{ "about": { "generatedBy": "pipeline/sequence-toolkit/reference.py", "scriptSha256": "1bc66633d1a780a7f255b02743e9258652769ed35b770f193c5d74e0070410d6", "recordedOn": "2026-10-06", "python": "3.11.15", "oracle": "Biopython 1.88 Bio.SeqUtils.MeltingTemp.Tm_NN, nn_table=DNA_NN3", "oracleLicence": "Biopython Licence Agreement or BSD-3-Clause (MeltingTemp.py is dual-licensed)", "rule": "No value in this file comes from the Drybench engine under test.", "fixture": "Oligo Tm, 45 cases under two concentration models, plus refusals and acceptance cases (brief section 4.3 (2); CSO ruling, 6 October 2026)", "tolerance": "Tm within 0.1 C of Biopython 1.88 in both models; saltRegime.R to 1e-9 relative; saltRegime.regimeId and nearBoundary exact (T36-T39 and T43-T45 sit near a regime boundary); refusals and acceptance exact", "table": "Biopython documents DNA_NN3 as Allawi & SantaLucia (1997). Its 10 Watson-Crick stacks, initiation (0.1/-2.8 with a terminal G-C, 2.3/4.1 with a terminal A-T) and symmetry (0/-1.4) terms equal SantaLucia 1998 (PNAS 95:1460, doi:10.1073/pnas.95.4.1460) Table 2 as read at https://pmc.ncbi.nlm.nih.gov/articles/PMC19045/ on 2026-10-06; reference.py asserts this on every run (the other DNA_NN3 keys are zero). The values are in fixtureTable below.", "entropyCorrection": "saltcorr=5 adds 0.368 (N - 1) ln[Na+] (mol/L) to dS, N = oligo length. SantaLucia 1998 Eq. 7 gives dG37 = dG37(1 M) - 0.114 kcal/mol x N' x ln[Na+], N' = total phosphates in the duplex / 2 (= N - 1 for 5'-OH oligos); with dH salt-independent, 0.114 / 310.15 K = 0.368 cal/(K mol). The paper's entropy form (Eq. 8) is rendered as an image on PMC and was not read verbatim.", "formula": "Tm = 1000 dH / (dS + R ln(k)) - 273.15 with R = 1.987 cal/(K mol); salt correction then applied as saltCorrectionApplies says", "concentrationModels": "CSO ruling, 6 October 2026. primerInExcess (the default): the oligo concentration C is the primer's, in excess over its template; k = C (Biopython dnac1 = C, dnac2 = 0, selfcomp False; SantaLucia and Hicks 2004, CA - CB/2 with CB -> 0); a self-complementary oligo is an ordinary primer here and its self-duplex is the dimer check's business. equalStrands (the named alternative): C is the total strand concentration; k = C/4 (dnac1 = dnac2 = C/2), or for a self-complementary oligo k = C with the symmetry term (selfcomp True, x = 1; SantaLucia 1998).", "modelDifference": "primerInExcess minus equalStrands, by group: length15to25 (30 cases): 1.57 to 2.58 C; length30to40 (9 cases): 0.97 to 1.45 C; selfComplementary (6 cases): 0.74 to 1.18 C. The card states the equal-strands value instead of a fixed difference (CSO confirmation, item 7).", "cardWording": { "concentration": "Primer at {C} nM, in excess over its template. Equal strands ({C} nM total): {Tm_eq} °C.", "risk": "0.7–2.6 °C above equal-strands tools, less for longer oligos", "nearBoundary": "Near an Owczarzy 2008 regime boundary; Tm can step here.", "show": "Tm (primerInExcess) and {Tm_eq} (equalStrands), both gated within 0.1 C; R and the regime whenever Mg2+ > 0; the near-boundary line when saltRegime.nearBoundary is true", "source": "CSO ruling, 6 October 2026 (items 1 and 2) and the CSO's confirmation of the same day (item 7), verbatim" }, "saltDetails": "CSO ruling: when Mg2+ > 0, Owczarzy 2008 (saltcorr 7) is the only correction, and Tm never uses a sodium equivalent (Biopython's methods 5 and 6 would add a von Ahsen 2001 equivalent, so every saltcorr 5 and 6 case has Mg2+ = 0). Method 7 uses Mon = Na + K + Tris/2 in mol/L and free Mg2+ from the Mg2+:dNTP equilibrium (Ka = 3e4 M-1); R = sqrt(free Mg2+) / Mon. R < 0.22: the 2004 monovalent