596, "end": 2615, "length": 20 }, "reverse": { "strand": "-", "start": 84, "end": 64, "length": 21 } }, "ranking": { "tmDeviation": 0.406424377319496, "lengthDeviation": 0.2, "deltaTm": 0.23030849924128916, "total": 0.8367328765607851 }, "exactSites": { "forward": 1, "reverse": 1 }, "exactProducts": 1 }, { "id": "+:2602:2622|-:67:49", "forward": { "annealing": "CGAAAAGTGCCACCTGACGTC", "tail": "", "start": 2602, "end": 2622, "tm": 60.27949512360135, "gc": 57.142857142857146, "penalty": 0.42949512360135317, "tmReview": { "value": 60.27949512360135, "method": "oligo-tm-nearest-neighbour", "version": "1.0.0", "saltCorrection": "owczarzy-2004", "conditions": { "oligo_nM": 250, "na_mM": 50, "k_mM": 0, "tris_mM": 0, "mg_mM": 0, "dntp_mM": 0, "model": "primer-excess", "saltCorrection": "owczarzy-2004" }, "limit": "Monovalent correction: Owczarzy 2004, fitted at 69 mM to 1.02 M Na⁺. It is also used from 20 to 69 mM, an extrapolation whose error has not been established here: Owczarzy 2008 places typical PCR buffers (20 to 100 mM monovalent) where this equation applies.", "outside": [] } }, "reverse": { "annealing": "CAAGCTGTGACCGTCTCCG", "tail": "", "start": 67, "end": 49, "tm": 60.22135733315076, "gc": 63.1578947368421, "penalty": 0.3713573331507661, "tmReview": { "value": 60.22135733315076, "method": "oligo-tm-nearest-neighbour", "version": "1.0.0", "saltCorrection": "owczarzy-2004", "conditions": { "oligo_nM": 250, "na_mM": 50, "k_mM": 0, "tris_mM": 0, "mg_mM": 0, "dntp_mM": 0, "model": "primer-excess", "saltCorrection": "owczarzy-2004" }, "limit": "Monovalent correction: Owczarzy 2004, fitted at 69 mM to 1.02 M Na⁺. It is also used from 20 to 69 mM, an extrapolation whose error has not been established here: Owczarzy 2008 places typical PCR buffers (20 to 100 mM monovalent) where this equation applies.", "outside": [] } }, "product": { "id": "+:2602:2622|-:67:49", "sequence": "CGAAAAGTGCCACCTGACGTCTAAGAAACCATTATTATCATGACATTAACCTATAAAAATAGGCGTATCACGAGGCCCTTTCGTCTCGCGCGTTTCGGTGATGACGGTGAAAACCTCTGACACATGCAGCTCCCGGAGACGGTCACAGCTTG", "length": 152, "templateLength": 2686, "templateSpan": 152, "orientation": "+", "crossesOrigin": true, "forward": { "strand": "+", "start": 2602, "end": 2622, "length": 21 }, "reverse": { "strand": "-", "start": 67, "end": 49, "length": 19 } }, "ranking": { "tmDeviation": 0.4008524567521192, "lengthDeviation": 0.4, "deltaTm": 0.05813779045058709, "total": 0.8589902472027063 }, "exactSites": { "forward": 1, "reverse": 1 }, "exactProducts": 1 } ], "counts": { "windows": 1098, "boundary": 0, "excluded": 0, "gc": 321, "tm": 193, "validForward": 281, "validReverse": 303, "productSize": 0, "deltaTm": 0, "eligiblePairs": 576, "exactChecked": 5, "exactRefused": 0 }, "capped": true } }, { "id": "design-lac-no-window", "input": { "templateName": "J01636.1 1..600", "template": "GACACCATCGAATGGCGCAAAACCTTTCGCGGTATGGCATGATAGCGCCCGGAAGAGAGTCAATTCAGGGTGGTGAATGTGAAACCAGTAACGTTATACGATGTCGCAGAGTATGCCGGTGTCTCTTATCAGACCGTTTCCCGCGTGGTGAACCAGGCCAGCCACGTTTCTGCGAAAACGCGGGAAAAAGTGGAAGCGGCGATGGCGGAGCTGAATTACATTCCCAACCGCGTGGCACAACAACTGGCGGGCAAACAGTCGTTGCTGATTGGCGTTGCCACCTCCAGTCTGGCCCTGCACGCGCCGTCGCAAATTGTCGCGGCGATTAAATCTCGCGCCGATCAACTGGGTGCCAGCGTGGTGGTGTCGATGGTAGAACGAAGCGGCGTCGAAGCCTGTAAAGCGGCGGTGCACAATCTTCTCGCGCAACGCGTCAGTGGGCTGATCATTAACTATCCGCTGGATGACCAGGATGCCATTGCTGTGGAAGCTGCCTGCACTAATGTTCCGGCGTTATTTCTTGATGTCTCTGACCAGACACCCATCAACAGTATTATTTTCTCCCATGAAGACGGTACGCGACTGGGCGTGGAGCATCTG", "topology": "linear", "settings": { "target": { "start": 201, "end": 400 }, "excluded": [], "forwardTail": "", "reverseTail": "", "conditions": { "oligo_nM": 250, "na_mM": 50, "mg_mM": 0, "dntp_mM": 0, "model": "primer-excess", "saltCorrection": "owczarzy-2004" }, "flank": 50, "minLength": 18, "maxLength": 26, "targetLength": 20, "minTm": 80, "maxTm": 95, "targetTm": 85, "maxDeltaTm": 3, "minGc": 30, "maxGc": 70, "minProduct": 180, "maxProduct": 420 } }, "expected": { "method": "bounded-flanks-v2", "pcrMethod": "exact-pair-v1", "templateHash": "fd182829946e68ba90d7c14906883ef31f663537dade5f617f804b8ce46dc316", "topology": "linear", "templateLength": 600, "pairs": [], "counts": { "windows": 918, "boundary": 0, "excluded": 0, "gc": 40, "tm": 878, "validForward": 0, "validReverse": 0, "productSize": 0, "deltaTm": 0, "eligiblePairs": 0, "exactChecked": 0, "exactRefused": 0 }, "capped": false } }, { "id": "design-lac-no-product", "input": { "templateName": "J01636.1 1..600", "template": "GACACCATCGAATGGCGCAAAACCTTTCGCGGTATGGCATGATAGCGCCCGGAAGAGAGTCAATTCAGGGTGGTGAATGTGAAACCAGTAACGTTATACGATGTCGCAGAGTATGCCGGTGTCTCTTATCAGACCGTTTCCCGCGTGGTGAACCAGGCCAGCCACGTTTCTGCGAAAACGCGGGAAAAAGTGGAAGCGGCGATGGCGGAGCTGAATTACATTCCCAACCGCGTGGCACAACAACTGGCGGGCAAACAGTCGTTGCTGATTGGCGTTGCCACCTCCAGTCTGGCCCTGCACGCGCCGTCGCAAATTGTCGCGGCGATTAAATCTCGCGCCGATCAACTGGGTGCCAGCGTGGTGGTGTCGATGGTAGAACGAAGCGGCGTCGAAGCCTGTAAAGCGGCGGTGCACAATCTTCTCGCGCAACGCGTCAGTGGGCTGATCATTAACTATCCGCTGGATGACCAGGATGCCATTGCTGTGGAAGCTGCCTGCACTAATGTTCCGGCGTTATTTCTTGATGTCTCTGACCAGACACCCATCAACAGTATTATTTTCTCCCATGAAGACGGTACGCGACTGGGCGTGGAGCATCTG", "topology": "linear", "settings": { "target": { "start": 201, "end": 400 }, "excluded": [], "forwardTail": "", "reverseTail": "", "conditions": { "oligo_nM": 250, "na_mM": 50, "mg_mM": 0, "dntp_mM": 0, "model": "primer-excess", "saltCorrection": "owczarzy-2004" }, "flank": 50, "minLength": 18, "maxLength": 26, "targetLength": 20, "minTm": 55, "maxTm": 68, "targetTm": 60, "maxDeltaTm": 3, "minGc": 30, "maxGc": 70, "minProduct": 900, "maxProduct": 1000 } }, "expected": { "method": "bounded-flanks-v2", "pcrMethod": "exact-pair-v1", "templateHash": "fd182829946e68ba90d7c14906883ef31f663537dade5f617f804b8ce46dc316", "topology": "linear", "templateLength": 600, "pairs": [], "counts": { "windows": 918, "boundary": 0, "excluded": 0, "gc": 40, "tm": 234, "validForward": 353, "validReverse": 291, "productSize": 576, "deltaTm": 0, "eligiblePairs": 0, "exactChecked": 0, "exactRefused": 0 }, "capped": true } } ], "tmCases": [ { "id": "tm-default-50", "input": { "sequence": "ACGTTAGCGATCCGATGCCA", "conditions": {} }, "expected": { "value": 60.373395091885016, "method": "oligo-tm-nearest-neighbour", "version": "1.0.0", "saltCorrection": "owczarzy-2004", "conditions": { "oligo_nM": 250, "na_mM": 50, "k_mM": 0, "tris_mM": 0, "mg_mM": 0, "dntp_mM": 0, "model": "primer-excess", "saltCorrection": "owczarzy-2004" }, "limit": "Monovalent correction: Owczarzy 2004, fitted at 69 mM to 1.02 M Na⁺. It is also used from 20 to 69 mM, an extrapolation whose error has not been established here: Owczarzy 2008 places typical PCR buffers (20 to 100 mM monovalent) where this equation applies.", "outside": [] }, "expectedOutsideFit": [], "qualification": "50 mM is below the measured 69 mM floor; the limit text qualifies it, with no separate outside note under the declared 20 mM warning threshold." }, { "id": "tm-measured-69", "input": { "sequence": "ACGTTAGCGATCCGATGCCA", "conditions": { "na_mM": 69 } }, "expected": { "value": 62.871149879529696, "method": "oligo-tm-nearest-neighbour", "version": "1.0.0", "saltCorrection": "owczarzy-2004", "conditions": { "oligo_nM": 250, "na_mM": 69, "k_mM": 0, "tris_mM": 0, "mg_mM": 0, "dntp_mM": 0, "model": "primer-excess", "saltCorrection": "owczarzy-2004" }, "limit": "Monovalent correction: Owczarzy 2004, fitted at 69 mM to 1.02 M Na⁺. It is also used from 20 to 69 mM, an extrapolation whose error has not been established here: Owczarzy 2008 places typical PCR buffers (20 to 100 mM monovalent) where this equation applies.", "outside": [] }, "expectedOutsideFit": [], "qualification": "At the stated lower measured Na boundary; no outside warning." }, { "id": "tm-low-na-10", "input": { "sequence": "ACGTTAGCGATCCGATGCCA", "conditions": { "na_mM": 10 } }, "expected": { "value": 45.434929699142685, "method": "oligo-tm-nearest-neighbour", "version": "1.0.0", "saltCorrection": "owczarzy-2004", "conditions": { "oligo_nM": 250, "na_mM": 10, "k_mM": 0, "tris_mM": 0, "mg_mM": 0, "dntp_mM": 0, "model": "primer-excess", "saltCorrection": "owczarzy-2004" }, "limit": "Monovalent correction: Owczarzy 2004, fitted at 69 mM to 1.02 M Na⁺. It is also used from 20 to 69 mM, an extrapolation whose error has not been established here: Owczarzy 2008 places typical PCR buffers (20 to 100 mM monovalent) where this equation applies.", "outside": [ "Salt correction outside its fitted range: Owczarzy 2004 was fitted at 69 mM to 1.02 M Na⁺; 10 mM monovalent is an extrapolation." ] }, "expectedOutsideFit": [ { "code": "owczarzy-2004-monovalent", "parameter": "monovalent", "value_mM": 10.0, "range_mM": [ 69, 1020 ], "unverified": false } ], "qualification": "Accepted numerical extrapolation with explicit outside warning; no experimental accuracy claim." }, { "id": "tm-warning-boundary-20", "input": { "sequence": "ACGTTAGCGATCCGATGCCA", "conditions": { "na_mM": 20 } }, "expected": { "value": 52.332538579391894, "method": "oligo-tm-nearest-neighbour", "version": "1.0.0", "saltCorrection": "owczarzy-2004", "conditions": { "oligo_nM": 250, "na_mM": 20, "k_mM": 0, "tris_mM": 0, "mg_mM": 0, "dntp_mM": 0, "model": "primer-excess", "saltCorrection": "owczarzy-2004" }, "limit": "Monovalent correction: Owczarzy 2004, fitted at 69 mM to 1.02 M Na⁺. It is also used from 20 to 69 mM, an extrapolation whose error has not been established here: Owczarzy 2008 places typical PCR buffers (20 to 100 mM monovalent) where this equation applies.", "outside": [] }, "expectedOutsideFit": [], "qualification": "Warning