formula; 0.22 <= R < 6: a, d and g adjusted for [Mon+]; R >= 6 or no monovalent ions: the original constants. The switch is reproduced exactly, never smoothed; nearBoundary marks R in 0.198-0.242 or 5.4-6.6 (the card's 'Near an Owczarzy 2008 regime boundary; Tm can step here').", "fixtureTable": { "init": [ 0, 0 ], "init_A/T": [ 2.3, 4.1 ], "init_G/C": [ 0.1, -2.8 ], "init_oneG/C": [ 0, 0 ], "init_allA/T": [ 0, 0 ], "init_5T/A": [ 0, 0 ], "sym": [ 0, -1.4 ], "AA/TT": [ -7.9, -22.2 ], "AT/TA": [ -7.2, -20.4 ], "TA/AT": [ -7.2, -21.3 ], "CA/GT": [ -8.5, -22.7 ], "GT/CA": [ -8.4, -22.4 ], "CT/GA": [ -7.8, -21.0 ], "GA/CT": [ -8.2, -22.2 ], "CG/GC": [ -10.6, -27.2 ], "GC/CG": [ -9.8, -24.4 ], "GG/CC": [ -8.0, -19.9 ] }, "refusalRule": "CSO ruling: the engine refuses an oligo containing any character other than A, C, G or T (after removing line breaks and other whitespace and upper-casing) and an oligo shorter than 2 nt; it returns no Tm, and its reason names each offending character with its 1-based position in the cleaned sequence. Biopython does not refuse (check=True deletes or converts characters; I uses its inosine table; a 1-nt oligo returns a negative Tm): its values are recorded as mustNotEqual_C." }, "cases": [ { "id": "T01", "input": { "sequence": "ATTAGTAAATTAGCT", "name": "d15-at", "length": 15, "gcPercent": 20.0, "selfComplementary": false, "oligoConcentration_nM": 250, "Na_mM": 50, "K_mM": 0, "Tris_mM": 0, "Mg_mM": 0, "dNTPs_mM": 0, "complement": "perfect complement (c_seq=None), no dangling ends, no mismatches" }, "expected": { "defaultModel": "primerInExcess", "primerInExcess": { "tm_C": 31.079947809120483, "concentrationTerm_nM": 250.0, "dnac1_nM": 250, "dnac2_nM": 0, "symmetryTerm": false }, "equalStrands": { "tm_C": 28.661927185426293, "concentrationTerm_nM": 62.5, "dnac1_nM": 125.0, "dnac2_nM": 125.0, "symmetryTerm": false, "x": 4 }, "saltRegime": { "R": 0.0, "freeMg_mM": 0, "regimeId": null, "regime": "no Mg2+: Owczarzy 2008 not applied (R = 0)", "nearBoundary": false, "appliedCorrection": "owczarzy-2004", "note": "R, the regime and nearBoundary use free Mg2+; the regime decides the Tm where Owczarzy 2008 is applied (Mg2+ > 0)." } }, "oracleIntermediates": { "primerInExcess": { "deltaH_kcal_per_mol": -104.59999999999954, "deltaS_cal_per_K_mol": -295.09999999999854, "tmWithoutSaltCorrection_C": 48.39342182830893 }, "equalStrands": { "deltaH_kcal_per_mol": -104.60000000000056, "deltaS_cal_per_K_mol": -295.1000000000018, "tmWithoutSaltCorrection_C": 45.693576155244216 }, "saltCorrection": 0.00017698751333353126, "saltCorrectionApplies": "1/Tm(K) += corr", "derivation": "dH and dS recovered from two Biopython Tm_NN evaluations with saltcorr=0 at concentration terms k and 10k; they include initiation and, in equalStrands for a self-complementary oligo, the symmetry term." }, "method": { "nn": "santalucia-1998", "nnTable": "Biopython DNA_NN3", "salt": "owczarzy-2004", "saltText": "Owczarzy et al. 2004: 1/Tm = 1/Tm(1 M) + (4.29 fGC - 3.95) 1e-5 ln[Na+] + 9.40e-6 ln^2[Na+]", "concentration": "primerInExcess by default; equalStrands as the named alternative" }, "oracle": "Biopython Bio.SeqUtils.MeltingTemp.Tm_NN", "oracleVersion": "1.88", "recordedOn": "2026-10-06", "source": "pipeline/sequence-toolkit/reference.py (oligo-tm)", "call": { "primerInExcess": "Bio.SeqUtils.MeltingTemp.Tm_NN('ATTAGTAAATTAGCT', check=True, strict=True, nn_table=DNA_NN3, dnac1=250, dnac2=0, selfcomp=False, Na=50, K=0, Tris=0, Mg=0, dNTPs=0, saltcorr=6)", "equalStrands": "Bio.SeqUtils.MeltingTemp.Tm_NN('ATTAGTAAATTAGCT', check=True, strict=True, nn_table=DNA_NN3, dnac1=125.0, dnac2=125.0, selfcomp=False, Na=50, K=0, Tris=0, Mg=0, dNTPs=0, saltcorr=6)" }, "notes": "15-mer, 