threshold inclusive; still qualified as extrapolation in the limit text." }, { "id": "tm-magnesium", "input": { "sequence": "ACGTTAGCGATCCGATGCCA", "conditions": { "mg_mM": 1.5, "dntp_mM": 0.2 } }, "expected": { "value": 66.56372428190372, "method": "oligo-tm-nearest-neighbour", "version": "1.0.0", "saltCorrection": "owczarzy-2008", "conditions": { "oligo_nM": 250, "na_mM": 50, "k_mM": 0, "tris_mM": 0, "mg_mM": 1.5, "dntp_mM": 0.2, "model": "primer-excess", "saltCorrection": "owczarzy-2008" }, "limit": "Magnesium correction: Owczarzy 2008. Its free Mg²⁺ range, recalled as 0.5 to 600 mM, is Unverified: not yet checked against Owczarzy 2008.", "outside": [] }, "expectedOutsideFit": [], "qualification": "Mixed cations; retained magnesium range remains explicitly Unverified." }, { "id": "tm-santalucia", "input": { "sequence": "ACGTTAGCGATCCGATGCCA", "conditions": { "saltCorrection": "santalucia-1998" } }, "expected": { "value": 60.357173382208316, "method": "oligo-tm-nearest-neighbour", "version": "1.0.0", "saltCorrection": "santalucia-1998", "conditions": { "oligo_nM": 250, "na_mM": 50, "k_mM": 0, "tris_mM": 0, "mg_mM": 0, "dntp_mM": 0, "model": "primer-excess", "saltCorrection": "santalucia-1998" }, "limit": "Entropy correction: SantaLucia 1998. Its fitted range has not yet been read against the paper.", "outside": [] }, "expectedOutsideFit": [], "qualification": "Alternative salt correction; fitted range remains unread, not invented." }, { "id": "tm-magnesium-overrides-santalucia", "input": { "sequence": "ACGTTAGCGATCCGATGCCA", "conditions": { "mg_mM": 1.5, "dntp_mM": 0.2, "saltCorrection": "santalucia-1998" } }, "expected": { "value": 66.56372428190372, "method": "oligo-tm-nearest-neighbour", "version": "1.0.0", "saltCorrection": "owczarzy-2008", "conditions": { "oligo_nM": 250, "na_mM": 50, "k_mM": 0, "tris_mM": 0, "mg_mM": 1.5, "dntp_mM": 0.2, "model": "primer-excess", "saltCorrection": "owczarzy-2008" }, "limit": "Magnesium correction: Owczarzy 2008. Its free Mg²⁺ range, recalled as 0.5 to 600 mM, is Unverified: not yet checked against Owczarzy 2008.", "outside": [] }, "expectedOutsideFit": [], "qualification": "Effective Mg correction is Owczarzy 2008 even if another correction was requested." }, { "id": "tm-low-magnesium", "input": { "sequence": "ACGTTAGCGATCCGATGCCA", "conditions": { "mg_mM": 0.2 } }, "expected": { "value": 61.693473502150255, "method": "oligo-tm-nearest-neighbour", "version": "1.0.0", "saltCorrection": "owczarzy-2008", "conditions": { "oligo_nM": 250, "na_mM": 50, "k_mM": 0, "tris_mM": 0, "mg_mM": 0.2, "dntp_mM": 0, "model": "primer-excess", "saltCorrection": "owczarzy-2008" }, "limit": "Magnesium correction: Owczarzy 2008. Its free Mg²⁺ range, recalled as 0.5 to 600 mM, is Unverified: not yet checked against Owczarzy 2008.", "outside": [ "Free Mg²⁺ 0.2 mM: outside 0.5 to 600 mM, the range recalled for Owczarzy 2008. Unverified: not yet checked against Owczarzy 2008." ] }, "expectedOutsideFit": [ { "code": "owczarzy-2008-free-mg", "parameter": "free-mg", "value_mM": 0.2, "range_mM": [ 0.5, 600 ], "unverified": true } ], "qualification": "Free Mg below recalled range, in the divalent regime, with Unverified outside note." }, { "id": "tm-trace-magnesium-monovalent", "input": { "sequence": "ACGTTAGCGATCCGATGCCA", "conditions": { "mg_mM": 0.01 } }, "expected": { "value": 60.373395091885016, "method": "oligo-tm-nearest-neighbour", "version": "1.0.0", "saltCorrection": "owczarzy-2008", "conditions": { "oligo_nM": 250, "na_mM": 50, "k_mM": 0, "tris_mM": 0, "mg_mM": 0.01, "dntp_mM": 0, "model": "primer-excess", "saltCorrection": "owczarzy-2008" }, "limit": "Monovalent correction: Owczarzy 2004, fitted at 69 mM to 1.02 M Na⁺. It is also used from 20 to 69 mM, an extrapolation whose error has not been established here: Owczarzy 2008 places typical PCR buffers (20 to 100 mM monovalent) where this equation applies.", "outside": [] }, "expectedOutsideFit": [], "qualification": "Selected correction remains Owczarzy 2008 but low R uses the monovalent equation and its limit text." }, { "id": "tm-no-magnesium-normalizes-2008", "input": { "sequence": "ACGTTAGCGATCCGATGCCA", "conditions": { "saltCorrection": "owczarzy-2008" } }, "expected": { "value": 60.373395091885016, "method": "oligo-tm-nearest-neighbour", "version": "1.0.0", "saltCorrection": "owczarzy-2004", "conditions": { "oligo_nM": 250, "na_mM": 50, "k_mM": 0, "tris_mM": 0, "mg_mM": 0, "dntp_mM": 0, "model": "primer-excess", "saltCorrection": "owczarzy-2004" }, "limit": "Monovalent correction: Owczarzy 2004, fitted at 69 mM to 1.02 M Na⁺. It is also used from 20 to 69 mM, an extrapolation whose error has not been established here: Owczarzy 2008 places typical PCR buffers (20 to 100 mM monovalent) where this equation applies.", "outside": [] }, "expectedOutsideFit": [], "qualification": "No Mg uses Owczarzy 2004; normalized output names the effective correction." } ], "recordCases": [ { "id": "record-v2-valid", "input": [ { "v": 1, "id": "oracle-primer-set", "label": "Independent record contract example", "createdAt": "2026-10-11T00:00:00.000Z", "notes": "", "forward": { "annealing": "CCAGCCACGTTTCTGCGAAA", "tail": "" }, "reverse": { "annealing": "TGCGCGAGAAGATTGTGCAC", "tail": "" }, "conditions": { "oligo_nM": 250, "na_mM": 50, "mg_mM": 0, "dntp_mM": 0, "model": "primer-excess", "saltCorrection": "owczarzy-2004" }, "witness": { "templateHash": "fd182829946e68ba90d7c14906883ef31f663537dade5f617f804b8ce46dc316", "templateLength": 600, "topology": "linear", "coordinates": "1-based-inclusive-5prime-to-3prime", "forward": { "strand": "+", "start": 158, "end": 177, "length": 20 }, "reverse": { "strand": "-", "start": 428, "end": 409, "length": 20 }, "productId": "+:158:177|-:428:409", "method": "exact-pair-v1" }, "design": { "method": "bounded-flanks-v2", "target": { "start": 201, "end": 400 }, "capped": true, "ranking": { "tmDeviation": 0.06462320381317, "lengthDeviation": 0.0, "deltaTm": 0.03260351198753142, "total": 0.09722671580070141 }, "counts": { "windows": 918, "boundary": 0, "excluded": 0, "gc": 40, "tm": 234, "validForward": 353, "validReverse": 291, "productSize": 0, "deltaTm": 0, "eligiblePairs": 576, "exactChecked": 5, "exactRefused": 0 }, "settings": { "target": { "start": 201, "end": 400 }, "excluded": [], "forwardTail": "", "reverseTail": "", "conditions": { "oligo_nM": 250, "na_mM": 50, "mg_mM": 0, "dntp_mM": 0, "model": "primer-excess", "saltCorrection": "owczarzy-2004" }, "flank": 50, "minLength": 18, "maxLength": 26, "targetLength": 20, "minTm": 55, "maxTm": 68, "targetTm": 59.95, "maxDeltaTm": 3, "minGc": 30, "maxGc": 70, "minProduct": 180, "maxProduct": 420 }, "structures": [ { "kind": "forward hairpin", "evaluated": false, "dG37": null, "detail": "Not evaluated in this hand-authored reader-contract example." }, { "kind": "reverse hairpin", "evaluated": false, "dG37": null, "detail": "Not evaluated in this hand-authored reader-contract example." }, { "kind": "forward self-dimer", "evaluated": false, "dG37": null, "detail": "Not evaluated in this hand-authored reader-contract example." }, { "kind": "reverse self-dimer", "evaluated": false, "dG37": null, "detail": "Not evaluated in this hand-authored reader-contract example." }, { "kind": "cross-dimer", "evaluated": false, "dG37": null, "detail": "Not evaluated in this hand-authored reader-contract example." } ], "limitations": [ "Reader-contract fixture: no secondary structure calculation is represented." ], "temperatures": { "forward": { "value": 59.99861335790035, "method": "oligo-tm-nearest-neighbour", "version": "1.0.0", "saltCorrection": "owczarzy-2004", "conditions": { "oligo_nM": 250, "na_mM": 50, "k_mM": 0, "tris_mM": 0, "mg_mM": 0, "dntp_mM": 0, "model": "primer-excess", "saltCorrection": "owczarzy-2004" }, "limit": "Monovalent correction: Owczarzy 2004, fitted at 69 mM to 1.02 M Na⁺. It is also used from 20 to 69 mM, an extrapolation whose error has not been established here: Owczarzy 2008 places typical PCR buffers (20 to 100 mM monovalent) where this equation applies.", "outside": [] }, "reverse": { "value": 59.96600984591282, "method": "oligo-tm-nearest-neighbour", "version": "1.0.0", "saltCorrection": "owczarzy-2004", "conditions": { "oligo_nM": 250, "na_mM": 50, "k_mM": 0, "tris_mM": 0, "mg_mM": 0, "dntp_mM": 0, "model": "primer-excess", "saltCorrection": "owczarzy-2004" }, "limit": "Monovalent correction: Owczarzy 2004, fitted at 69 mM to 1.02 M Na⁺. It is also used from 20 to 69 mM, an extrapolation whose error has not been established here: Owczarzy 2008 places typical PCR buffers (20 to 100 mM monovalent) where this equation applies.", "outside": [] } } } } ], "expectedAccepted": true, "reason": "Sparse settings and explicit normalized retained conditions are semantically consistent; retained data must survive unchanged.", "expectedRead": [ { "v": 1, "id": "oracle-primer-set", "label": "Independent record contract example", "createdAt": "2026-10-11T00:00:00.000Z", "notes": "", "forward": { "annealing": "CCAGCCACGTTTCTGCGAAA", "tail": "" }, "reverse": { "annealing": "TGCGCGAGAAGATTGTGCAC", "tail": "" }, "conditions": { "oligo_nM": 250, "na_mM": 50, "mg_mM": 0, "dntp_mM": 0, "model": "primer-excess", "saltCorrection": "owczarzy-2004" }, "witness": { "templateHash": "fd182829946e68ba90d7c14906883ef31f663537dade5f617f804b8ce46dc316", "templateLength": 600, "topology": "linear", "coordinates": "1-based-inclusive-5prime-to-3prime", "forward": { "strand": "+", "start": 158, "end": 177, "length": 20 }, "reverse": { "strand": "-", "start": 428, "end": 409, "length": 20 }, "productId": "+:158:177|-:428:409", "method": "exact-pair-v1" }, "design": { "method": "bounded-flanks-v2", "target": { "start": 201, "end": 400 }, "capped": true, "ranking": { "tmDeviation": 0.06462320381317, "lengthDeviation": 0.0, "deltaTm": 0.03260351198753142, "total": 0.09722671580070141 }, "counts": { "windows": 918, "boundary": 0, "excluded": 0, "gc": 40, "tm": 234, "validForward": 353, "validReverse": 291, "productSize": 0, "deltaTm": 0, "eligiblePairs": 576, "exactChecked": 5, "exactRefused": 0 }, "settings": { "target": { "start": 201, "end": 400 }, "excluded": [], "forwardTail": "", "reverseTail": "", "conditions": { "oligo_nM": 250, "na_mM": 50, "mg_mM": 0, "dntp_mM": 0, "model": "primer-excess", "saltCorrection": "owczarzy-2004" }, "flank": 50, "minLength": 18, "maxLength": 26, "targetLength": 20, "minTm": 55, "maxTm": 68, "targetTm": 59.95, "maxDeltaTm": 3, "minGc": 30, "maxGc": 70, "minProduct": 180, "maxProduct": 420 }, "structures": [ { "kind": "forward hairpin", "evaluated": false, "dG37": null, "detail": "Not evaluated in this hand-authored reader-contract example." }, { "kind": "reverse hairpin", "evaluated": false, "dG37": null, "detail": "Not evaluated in this hand-authored reader-contract example." }, { "kind": "forward self-dimer", "evaluated": false, "dG37": null, "detail": "Not evaluated in this hand-authored reader-contract example." }, { "kind": "reverse self-dimer", "evaluated": false, "dG37": null, "detail": "Not evaluated in this hand-authored reader-contract example." }, { "kind": "cross-dimer", "evaluated": false, "dG37": null, "detail": "Not evaluated in this hand-authored reader-contract example." } ], "limitations": [ "Reader-contract fixture: no secondary structure calculation is represented." ], "temperatures": { "forward": { "value": 59.99861335790035, "method": "oligo-tm-nearest-neighbour", "version": "1.0.0", "saltCorrection": "owczarzy-2004", "conditions": { "oligo_nM": 250, "na_mM": 50, "k_mM": 0, "tris_mM": 0, "mg_mM": 0, "dntp_mM": 0, "model": "primer-excess", "saltCorrection": "owczarzy-2004" }, "limit": "Monovalent correction: Owczarzy 2004, fitted at 69 mM to 1.02 M Na⁺. It is also used from 20 to 69 mM, an extrapolation whose error has not been established here: Owczarzy 2008 places typical PCR buffers (20 to 100 mM monovalent) where this equation applies.", "outside": [] }, "reverse": { "value": 59.96600984591282, "method": "oligo-tm-nearest-neighbour", "version": "1.0.0", "saltCorrection": "owczarzy-2004", "conditions": { "oligo_nM": 250, "na_mM": 50, "k_mM": 0, "tris_mM": 0, "mg_mM": 0, "dntp_mM": 0, "model": "primer-excess", "saltCorrection": "owczarzy-2004" }, "limit": "Monovalent correction: Owczarzy 2004, fitted at 69 mM to 1.02 M Na⁺. It is also used from 20 to 69 mM, an extrapolation whose error has not been established here: Owczarzy 2008 places typical PCR buffers (20 to 100 mM monovalent) where this equation applies.", "outside": [] } } } } ] }, { "id": "record-v2-explicit-defaults", "input": [ { "v": 1, "id": "oracle-primer-set", "label": "Independent record contract example", "createdAt": "2026-10-11T00:00:00.000Z", "notes": "", "forward": { "annealing": "CCAGCCACGTTTCTGCGAAA", "tail": "" }, "reverse": { "annealing": "TGCGCGAGAAGATTGTGCAC", "tail": "" }, "conditions": { "oligo_nM": 250, "na_mM": 50, "k_mM": 0, "tris_mM": 0, "mg_mM": 0, "dntp_mM": 0, "model": "primer-excess", "saltCorrection": "owczarzy-2004" }, "witness": { "templateHash": "fd182829946e68ba90d7c14906883ef31f663537dade5f617f804b8ce46dc316", "templateLength": 600, "topology": "linear", "coordinates": "1-based-inclusive-5prime-to-3prime", "forward": { "strand": "+", "start": 158, "end": 177, "length": 20 }, "reverse": { "strand": "-", "start": 428, "end": 409, "length": 20 }, "productId": "+:158:177|-:428:409", "method": "exact-pair-v1" }, "design": { "method": "bounded-flanks-v2", "target": { "start": 201, "end": 400 }, "capped": true, "ranking": { "tmDeviation": 0.06462320381317, "lengthDeviation": 0.0, "deltaTm": 0.03260351198753142, "total": 0.09722671580070141 }, "counts": { "windows": 918, "boundary": 0, "excluded": 0, "gc": 40, "tm": 234, "validForward": 353, "validReverse": 291, "productSize": 0, "deltaTm": 0, "eligiblePairs": 576, "exactChecked": 5, "exactRefused": 0 }, "settings": { "target": { "start": 201, "end": 400 }, "excluded": [], "forwardTail": "", "reverseTail": "", "conditions": { "oligo_nM": 250, "na_mM": 50, "k_mM": 0, "tris_mM": 0, "mg_mM": 0, "dntp_mM": 0, "model": "primer-excess", "saltCorrection": "owczarzy-2004" }, "flank": 50, "minLength": 18, "maxLength": 26, "targetLength": 20, "minTm": 55, "maxTm": 68, "targetTm": 59.95, "maxDeltaTm": 3, "minGc": 30, "maxGc": 70, "minProduct": 180, "maxProduct": 420 }, "structures": [ { "kind": "forward hairpin", "evaluated": false, "dG37": null, "detail": "Not evaluated in this hand-authored reader-contract example." }, { "kind": "reverse hairpin", "evaluated": false, "dG37": null, "detail": "Not evaluated in this hand-authored reader-contract example." }, { "kind": "forward self-dimer", "evaluated": false, "dG37": null, "detail": "Not evaluated in this hand-authored reader-contract example." }, { "kind": "reverse self-dimer", "evaluated": false, "dG37": null, "detail": "Not evaluated in this hand-authored reader-contract example." }, { "kind": "cross-dimer", "evaluated": false, "dG37": null, "detail": "Not evaluated in this hand-authored reader-contract example." } ], "limitations": [ "Reader-contract fixture: no secondary structure calculation is represented." ], "temperatures": { "forward": { "value": 59.99861335790035, "method": "oligo-tm-nearest-neighbour", "version": "1.0.0", "saltCorrection": "owczarzy-2004", "conditions": { "oligo_nM": 250, "na_mM": 50, "k_mM": 0, "tris_mM": 0, "mg_mM": 0, "dntp_mM": 0, "model": "primer-excess", "saltCorrection": "owczarzy-2004" }, "limit": "Monovalent correction: Owczarzy 2004, fitted at 69 mM to 1.02 M Na⁺. It is also used from 20 to 69 mM, an extrapolation whose error has not been established here: Owczarzy 2008 places typical PCR buffers (20 to 100 mM monovalent) where this equation applies.", "outside": [] }, "reverse": { "value": 59.96600984591282, "method": "oligo-tm-nearest-neighbour", "version": "1.0.0", "saltCorrection": "owczarzy-2004", "conditions": { "oligo_nM": 250, "na_mM": 50, "k_mM": 0, "tris_mM": 0, "mg_mM": 0, "dntp_mM": 0, "model": "primer-excess", "saltCorrection": "owczarzy-2004" }, "limit": "Monovalent correction: Owczarzy 2004, fitted at 69 mM to 1.02 M Na⁺. It is also used from 20 to 69 mM, an extrapolation whose error has not been established here: Owczarzy 2008 places typical PCR buffers (20 to 100 mM monovalent) where this equation applies.", "outside": [] } } } } ], "expectedAccepted": true, "reason": "Explicit zero K/Tris and defaults in settings are equivalent to normalized retained conditions.", "expectedRead": [ { "v": 1, "id": "oracle-primer-set", "label": "Independent record contract example", "createdAt": "2026-10-11T00:00:00.000Z", "notes": "", "forward": { "annealing": "CCAGCCACGTTTCTGCGAAA", "tail": "" }, "reverse": { "annealing": "TGCGCGAGAAGATTGTGCAC", "tail": "" }, "conditions": { "oligo_nM": 250, "na_mM": 50, "k_mM": 0, "tris_mM": 0, "mg_mM": 0, "dntp_mM": 0, "model": "primer-excess", "saltCorrection": "owczarzy-2004" }, "witness": { "templateHash": "fd182829946e68ba90d7c14906883ef31f663537dade5f617f804b8ce46dc316", "templateLength": 600, "topology": "linear", "coordinates": "1-based-inclusive-5prime-to-3prime", "forward": { "strand": "+", "start": 158, "end": 177, "length": 20 }, "reverse": { "strand": "-", "start": 428, "end": 409, "length": 20 }, "productId": "+:158:177|-:428:409", "method": "exact-pair-v1" }, "design": { "method": "bounded-flanks-v2", "target": { "start": 201, "end": 400 }, "capped": true, "ranking": { "tmDeviation": 0.06462320381317, "lengthDeviation": 0.0, "deltaTm": 0.03260351198753142, "total": 0.09722671580070141 }, "counts": { "windows": 918, "boundary": 0, "excluded": 0, "gc": 40, "tm": 234, "validForward": 353, "validReverse": 291, "productSize": 0, "deltaTm": 0, "eligiblePairs": 576, "exactChecked": 5, "exactRefused": 0 }, "settings": { "target": { "start": 201, "end": 400 }, "excluded": [], "forwardTail": "", "reverseTail": "", "conditions": { "oligo_nM": 250, "na_mM": 50, "k_mM": 0, "tris_mM": 0, "mg_mM": 0, "dntp_mM": 0, "model": "primer-excess", "saltCorrection": "owczarzy-2004" }, "flank": 50, "minLength": 18, "maxLength": 26, "targetLength": 20, "minTm": 55, "maxTm": 68, "targetTm": 59.95, "maxDeltaTm": 3, "minGc": 30, "maxGc": 70, "minProduct": 180, "maxProduct": 420 }, "structures": [ { "kind": "forward hairpin", "evaluated": false, "dG37": null, "detail": "Not evaluated in this hand-authored reader-contract example." }, { "kind": "reverse hairpin", "evaluated": false, "dG37": null, "detail": "Not evaluated in this hand-authored reader-contract example." }, { "kind": "forward self-dimer", "evaluated": false, "dG37": null, "detail": "Not evaluated in this hand-authored reader-contract example." }, { "kind": "reverse self-dimer", "evaluated": false, "dG37": null, "detail": "Not evaluated in this hand-authored reader-contract example." }, { "kind": "cross-dimer", "evaluated": false, "dG37": null, "detail": "Not evaluated in this hand-authored reader-contract example." } ], "limitations": [ "Reader-contract fixture: no secondary structure calculation is represented." ], "temperatures": { "forward": { "value": 59.99861335790035, "method": "oligo-tm-nearest-neighbour", "version": "1.0.0", "saltCorrection": "owczarzy-2004", "conditions": { "oligo_nM": 250, "na_mM": 50, "k_mM": 0, "tris_mM": 0, "mg_mM": 0, "dntp_mM": 0, "model": "primer-excess", "saltCorrection": "owczarzy-2004" }, "limit": "Monovalent correction: Owczarzy 2004, fitted at 69 mM to 1.02 M Na⁺. It is also used from 20 to 69 mM, an extrapolation whose error has not been established here: Owczarzy 2008 places typical PCR buffers (20 to 100 mM monovalent) where this equation applies.", "outside": [] }, "reverse": { "value": 59.96600984591282, "method": "oligo-tm-nearest-neighbour", "version": "1.0.0", "saltCorrection": "owczarzy-2004", "conditions": { "oligo_nM": 250, "na_mM": 50, "k_mM": 0, "tris_mM": 0, "mg_mM": 0, "dntp_mM": 0, "model": "primer-excess", "saltCorrection": "owczarzy-2004" }, "limit": "Monovalent correction: Owczarzy 2004, fitted at 69 mM to 1.02 M Na⁺. It is also used from 20 to 69 mM, an extrapolation whose error has not been established here: Owczarzy 2008 places typical PCR buffers (20 to 100 mM monovalent) where this equation applies.", "outside": [] } } } } ] }, { "id": "record-v2-wrong-forward-na", "input": [ { "v": 1, "id": "oracle-primer-set", "label": "Independent record contract example", "createdAt": "2026-10-11T00:00:00.000Z", "notes": "", "forward": { "annealing": "CCAGCCACGTTTCTGCGAAA", "tail": "" }, "reverse": { "annealing": "TGCGCGAGAAGATTGTGCAC", "tail": "" }, "conditions": { "oligo_nM": 250, "na_mM": 50, "mg_mM": 0, "dntp_mM": 0, "model": "primer-excess", "saltCorrection": "owczarzy-2004" }, "witness": { "templateHash": "fd182829946e68ba90d7c14906883ef31f663537dade5f617f804b8ce46dc316", "templateLength": 600, "topology": "linear", "coordinates": "1-based-inclusive-5prime-to-3prime", "forward": { "strand": "+", "start": 158, "end": 177, "length": 20 }, "reverse": { "strand": "-", "start": 428, "end": 409, "length": 20 }, "productId": "+:158:177|-:428:409", "method": "exact-pair-v1" }, "design": { "method": "bounded-flanks-v2", "target": { "start": 201, "end": 400 }, "capped": true, "ranking": { "tmDeviation": 0.06462320381317, "lengthDeviation": 0.0, "deltaTm": 0.03260351198753142, "total": 0.09722671580070141 }, "counts": { "windows": 918, "boundary": 0, "excluded": 0, "gc": 40, "tm": 234, "validForward": 353, "validReverse": 291, "productSize": 0, "deltaTm": 0, "eligiblePairs": 576, "exactChecked": 5, "exactRefused": 0 }, "settings": { "target": { "start": 201, "end": 400 }, "excluded": [], "forwardTail": "", "reverseTail": "", "conditions": { "oligo_nM": 250, "na_mM": 50, "mg_mM": 0, "dntp_mM": 0, "model": "primer-excess", "saltCorrection": "owczarzy-2004" }, "flank": 50, "minLength": 18, "maxLength": 26, "targetLength": 20, "minTm": 55, "maxTm": 68, "targetTm": 59.95, "maxDeltaTm": 3, "minGc": 30, "maxGc": 70, "minProduct": 180, "maxProduct": 420 }, "structures": [ { "kind": "forward hairpin", "evaluated": false, "dG37": null, "detail": "Not evaluated in this hand-authored reader-contract example." }, { "kind": "reverse hairpin", "evaluated": false, "dG37": null, "detail": "Not evaluated in this hand-authored reader-contract example." }, { "kind": "forward self-dimer", "evaluated": false, "dG37": null, "detail": "Not evaluated in this hand-authored reader-contract example." }, { "kind": "reverse self-dimer", "evaluated": false, "dG37": null, "detail": "Not evaluated in this hand-authored reader-contract example." }, { "kind": "cross-dimer", "evaluated": false, "dG37": null, "detail": "Not evaluated in this hand-authored reader-contract example." } ], "limitations": [ "Reader-contract fixture: no secondary structure calculation is represented." ], "temperatures": { "forward": { "value": 59.99861335790035, "method": "oligo-tm-nearest-neighbour", "version": "1.0.0", "saltCorrection": "owczarzy-2004", "conditions": { "oligo_nM": 250, "na_mM": 10, "k_mM": 0, "tris_mM": 0, "mg_mM": 0, "dntp_mM": 0, "model": "primer-excess", "saltCorrection": "owczarzy-2004" }, "limit": "Monovalent correction: Owczarzy 2004, fitted at 69 mM to 1.02 M Na⁺. It is also used from 20 to 69 mM, an extrapolation whose error has not been established here: Owczarzy 2008 places typical PCR buffers (20 to 100 mM monovalent) where this equation applies.", "outside": [] }, "reverse": { "value": 59.96600984591282, "method": "oligo-tm-nearest-neighbour", "version": "1.0.0", "saltCorrection": "owczarzy-2004", "conditions": { "oligo_nM": 250, "na_mM": 50, "k_mM": 0, "tris_mM": 0, "mg_mM": 0, "dntp_mM": 0, "model": "primer-excess", "saltCorrection": "owczarzy-2004" }, "limit": "Monovalent correction: Owczarzy 2004, fitted at 69 mM to 1.02 M Na⁺. It is also used from 20 to 69 mM, an extrapolation whose error has not been established here: Owczarzy 2008 places typical PCR buffers (20 to 100 mM monovalent) where this equation applies.", "outside": [] } } } } ], "expectedAccepted": false, "reason": "Forward retained Tm conditions contradict saved conditions." }, { "id": "record-v2-wrong-reverse-na", "input": [ { "v": 1, "id": "oracle-primer-set", "label": "Independent record contract example", "createdAt": "2026-10-11T00:00:00.000Z", "notes": "", "forward": { "annealing": "CCAGCCACGTTTCTGCGAAA", "tail": "" }, "reverse": { "annealing": "TGCGCGAGAAGATTGTGCAC", "tail": "" }, "conditions": { "oligo_nM": 250, "na_mM": 50, "mg_mM": 0, "dntp_mM": 0, "model": "primer-excess", "saltCorrection": "owczarzy-2004" }, "witness": { "templateHash": "fd182829946e68ba90d7c14906883ef31f663537dade5f617f804b8ce46dc316", "templateLength": 600, "topology": "linear", "coordinates": "1-based-inclusive-5prime-to-3prime", "forward": { "strand": "+", "start": 158, "end": 177, "length": 20 }, "reverse": { "strand": "-", "start": 428, "end": 409, "length": 20 }, "productId": "+:158:177|-:428:409", "method": "exact-pair-v1" }, "design": { "method": "bounded-flanks-v2", "target": { "start": 201, "end": 400 }, "capped": true, "ranking": { "tmDeviation": 0.06462320381317, "lengthDeviation": 0.0, "deltaTm": 0.03260351198753142, "total": 0.09722671580070141 }, "counts": { "windows": 918, "boundary": 0, "excluded": 0, "gc": 40, "tm": 234, "validForward": 353, "validReverse": 291, "productSize": 0, "deltaTm": 0, "eligiblePairs": 576, "exactChecked": 5, "exactRefused": 0 }, "settings": { "target": { "start": 201, "end": 400 }, "excluded": [], "forwardTail": "", "reverseTail": "", "conditions": { "oligo_nM": 250, "na_mM": 50, "mg_mM": 0, "dntp_mM": 0, "model": "primer-excess", "saltCorrection": "owczarzy-2004" }, "flank": 50, "minLength": 18, "maxLength": 26, "targetLength": 20, "minTm": 55, "maxTm": 68, "targetTm": 59.95, "maxDeltaTm": 3, "minGc": 30, "maxGc": 70, "minProduct": 180, "maxProduct": 420 }, "structures": [ { "kind": "forward hairpin", "evaluated": false, "dG37": null, "detail": "Not evaluated in this hand-authored reader-contract example." }, { "kind": "reverse hairpin", "evaluated": false, "dG37": null, "detail": "Not evaluated in this hand-authored reader-contract example." }, { "kind": "forward self-dimer", "evaluated": false, "dG37": null, "detail": "Not evaluated in this hand-authored reader-contract example." }, { "kind": "reverse self-dimer", "evaluated": false, "dG37": null, "detail": "Not evaluated in this hand-authored reader-contract example." }, { "kind": "cross-dimer", "evaluated": false, "dG37": null, "detail": "Not evaluated in this hand-authored reader-contract example." } ], "limitations": [ "Reader-contract fixture: no secondary structure calculation is represented." ], "temperatures": { "forward": { "value": 59.99861335790035, "method": "oligo-tm-nearest-neighbour", "version": "1.0.0", "saltCorrection": "owczarzy-2004", "conditions": { "oligo_nM": 250, "na_mM": 50, "k_mM": 0, "tris_mM": 0, "mg_mM": 0, "dntp_mM": 0, "model": "primer-excess", "saltCorrection": "owczarzy-2004" }, "limit": "Monovalent correction: Owczarzy 2004, fitted at 69 mM to 1.02 M Na⁺. It is also used from 20 to 69 mM, an extrapolation whose error has not been established here: Owczarzy 2008 places typical PCR buffers (20 to 100 mM monovalent) where this equation applies.", "outside": [] }, "reverse": { "value": 59.96600984591282, "method": "oligo-tm-nearest-neighbour", "version": "1.0.0", "saltCorrection": "owczarzy-2004", "conditions": { "oligo_nM": 250, "na_mM": 10, "k_mM": 0, "tris_mM": 0, "mg_mM": 0, "dntp_mM": 0, "model": "primer-excess", "saltCorrection": "owczarzy-2004" }, "limit": "Monovalent correction: Owczarzy 2004, fitted at 69 mM to 1.02 M Na⁺. It is also used from 20 to 69 mM, an extrapolation whose error has not been established here: Owczarzy 2008 places typical PCR buffers (20 to 100 mM monovalent) where this equation applies.", "outside": [] } } } } ], "expectedAccepted": false, "reason": "Reverse retained Tm conditions contradict saved conditions." }, { "id": "record-v2-balanced-settings-na", "input": [ { "v": 1, "id": "oracle-primer-set", "label": "Independent record contract example", "createdAt": "2026-10-11T00:00:00.000Z", "notes": "", "forward": { "annealing": "CCAGCCACGTTTCTGCGAAA", "tail": "" }, "reverse": { "annealing": "TGCGCGAGAAGATTGTGCAC", "tail": "" }, "conditions": { "oligo_nM": 250, "na_mM": 10, "mg_mM": 0, "dntp_mM": 0, "model": "primer-excess", "saltCorrection": "owczarzy-2004" }, "witness": { "templateHash": "fd182829946e68ba90d7c14906883ef31f663537dade5f617f804b8ce46dc316", "templateLength": 600, "topology": "linear", "coordinates": "1-based-inclusive-5prime-to-3prime", "forward": { "strand": "+", "start": 158, "end": 177, "length": 20 }, "reverse": { "strand": "-", "start": 428, "end": 409, "length": 20 }, "productId": "+:158:177|-:428:409", "method": "exact-pair-v1" }, "design": { "method": "bounded-flanks-v2", "target": { "start": 201, "end": 400 }, "capped": true, "ranking": { "tmDeviation": 0.06462320381317, "lengthDeviation": 0.0, "deltaTm": 0.03260351198753142, "total": 0.09722671580070141 }, "counts": { "windows": 918, "boundary": 0, "excluded": 0, "gc": 40, "tm": 234, "validForward": 353, "validReverse": 291, "productSize": 0, "deltaTm": 0, "eligiblePairs": 576, "exactChecked": 5, "exactRefused": 0 }, "settings": { "target": { "start": 201, "end": 400 }, "excluded": [], "forwardTail": "", "reverseTail": "", "conditions": { "oligo_nM": 250, "na_mM": 10, "mg_mM": 0, "dntp_mM": 0, "model": "primer-excess", "saltCorrection": "owczarzy-2004" }, "flank": 50, "minLength": 18, "maxLength": 26, "targetLength": 20, "minTm": 55, "maxTm": 68, "targetTm": 59.95, "maxDeltaTm": 3, "minGc": 30, "maxGc": 70, "minProduct": 180, "maxProduct": 420 }, "structures": [ { "kind": "forward hairpin", "evaluated": false, "dG37": null, "detail": "Not evaluated in this hand-authored reader-contract example." }, { "kind": "reverse hairpin", "evaluated": false, "dG37": null, "detail": "Not evaluated in this hand-authored reader-contract example." }, { "kind": "forward self-dimer", "evaluated": false, "dG37": null, "detail": "Not evaluated in this hand-authored reader-contract example." }, { "kind": "reverse self-dimer", "evaluated": false, "dG37": null, "detail": "Not evaluated in this hand-authored reader-contract example." }, { "kind": "cross-dimer", "evaluated": false, "dG37": null, "detail": "Not evaluated in this hand-authored reader-contract example." } ], "limitations": [ "Reader-contract fixture: no secondary structure calculation is represented." ], "temperatures": { "forward": { "value": 59.99861335790035, "method": "oligo-tm-nearest-neighbour", "version": "1.0.0", "saltCorrection": "owczarzy-2004", "conditions": { "oligo_nM": 250, "na_mM": 50, "k_mM": 0, "tris_mM": 0, "mg_mM": 0, "dntp_mM": 0, "model": "primer-excess", "saltCorrection": "owczarzy-2004" }, "limit": "Monovalent correction: Owczarzy 2004, fitted at 69 mM to 1.02 M Na⁺. It is also used from 20 to 69 mM, an extrapolation whose error has not been established here: Owczarzy 2008 places typical PCR buffers (20 to 100 mM monovalent) where this equation applies.", "outside": [] }, "reverse": { "value": 59.96600984591282, "method": "oligo-tm-nearest-neighbour", "version": "1.0.0", "saltCorrection": "owczarzy-2004", "conditions": { "oligo_nM": 250, "na_mM": 50, "k_mM": 0, "tris_mM": 0, "mg_mM": 0, "dntp_mM": 0, "model": "primer-excess", "saltCorrection": "owczarzy-2004" }, "limit": "Monovalent correction: Owczarzy 2004, fitted at 69 mM to 1.02 M Na⁺. It is also used from 20 to 69 mM, an extrapolation whose error has not been established here: Owczarzy 2008 places typical PCR buffers (20 to 100 mM monovalent) where this equation applies.", "outside": [] } } } } ], "expectedAccepted": false, "reason": "Entry and settings both changed to 10 mM, preserving their mutual equality, but both retained Tm records still say 50 mM." }, { "id": "record-v2-balanced-temperatures-na", "input": [ { "v": 1, "id": "oracle-primer-set", "label": "Independent record contract example", "createdAt": "2026-10-11T00:00:00.000Z", "notes": "", "forward": { "annealing": "CCAGCCACGTTTCTGCGAAA", "tail": "" }, "reverse": { "annealing": "TGCGCGAGAAGATTGTGCAC", "tail": "" }, "conditions": { "oligo_nM": 250, "na_mM": 50, "mg_mM": 0, "dntp_mM": 0, "model": "primer-excess", "saltCorrection": "owczarzy-2004" }, "witness": { "templateHash": "fd182829946e68ba90d7c14906883ef31f663537dade5f617f804b8ce46dc316", "templateLength": 600, "topology": "linear", "coordinates": "1-based-inclusive-5prime-to-3prime", "forward": { "strand": "+", "start": 158, "end": 177, "length": 20 }, "reverse": { "strand": "-", "start": 428, "end": 409, "length": 20 }, "productId": "+:158:177|-:428:409", "method": "exact-pair-v1" }, "design": { "method": "bounded-flanks-v2", "target": { "start": 201, "end": 400 }, "capped": true, "ranking": { "tmDeviation": 0.06462320381317, "lengthDeviation": 0.0, "deltaTm": 0.03260351198753142, "total": 0.09722671580070141 }, "counts": { "windows": 918, "boundary": 0, "excluded": 0, "gc": 40, "tm": 234, "validForward": 353, "validReverse": 291, "productSize": 0, "deltaTm": 0, "eligiblePairs": 576, "exactChecked": 5, "exactRefused": 0 }, "settings": { "target": { "start": 201, "end": 400 }, "excluded": [], "forwardTail": "", "reverseTail": "", "conditions": { "oligo_nM": 250, "na_mM": 50, "mg_mM": 0, "dntp_mM": 0, "model": "primer-excess", "saltCorrection": "owczarzy-2004" }, "flank": 50, "minLength": 18, "maxLength": 26, "targetLength": 20, "minTm": 55, "maxTm": 68, "targetTm": 59.95, "maxDeltaTm": 3, "minGc": 30, "maxGc": 70, "minProduct": 180, "maxProduct": 420 }, "structures": [ { "kind": "forward hairpin", "evaluated": false, "dG37": null, "detail": "Not evaluated in this hand-authored reader-contract example." }, { "kind": "reverse hairpin", "evaluated": false, "dG37": null, "detail": "Not evaluated in this hand-authored reader-contract example." }, { "kind": "forward self-dimer", "evaluated": false, "dG37": null, "detail": "Not evaluated in this hand-authored reader-contract example." }, { "kind": "reverse self-dimer", "evaluated": false, "dG37": null, "detail": "Not evaluated in this hand-authored reader-contract example." }, { "kind": "cross-dimer", "evaluated": false, "dG37": null, "detail": "Not evaluated in this hand-authored reader-contract example." } ], "limitations": [ "Reader-contract fixture: no secondary structure calculation is represented." ], "temperatures": { "forward": { "value": 59.99861335790035, "method": "oligo-tm-nearest-neighbour", "version": "1.0.0", "saltCorrection": "owczarzy-2004", "conditions": { "oligo_nM": 250, "na_mM": 10, "k_mM": 0, "tris_mM": 0, "mg_mM": 0, "dntp_mM": 0, "model": "primer-excess", "saltCorrection": "owczarzy-2004" }, "limit": "Monovalent correction: Owczarzy 2004, fitted at 69 mM to 1.02 M Na⁺. It is also used from 20 to 69 mM, an extrapolation whose error has not been established here: Owczarzy 2008 places typical PCR buffers (20 to 100 mM monovalent) where this equation applies.", "outside": [] }, "reverse": { "value": 59.96600984591282, "method": "oligo-tm-nearest-neighbour", "version": "1.0.0", "saltCorrection": "owczarzy-2004", "conditions": { "oligo_nM": 250, "na_mM": 10, "k_mM": 0, "tris_mM": 0, "mg_mM": 0, "dntp_mM": 0, "model": "primer-excess", "saltCorrection": "owczarzy-2004" }, "limit": "Monovalent correction: Owczarzy 2004, fitted at 69 mM to 1.02 M Na⁺. It is also used from 20 to 69 mM, an extrapolation whose error has not been established here: Owczarzy 2008 places typical PCR buffers (20 to 100 mM monovalent) where this equation applies.", "outside": [] } } } } ], "expectedAccepted": false, "reason": "Both retained Tm records changed consistently with one another to 10 mM but contradict saved settings." }, { "id": "record-v2-wrong-correction-label", "input": [ { "v": 1, "id": "oracle-primer-set", "label": "Independent record contract example", "createdAt": "2026-10-11T00:00:00.000Z", "notes": "", "forward": { "annealing": "CCAGCCACGTTTCTGCGAAA", "tail": "" }, "reverse": { "annealing": "TGCGCGAGAAGATTGTGCAC", "tail": "" }, "conditions": { "oligo_nM": 250, "na_mM": 50, "mg_mM": 0, "dntp_mM": 0, "model": "primer-excess", "saltCorrection": "owczarzy-2004" }, "witness": { "templateHash": "fd182829946e68ba90d7c14906883ef31f663537dade5f617f804b8ce46dc316", "templateLength": 600, "topology": "linear", "coordinates": "1-based-inclusive-5prime-to-3prime", "forward": { "strand": "+", "start": 158, "end": 177, "length": 20 }, "reverse": { "strand": "-", "start": 428, "end": 409, "length": 20 }, "productId": "+:158:177|-:428:409", "method": "exact-pair-v1" }, "design": { "method": "bounded-flanks-v2", "target": { "start": 201, "end": 400 }, "capped": true, "ranking": { "tmDeviation": 0.06462320381317, "lengthDeviation": 0.0, "deltaTm": 0.03260351198753142, "total": 0.09722671580070141 }, "counts": { "windows": 918, "boundary": 0, "excluded": 0, "gc": 40, "tm": 234, "validForward": 353, "validReverse": 291, "productSize": 0, "deltaTm": 0, "eligiblePairs": 576, "exactChecked": 5, "exactRefused": 0 }, "settings": { "target": { "start": 201, "end": 400 }, "excluded": [], "forwardTail": "", "reverseTail": "", "conditions": { "oligo_nM": 250, "na_mM": 50, "mg_mM": 0, "dntp_mM": 0, "model": "primer-excess", "saltCorrection": "owczarzy-2004" }, "flank": 50, "minLength": 18, "maxLength": 26, "targetLength": 20, "minTm": 55, "maxTm": 68, "targetTm": 59.95, "maxDeltaTm": 3, "minGc": 30, "maxGc": 70, "minProduct": 180, "maxProduct": 420 }, "structures": [ { "kind": "forward hairpin", "evaluated": false, "dG37": null, "detail": "Not evaluated in this hand-authored reader-contract example." }, { "kind": "reverse hairpin", "evaluated": false, "dG37": null, "detail": "Not evaluated in this hand-authored reader-contract example." }, { "kind": "forward self-dimer", "evaluated": false, "dG37": null, "detail": "Not evaluated in this hand-authored reader-contract example." }, { "kind": "reverse self-dimer", "evaluated": false, "dG37": null, "detail": "Not evaluated in this hand-authored reader-contract example." }, { "kind": "cross-dimer", "evaluated": false, "dG37": null, "detail": "Not evaluated in this hand-authored reader-contract example." } ], "limitations": [ "Reader-contract fixture: no secondary structure calculation is represented." ], "temperatures": { "forward": { "value": 59.99861335790035, "method": "oligo-tm-nearest-neighbour", "version": "1.0.0", "saltCorrection": "santalucia-1998", "conditions": { "oligo_nM": 250, "na_mM": 50, "k_mM": 0, "tris_mM": 0, "mg_mM": 0, "dntp_mM": 0, "model": "primer-excess", "saltCorrection": "owczarzy-2004" }, "limit": "Monovalent correction: Owczarzy 2004, fitted at 69 mM to 1.02 M Na⁺. It is also used from 20 to 69 mM, an extrapolation whose error has not been established here: Owczarzy 2008 places typical PCR buffers (20 to 100 mM monovalent) where this equation applies.", "outside": [] }, "reverse": { "value": 59.96600984591282, "method": "oligo-tm-nearest-neighbour", "version": "1.0.0", "saltCorrection": "owczarzy-2004", "conditions": { "oligo_nM": 250, "na_mM": 50, "k_mM": 0, "tris_mM": 0, "mg_mM": 0, "dntp_mM": 0, "model": "primer-excess", "saltCorrection": "owczarzy-2004" }, "limit": "Monovalent correction: Owczarzy 2004, fitted at 69 mM to 1.02 M Na⁺. It is also used from 20 to 69 mM, an extrapolation whose error has not been established here: Owczarzy 2008 places typical PCR buffers (20 to 100 mM monovalent) where this equation applies.", "outside": [] } } } } ], "expectedAccepted": false, "reason": "Top-level retained correction contradicts its own normalized conditions." }, { "id": "record-v2-balanced-correction-labels", "input": [ { "v": 1, "id": "oracle-primer-set", "label": "Independent record contract example", "createdAt": "2026-10-11T00:00:00.000Z", "notes": "", "forward": { "annealing": "CCAGCCACGTTTCTGCGAAA", "tail": "" }, "reverse": { "annealing": "TGCGCGAGAAGATTGTGCAC", "tail": "" }, "conditions": { "oligo_nM": 250, "na_mM": 50, "mg_mM": 0, "dntp_mM": 0, "model": "primer-excess", "saltCorrection": "owczarzy-2004" }, "witness": { "templateHash": "fd182829946e68ba90d7c14906883ef31f663537dade5f617f804b8ce46dc316", "templateLength": 600, "topology": "linear", "coordinates": "1-based-inclusive-5prime-to-3prime", "forward": { "strand": "+", "start": 158, "end": 177, "length": 20 }, "reverse": { "strand": "-", "start": 428, "end": 409, "length": 20 }, "productId": "+:158:177|-:428:409", "method": "exact-pair-v1" }, "design": { "method": "bounded-flanks-v2", "target": { "start": 201, "end": 400 }, "capped": true, "ranking": { "tmDeviation": 0.06462320381317, "lengthDeviation": 0.0, "deltaTm": 0.03260351198753142, "total": 0.09722671580070141 }, "counts": { "windows": 918, "boundary": 0, "excluded": 0, "gc": 40, "tm": 234, "validForward": 353, "validReverse": 291, "productSize": 0, "deltaTm": 0, "eligiblePairs": 576, "exactChecked": 5, "exactRefused": 0 }, "settings": { "target": { "start": 201, "end": 400 }, "excluded": [], "forwardTail": "", "reverseTail": "", "conditions": { "oligo_nM": 250, "na_mM": 50, "mg_mM": 0, "dntp_mM": 0, "model": "primer-excess", "saltCorrection": "owczarzy-2004" }, "flank": 50, "minLength": 18, "maxLength": 26, "targetLength": 20, "minTm": 55, "maxTm": 68, "targetTm": 59.95, "maxDeltaTm": 3, "minGc": 30, "maxGc": 70, "minProduct": 180, "maxProduct": 420 }, "structures": [ { "kind": "forward hairpin", "evaluated": false, "dG37": null, "detail": "Not evaluated in this hand-authored reader-contract example." }, { "kind": "reverse hairpin", "evaluated": false, "dG37": null, "detail": "Not evaluated in this hand-authored reader-contract example." }, { "kind": "forward self-dimer", "evaluated": false, "dG37": null, "detail": "Not evaluated in this hand-authored reader-contract example." }, { "kind": "reverse self-dimer", "evaluated": false, "dG37": null, "detail": "Not evaluated in this hand-authored reader-contract example." }, { "kind": "cross-dimer", "evaluated": false, "dG37": null, "detail": "Not evaluated in this hand-authored reader-contract example." } ], "limitations": [ "Reader-contract fixture: no secondary structure calculation is represented." ], "temperatures": { "forward": { "value": 59.99861335790035, "method": "oligo-tm-nearest-neighbour", "version": "1.0.0", "saltCorrection": "santalucia-1998", "conditions": { "oligo_nM": 250, "na_mM": 50, "k_mM": 0, "tris_mM": 0, "mg_mM": 0, "dntp_mM": 0, "model": "primer-excess", "saltCorrection": "santalucia-1998" }, "limit": "Monovalent correction: Owczarzy 2004, fitted at 69 mM to 1.02 M Na⁺. It is also used from 20 to 69 mM, an extrapolation whose error has not been established here: Owczarzy 2008 places typical PCR buffers (20 to 100 mM monovalent) where this equation applies.", "outside": [] }, "reverse": { "value": 59.96600984591282, "method": "oligo-tm-nearest-neighbour", "version": "1.0.0", "saltCorrection": "santalucia-1998", "conditions": { "oligo_nM": 250, "na_mM": 50, "k_mM": 0, "tris_mM": 0, "mg_mM": 0, "dntp_mM": 0, "model": "primer-excess", "saltCorrection": "santalucia-1998" }, "limit": "Monovalent correction: Owczarzy 2004, fitted at 69 mM to 1.02 M Na⁺. It is also used from 20 to 69 mM, an extrapolation whose error has not been established here: Owczarzy 2008 places typical PCR buffers (20 to 100 mM monovalent) where this equation applies.", "outside": [] } } } } ], "expectedAccepted": false, "reason": "Both retained top-level and nested corrections changed to SantaLucia; still contradict the saved design conditions." }, { "id": "record-v2-wrong-concentration", "input": [ { "v": 1, "id": "oracle-primer-set", "label": "Independent record contract example", "createdAt": "2026-10-11T00:00:00.000Z", "notes": "", "forward": { "annealing": "CCAGCCACGTTTCTGCGAAA", "tail": "" }, "reverse": { "annealing": "TGCGCGAGAAGATTGTGCAC", "tail": "" }, "conditions": { "oligo_nM": 250, "na_mM": 50, "mg_mM": 0, "dntp_mM": 0, "model": "primer-excess", "saltCorrection": "owczarzy-2004" }, "witness": { "templateHash": "fd182829946e68ba90d7c14906883ef31f663537dade5f617f804b8ce46dc316", "templateLength": 600, "topology": "linear", "coordinates": "1-based-inclusive-5prime-to-3prime", "forward": { "strand": "+", "start": 158, "end": 177, "length": 20 }, "reverse": { "strand": "-", "start": 428, "end": 409, "length": 20 }, "productId": "+:158:177|-:428:409", "method": "exact-pair-v1" }, "design": { "method": "bounded-flanks-v2", "target": { "start": 201, "end": 400 }, "capped": true, "ranking": { "tmDeviation": 0.06462320381317, "lengthDeviation": 0.0, "deltaTm": 0.03260351198753142, "total": 0.09722671580070141 }, "counts": { "windows": 918, "boundary": 0, "excluded": 0, "gc": 40, "tm": 234, "validForward": 353, "validReverse": 291, "productSize": 0, "deltaTm": 0, "eligiblePairs": 576, "exactChecked": 5, "exactRefused": 0 }, "settings": { "target": { "start": 201, "end": 400 }, "excluded": [], "forwardTail": "", "reverseTail": "", "conditions": { "oligo_nM": 250, "na_mM": 50, "mg_mM": 0, "dntp_mM": 0, "model": "primer-excess", "saltCorrection": "owczarzy-2004" }, "flank": 50, "minLength": 18, "maxLength": 26, "targetLength": 20, "minTm": 55, "maxTm": 68, "targetTm": 59.95, "maxDeltaTm": 3, "minGc": 30, "maxGc": 70, "minProduct": 180, "maxProduct": 420 }, "structures": [ { "kind": "forward hairpin", "evaluated": false, "dG37": null, "detail": "Not evaluated in this hand-authored reader-contract example." }, { "kind": "reverse hairpin", "evaluated": false, "dG37": null, "detail": "Not evaluated in this hand-authored reader-contract example." }, { "kind": "forward self-dimer", "evaluated": false, "dG37": null, "detail": "Not evaluated in this hand-authored reader-contract example." }, { "kind": "reverse self-dimer", "evaluated": false, "dG37": null, "detail": "Not evaluated in this hand-authored reader-contract example." }, { "kind": "cross-dimer", "evaluated": false, "dG37": null, "detail": "Not evaluated in this hand-authored reader-contract example." } ], "limitations": [ "Reader-contract fixture: no secondary structure calculation is represented." ], "temperatures": { "forward": { "value": 59.99861335790035, "method": "oligo-tm-nearest-neighbour", "version": "1.0.0", "saltCorrection": "owczarzy-2004", "conditions": { "oligo_nM": 500, "na_mM": 50, "k_mM": 0, "tris_mM": 0, "mg_mM": 0, "dntp_mM": 0, "model": "primer-excess", "saltCorrection": "owczarzy-2004" }, "limit": "Monovalent correction: Owczarzy 2004, fitted at 69 mM to 1.02 M Na⁺. It is also used from 20 to 69 mM, an extrapolation whose error has not been established here: Owczarzy 2008 places typical PCR buffers (20 to 100 mM monovalent) where this equation applies.", "outside": [] }, "reverse": { "value": 59.96600984591282, "method": "oligo-tm-nearest-neighbour", "version": "1.0.0", "saltCorrection": "owczarzy-2004", "conditions": { "oligo_nM": 250, "na_mM": 50, "k_mM": 0, "tris_mM": 0, "mg_mM": 0, "dntp_mM": 0, "model": "primer-excess", "saltCorrection": "owczarzy-2004" }, "limit": "Monovalent correction: Owczarzy 2004, fitted at 69 mM to 1.02 M Na⁺. It is also used from 20 to 69 mM, an extrapolation whose error has not been established here: Owczarzy 2008 places typical PCR buffers (20 to 100 mM monovalent) where this equation applies.", "outside": [] } } } } ], "expectedAccepted": false, "reason": "Retained concentration contradicts saved concentration." }, { "id": "record-v2-wrong-model", "input": [ { "v": 1, "id": "oracle-primer-set", "label": "Independent record contract example", "createdAt": "2026-10-11T00:00:00.000Z", "notes": "", "forward": { "annealing": "CCAGCCACGTTTCTGCGAAA", "tail": "" }, "reverse": { "annealing": "TGCGCGAGAAGATTGTGCAC", "tail": "" }, "conditions": { "oligo_nM": 250, "na_mM": 50, "mg_mM": 0, "dntp_mM": 0, "model": "primer-excess", "saltCorrection": "owczarzy-2004" }, "witness": { "templateHash": "fd182829946e68ba90d7c14906883ef31f663537dade5f617f804b8ce46dc316", "templateLength": 600, "topology": "linear", "coordinates": "1-based-inclusive-5prime-to-3prime", "forward": { "strand": "+", "start": 158, "end": 177, "length": 20 }, "reverse": { "strand": "-", "start": 428, "end": 409, "length": 20 }, "productId": "+:158:177|-:428:409", "method": "exact-pair-v1" }, "design": { "method": "bounded-flanks-v2", "target": { "start": 201, "end": 400 }, "capped": true, "ranking": { "tmDeviation": 0.06462320381317, "lengthDeviation": 0.0, "deltaTm": 0.03260351198753142, "total": 0.09722671580070141 }, "counts": { "windows": 918, "boundary": 0, "excluded": 0, "gc": 40, "tm": 234, "validForward": 353, "validReverse": 291, "productSize": 0, "deltaTm": 0, "eligiblePairs": 576, "exactChecked": 5, "exactRefused": 0 }, "settings": { "target": { "start": 201, "end": 400 }, "excluded": [], "forwardTail": "", "reverseTail": "", "conditions": { "oligo_nM": 250, "na_mM": 50, "mg_mM": 0, "dntp_mM": 0, "model": "primer-excess", "saltCorrection": "owczarzy-2004" }, "flank": 50, "minLength": 18, "maxLength": 26, "targetLength": 20, "minTm": 55, "maxTm": 68, "targetTm": 59.95, "maxDeltaTm": 3, "minGc": 30, "maxGc": 70, "minProduct": 180, "maxProduct": 420 }, "structures": [ { "kind": "forward hairpin", "evaluated": false, "dG37": null, "detail": "Not evaluated in this hand-authored reader-contract example." }, { "kind": "reverse hairpin", "evaluated": false, "dG37": null, "detail": "Not evaluated in this hand-authored reader-contract example." }, { "kind": "forward self-dimer", "evaluated": false, "dG37": null, "detail": "Not evaluated in this hand-authored reader-contract example." }, { "kind": "reverse self-dimer", "evaluated": false, "dG37": null, "detail": "Not evaluated in this hand-authored reader-contract example." }, { "kind": "cross-dimer", "evaluated": false, "dG37": null, "detail": "Not evaluated in this hand-authored reader-contract example." } ], "limitations": [ "Reader-contract fixture: no secondary structure calculation is represented." ], "temperatures": { "forward": { "value": 59.99861335790035, "method": "oligo-tm-nearest-neighbour", "version": "1.0.0", "saltCorrection": "owczarzy-2004", "conditions": { "oligo_nM": 250, "na_mM": 50, "k_mM": 0, "tris_mM": 0, "mg_mM": 0, "dntp_mM": 0, "model": "primer-excess", "saltCorrection": "owczarzy-2004" }, "limit": "Monovalent correction: Owczarzy 2004, fitted at 69 mM to 1.02 M Na⁺. It is also used from 20 to 69 mM, an extrapolation whose error has not been established here: Owczarzy 2008 places typical PCR buffers (20 to 100 mM monovalent) where this equation applies.", "outside": [] }, "reverse": { "value": 59.96600984591282, "method": "oligo-tm-nearest-neighbour", "version": "1.0.0", "saltCorrection": "owczarzy-2004", "conditions": { "oligo_nM": 250, "na_mM": 50, "k_mM": 0, "tris_mM": 0, "mg_mM": 0, "dntp_mM": 0, "model": "equal-strands", "saltCorrection": "owczarzy-2004" }, "limit": "Monovalent correction: Owczarzy 2004, fitted at 69 mM to 1.02 M Na⁺. It is also used from 20 to 69 mM, an extrapolation whose error has not been established here: Owczarzy 2008 places typical PCR buffers (20 to 100 mM monovalent) where this equation applies.", "outside": [] } } } } ], "expectedAccepted": false, "reason": "Retained concentration model contradicts saved model." }, { "id": "record-v2-missing-temperatures", "input": [ { "v": 1, "id": "oracle-primer-set", "label": "Independent record contract example", "createdAt": "2026-10-11T00:00:00.000Z", "notes": "", "forward": { "annealing": "CCAGCCACGTTTCTGCGAAA", "tail": "" }, "reverse": { "annealing": "TGCGCGAGAAGATTGTGCAC", "tail": "" }, "conditions": { "oligo_nM": 250, "na_mM": 50, "mg_mM": 0, "dntp_mM": 0, "model": "primer-excess", "saltCorrection": "owczarzy-2004" }, "witness": { "templateHash": "fd182829946e68ba90d7c14906883ef31f663537dade5f617f804b8ce46dc316", "templateLength": 600, "topology": "linear", "coordinates": "1-based-inclusive-5prime-to-3prime", "forward": { "strand": "+", "start": 158, "end": 177, "length": 20 }, "reverse": { "strand": "-", "start": 428, "end": 409, "length": 20 }, "productId": "+:158:177|-:428:409", "method": "exact-pair-v1" }, "design": { "method": "bounded-flanks-v2", "target": { "start": 201, "end": 400 }, "capped": true, "ranking": { "tmDeviation": 0.06462320381317, "lengthDeviation": 0.0, "deltaTm": 0.03260351198753142, "total": 0.09722671580070141 }, "counts": { "windows": 918, "boundary": 0, "excluded": 0, "gc": 40, "tm": 234, "validForward": 353, "validReverse": 291, "productSize": 0, "deltaTm": 0, "eligiblePairs": 576, "exactChecked": 5, "exactRefused": 0 }, "settings": { "target": { "start": 201, "end": 400 }, "excluded": [], "forwardTail": "", "reverseTail": "", "conditions": { "oligo_nM": 250, "na_mM": 50, "mg_mM": 0, "dntp_mM": 0, "model": "primer-excess", "saltCorrection": "owczarzy-2004" }, "flank": 50, "minLength": 18, "maxLength": 26, "targetLength": 20, "minTm": 55, "maxTm": 68, "targetTm": 59.95, "maxDeltaTm": 3, "minGc": 30, "maxGc": 70, "minProduct": 180, "maxProduct": 420 }, "structures": [ { "kind": "forward hairpin", "evaluated": false, "dG37": null, "detail": "Not evaluated in this hand-authored reader-contract example." }, { "kind": "reverse hairpin", "evaluated": false, "dG37": null, "detail": "Not evaluated in this hand-authored reader-contract example." }, { "kind": "forward self-dimer", "evaluated": false, "dG37": null, "detail": "Not evaluated in this hand-authored reader-contract example." }, { "kind": "reverse self-dimer", "evaluated": false, "dG37": null, "detail": "Not evaluated in this hand-authored reader-contract example." }, { "kind": "cross-dimer", "evaluated": false, "dG37": null, "detail": "Not evaluated in this hand-authored reader-contract example." } ], "limitations": [ "Reader-contract fixture: no secondary structure calculation is represented." ] } } ], "expectedAccepted": false, "reason": "v2 requires its qualification block." }, { "id": "record-historical-v1-no-injection", "input": [ { "v": 1, "id": "oracle-primer-set", "label": "Independent record contract example", "createdAt": "2026-10-11T00:00:00.000Z", "notes": "", "forward": { "annealing": "CCAGCCACGTTTCTGCGAAA", "tail": "" }, "reverse": { "annealing": "TGCGCGAGAAGATTGTGCAC", "tail": "" }, "conditions": { "oligo_nM": 250, "na_mM": 50, "mg_mM": 0, "dntp_mM": 0, "model": "primer-excess", "saltCorrection": "owczarzy-2004" }, "witness": { "templateHash": "fd182829946e68ba90d7c14906883ef31f663537dade5f617f804b8ce46dc316", "templateLength": 600, "topology": "linear", "coordinates": "1-based-inclusive-5prime-to-3prime", "forward": { "strand": "+", "start": 158, "end": 177, "length": 20 }, "reverse": { "strand": "-", "start": 428, "end": 409, "length": 20 }, "productId": "+:158:177|-:428:409", "method": "exact-pair-v1" }, "design": { "method": "bounded-flanks-v1", "target": { "start": 201, "end": 400 }, "capped": true, "ranking": { "tmDeviation": 0.06462320381317, "lengthDeviation": 0.0, "deltaTm": 0.03260351198753142, "total": 0.09722671580070141 }, "counts": { "windows": 918, "boundary": 0, "excluded": 0, "gc": 40, "tm": 234, "validForward": 353, "validReverse": 291, "productSize": 0, "deltaTm": 0, "eligiblePairs": 576, "exactChecked": 5, "exactRefused": 0 }, "settings": { "target": { "start": 201, "end": 400 }, "excluded": [], "forwardTail": "", "reverseTail": "", "conditions": { "oligo_nM": 250, "na_mM": 50, "mg_mM": 0, "dntp_mM": 0, "model": "primer-excess", "saltCorrection": "owczarzy-2004" }, "flank": 50, "minLength": 18, "maxLength": 26, "targetLength": 20, "minTm": 55, "maxTm": 68, "targetTm": 59.95, "maxDeltaTm": 3, "minGc": 30, "maxGc": 70, "minProduct": 180, "maxProduct": 420 }, "structures": [ { "kind": "forward hairpin", "evaluated": false, "dG37": null, "detail": "Not evaluated in this hand-authored reader-contract example." }, { "kind": "reverse hairpin", "evaluated": false, "dG37": null, "detail": "Not evaluated in this hand-authored reader-contract example." }, { "kind": "forward self-dimer", "evaluated": false, "dG37": null, "detail": "Not evaluated in this hand-authored reader-contract example." }, { "kind": "reverse self-dimer", "evaluated": false, "dG37": null, "detail": "Not evaluated in this hand-authored reader-contract example." }, { "kind": "cross-dimer", "evaluated": false, "dG37": null, "detail": "Not evaluated in this hand-authored reader-contract example." } ], "limitations": [ "Reader-contract fixture: no secondary structure calculation is represented." ] } } ], "expectedAccepted": true, "reason": "Historical v1 without temperatures reads byte-equivalent JSON data; reader must not inject present-day Tm qualifications.", "expectedRead": [ { "v": 1, "id": "oracle-primer-set", "label": "Independent record contract example", "createdAt": "2026-10-11T00:00:00.000Z", "notes": "", "forward": { "annealing": "CCAGCCACGTTTCTGCGAAA", "tail": "" }, "reverse": { "annealing": "TGCGCGAGAAGATTGTGCAC", "tail": "" }, "conditions": { "oligo_nM": 250, "na_mM": 50, "mg_mM": 0, "dntp_mM": 0, "model": "primer-excess", "saltCorrection": "owczarzy-2004" }, "witness": { "templateHash": "fd182829946e68ba90d7c14906883ef31f663537dade5f617f804b8ce46dc316", "templateLength": 600, "topology": "linear", "coordinates": "1-based-inclusive-5prime-to-3prime", "forward": { "strand": "+", "start": 158, "end": 177, "length": 20 }, "reverse": { "strand": "-", "start": 428, "end": 409, "length": 20 }, "productId": "+:158:177|-:428:409", "method": "exact-pair-v1" }, "design": { "method": "bounded-flanks-v1", "target": { "start": 201, "end": 400 }, "capped": true, "ranking": { "tmDeviation": 0.06462320381317, "lengthDeviation": 0.0, "deltaTm": 0.03260351198753142, "total": 0.09722671580070141 }, "counts": { "windows": 918, "boundary": 0, "excluded": 0, "gc": 40, "tm": 234, "validForward": 353, "validReverse": 291, "productSize": 0, "deltaTm": 0, "eligiblePairs": 576, "exactChecked": 5, "exactRefused": 0 }, "settings": { "target": { "start": 201, "end": 400 }, "excluded": [], "forwardTail": "", "reverseTail": "", "conditions": { "oligo_nM": 250, "na_mM": 50, "mg_mM": 0, "dntp_mM": 0, "model": "primer-excess", "saltCorrection": "owczarzy-2004" }, "flank": 50, "minLength": 18, "maxLength": 26, "targetLength": 20, "minTm": 55, "maxTm": 68, "targetTm": 59.95, "maxDeltaTm": 3, "minGc": 30, "maxGc": 70, "minProduct": 180, "maxProduct": 420 }, "structures": [ { "kind": "forward hairpin", "evaluated": false, "dG37": null, "detail": "Not evaluated in this hand-authored reader-contract example." }, { "kind": "reverse hairpin", "evaluated": false, "dG37": null, "detail": "Not evaluated in this hand-authored reader-contract example." }, { "kind": "forward self-dimer", "evaluated": false, "dG37": null, "detail": "Not evaluated in this hand-authored reader-contract example." }, { "kind": "reverse self-dimer", "evaluated": false, "dG37": null, "detail": "Not evaluated in this hand-authored reader-contract example." }, { "kind": "cross-dimer", "evaluated": false, "dG37": null, "detail": "Not evaluated in this hand-authored reader-contract example." } ], "limitations": [ "Reader-contract fixture: no secondary structure calculation is represented." ] } } ] }, { "id": "record-v2-historical-text-retained", "input": [ { "v": 1, "id": "oracle-primer-set", "label": "Independent record contract example", "createdAt": "2026-10-11T00:00:00.000Z", "notes": "", "forward": { "annealing": "CCAGCCACGTTTCTGCGAAA", "tail": "" }, "reverse": { "annealing": "TGCGCGAGAAGATTGTGCAC", "tail": "" }, "conditions": { "oligo_nM": 250, "na_mM": 50, "mg_mM": 0, "dntp_mM": 0, "model": "primer-excess", "saltCorrection": "owczarzy-2004" }, "witness": { "templateHash": "fd182829946e68ba90d7c14906883ef31f663537dade5f617f804b8ce46dc316", "templateLength": 600, "topology": "linear", "coordinates": "1-based-inclusive-5prime-to-3prime", "forward": { "strand": "+", "start": 158, "end": 177, "length": 20 }, "reverse": { "strand": "-", "start": 428, "end": 409, "length": 20 }, "productId": "+:158:177|-:428:409", "method": "exact-pair-v1" }, "design": { "method": "bounded-flanks-v2", "target": { "start": 201, "end": 400 }, "capped": true, "ranking": { "tmDeviation": 0.06462320381317, "lengthDeviation": 0.0, "deltaTm": 0.03260351198753142, "total": 0.09722671580070141 }, "counts": { "windows": 918, "boundary": 0, "excluded": 0, "gc": 40, "tm": 234, "validForward": 353, "validReverse": 291, "productSize": 0, "deltaTm": 0, "eligiblePairs": 576, "exactChecked": 5, "exactRefused": 0 }, "settings": { "target": { "start": 201, "end": 400 }, "excluded": [], "forwardTail": "", "reverseTail": "", "conditions": { "oligo_nM": 250, "na_mM": 50, "mg_mM": 0, "dntp_mM": 0, "model": "primer-excess", "saltCorrection": "owczarzy-2004" }, "flank": 50, "minLength": 18, "maxLength": 26, "targetLength": 20, "minTm": 55, "maxTm": 68, "targetTm": 59.95, "maxDeltaTm": 3, "minGc": 30, "maxGc": 70, "minProduct": 180, "maxProduct": 420 }, "structures": [ { "kind": "forward hairpin", "evaluated": false, "dG37": null, "detail": "Not evaluated in this hand-authored reader-contract example." }, { "kind": "reverse hairpin", "evaluated": false, "dG37": null, "detail": "Not evaluated in this hand-authored reader-contract example." }, { "kind": "forward self-dimer", "evaluated": false, "dG37": null, "detail": "Not evaluated in this hand-authored reader-contract example." }, { "kind": "reverse self-dimer", "evaluated": false, "dG37": null, "detail": "Not evaluated in this hand-authored reader-contract example." }, { "kind": "cross-dimer", "evaluated": false, "dG37": null, "detail": "Not evaluated in this hand-authored reader-contract example." } ], "limitations": [ "Reader-contract fixture: no secondary structure calculation is represented." ], "temperatures": { "forward": { "value": 59.99861335790035, "method": "oligo-tm-nearest-neighbour", "version": "1.0.0", "saltCorrection": "owczarzy-2004", "conditions": { "oligo_nM": 250, "na_mM": 50, "k_mM": 0, "tris_mM": 0, "mg_mM": 0, "dntp_mM": 0, "model": "primer-excess", "saltCorrection": "owczarzy-2004" }, "limit": "Historical qualification as saved.", "outside": [ "Historical outside note as saved." ] }, "reverse": { "value": 59.96600984591282, "method": "oligo-tm-nearest-neighbour", "version": "1.0.0", "saltCorrection": "owczarzy-2004", "conditions": { "oligo_nM": 250, "na_mM": 50, "k_mM": 0, "tris_mM": 0, "mg_mM": 0, "dntp_mM": 0, "model": "primer-excess", "saltCorrection": "owczarzy-2004" }, "limit": "Monovalent correction: Owczarzy 2004, fitted at 69 mM to 1.02 M Na⁺. It is also used from 20 to 69 mM, an extrapolation whose error has not been established here: Owczarzy 2008 places typical PCR buffers (20 to 100 mM monovalent) where this equation applies.", "outside": [] } } } } ], "expectedAccepted": true, "reason": "Reader preserves bounded saved qualification text and version; it must not replace historical text with current copy or claim to recompute Tm.", "expectedRead": [ { "v": 1, "id": "oracle-primer-set", "label": "Independent record contract example", "createdAt": "2026-10-11T00:00:00.000Z", "notes": "", "forward": { "annealing": "CCAGCCACGTTTCTGCGAAA", "tail": "" }, "reverse": { "annealing": "TGCGCGAGAAGATTGTGCAC", "tail": "" }, "conditions": { "oligo_nM": 250, "na_mM": 50, "mg_mM": 0, "dntp_mM": 0, "model": "primer-excess", "saltCorrection": "owczarzy-2004" }, "witness": { "templateHash": "fd182829946e68ba90d7c14906883ef31f663537dade5f617f804b8ce46dc316", "templateLength": 600, "topology": "linear", "coordinates": "1-based-inclusive-5prime-to-3prime", "forward": { "strand": "+", "start": 158, "end": 177, "length": 20 }, "reverse": { "strand": "-", "start": 428, "end": 409, "length": 20 }, "productId": "+:158:177|-:428:409", "method": "exact-pair-v1" }, "design": { "method": "bounded-flanks-v2", "target": { "start": 201, "end": 400 }, "capped": true, "ranking": { "tmDeviation": 0.06462320381317, "lengthDeviation": 0.0, "deltaTm": 0.03260351198753142, "total": 0.09722671580070141 }, "counts": { "windows": 918, "boundary": 0, "excluded": 0, "gc": 40, "tm": 234, "validForward": 353, "validReverse": 291, "productSize": 0, "deltaTm": 0, "eligiblePairs": 576, "exactChecked": 5, "exactRefused": 0 }, "settings": { "target": { "start": 201, "end": 400 }, "excluded": [], "forwardTail": "", "reverseTail": "", "conditions": { "oligo_nM": 250, "na_mM": 50, "mg_mM": 0, "dntp_mM": 0, "model": "primer-excess", "saltCorrection": "owczarzy-2004" }, "flank": 50, "minLength": 18, "maxLength": 26, "targetLength": 20, "minTm": 55, "maxTm": 68, "targetTm": 59.95, "maxDeltaTm": 3, "minGc": 30, "maxGc": 70, "minProduct": 180, "maxProduct": 420 }, "structures": [ { "kind": "forward hairpin", "evaluated": false, "dG37": null, "detail": "Not evaluated in this hand-authored reader-contract example." }, { "kind": "reverse hairpin", "evaluated": false, "dG37": null, "detail": "Not evaluated in this hand-authored reader-contract example." }, { "kind": "forward self-dimer", "evaluated": false, "dG37": null, "detail": "Not evaluated in this hand-authored reader-contract example." }, { "kind": "reverse self-dimer", "evaluated": false, "dG37": null, "detail": "Not evaluated in this hand-authored reader-contract example." }, { "kind": "cross-dimer", "evaluated": false, "dG37": null, "detail": "Not evaluated in this hand-authored reader-contract example." } ], "limitations": [ "Reader-contract fixture: no secondary structure calculation is represented." ], "temperatures": { "forward": { "value": 59.99861335790035, "method": "oligo-tm-nearest-neighbour", "version": "1.0.0", "saltCorrection": "owczarzy-2004", "conditions": { "oligo_nM": 250, "na_mM": 50, "k_mM": 0, "tris_mM": 0, "mg_mM": 0, "dntp_mM": 0, "model": "primer-excess", "saltCorrection": "owczarzy-2004" }, "limit": "Historical qualification as saved.", "outside": [ "Historical outside note as saved." ] }, "reverse": { "value": 59.96600984591282, "method": "oligo-tm-nearest-neighbour", "version": "1.0.0", "saltCorrection": "owczarzy-2004", "conditions": { "oligo_nM": 250, "na_mM": 50, "k_mM": 0, "tris_mM": 0, "mg_mM": 0, "dntp_mM": 0, "model": "primer-excess", "saltCorrection": "owczarzy-2004" }, "limit": "Monovalent correction: Owczarzy 2004, fitted at 69 mM to 1.02 M Na⁺. It is also used from 20 to 69 mM, an extrapolation whose error has not been established here: Owczarzy 2008 places typical PCR buffers (20 to 100 mM monovalent) where this equation applies.", "outside": [] } } } } ] } ] }