20% GC" }, { "id": "T02", "input": { "sequence": "GCCGGTCCAGCGGCA", "name": "d15-gc", "length": 15, "gcPercent": 80.0, "selfComplementary": false, "oligoConcentration_nM": 250, "Na_mM": 50, "K_mM": 0, "Tris_mM": 0, "Mg_mM": 0, "dNTPs_mM": 0, "complement": "perfect complement (c_seq=None), no dangling ends, no mismatches" }, "expected": { "defaultModel": "primerInExcess", "primerInExcess": { "tm_C": 65.33193876269729, "concentrationTerm_nM": 250.0, "dnac1_nM": 250, "dnac2_nM": 0, "symmetryTerm": false }, "equalStrands": { "tm_C": 62.756368003141745, "concentrationTerm_nM": 62.5, "dnac1_nM": 125.0, "dnac2_nM": 125.0, "symmetryTerm": false, "x": 4 }, "saltRegime": { "R": 0.0, "freeMg_mM": 0, "regimeId": null, "regime": "no Mg2+: Owczarzy 2008 not applied (R = 0)", "nearBoundary": false, "appliedCorrection": "owczarzy-2004", "note": "R, the regime and nearBoundary use free Mg2+; the regime decides the Tm where Owczarzy 2008 is applied (Mg2+ > 0)." } }, "oracleIntermediates": { "primerInExcess": { "deltaH_kcal_per_mol": -121.59999999999998, "deltaS_cal_per_K_mol": -316.8999999999999, "tmWithoutSaltCorrection_C": 77.17527462347255 }, "equalStrands": { "deltaH_kcal_per_mol": -121.59999999999998, "deltaS_cal_per_K_mol": -316.8999999999999, "tmWithoutSaltCorrection_C": 74.41704882427382 }, "saltCorrection": 9.987736461225153e-05, "saltCorrectionApplies": "1/Tm(K) += corr", "derivation": "dH and dS recovered from two Biopython Tm_NN evaluations with saltcorr=0 at concentration terms k and 10k; they include initiation and, in equalStrands for a self-complementary oligo, the symmetry term." }, "method": { "nn": "santalucia-1998", "nnTable": "Biopython DNA_NN3", "salt": "owczarzy-2004", "saltText": "Owczarzy et al. 2004: 1/Tm = 1/Tm(1 M) + (4.29 fGC - 3.95) 1e-5 ln[Na+] + 9.40e-6 ln^2[Na+]", "concentration": "primerInExcess by default; equalStrands as the named alternative" }, "oracle": "Biopython Bio.SeqUtils.MeltingTemp.Tm_NN", "oracleVersion": "1.88", "recordedOn": "2026-10-06", "source": "pipeline/sequence-toolkit/reference.py (oligo-tm)", "call": { "primerInExcess": "Bio.SeqUtils.MeltingTemp.Tm_NN('GCCGGTCCAGCGGCA', check=True, strict=True, nn_table=DNA_NN3, dnac1=250, dnac2=0, selfcomp=False, Na=50, K=0, Tris=0, Mg=0, dNTPs=0, saltcorr=6)", "equalStrands": "Bio.SeqUtils.MeltingTemp.Tm_NN('GCCGGTCCAGCGGCA', check=True, strict=True, nn_table=DNA_NN3, dnac1=125.0, dnac2=125.0, selfcomp=False, Na=50, K=0, Tris=0, Mg=0, dNTPs=0, saltcorr=6)" }, "notes": "15-mer, 80% GC" }, { "id": "T03", "input": { "sequence": "GTAAAACGACGGCCAGT", "name": "M13F-20", "length": 17, "gcPercent": 52.94117647058823, "selfComplementary": false, "oligoConcentration_nM": 250, "Na_mM": 50, "K_mM": 0, "Tris_mM": 0, "Mg_mM": 0, "dNTPs_mM": 0, "complement": "perfect complement (c_seq=None), no dangling ends, no mismatches" }, "expected": { "defaultModel": "primerInExcess", "primerInExcess": { "tm_C": 53.583796229830284, "concentrationTerm_nM": 250.0, "dnac1_nM": 250, "dnac2_nM": 0, "symmetryTerm": false }, "equalStrands": { "tm_C": 51.397449061573354, "concentrationTerm_nM": 62.5, "dnac1_nM": 125.0, "dnac2_nM": 125.0, "symmetryTerm": false, "x": 4 }, "saltRegime": { "R": 0.0, "freeMg_mM": 0, "regimeId": null, "regime": "no Mg2+: Owczarzy 2008 not applied (R = 0)", "nearBoundary": false, "appliedCorrection": "owczarzy-2004", "note": "R, the regime and nearBoundary use free Mg2+; the regime decides the Tm where Owczarzy 2008 is applied (Mg2+ > 0)." } }, "oracleIntermediates": { "primerInExcess": { "deltaH_kcal_per_mol": -133.59999999999803, "deltaS_cal_per_K_mol": -360.69999999999413, "tmWithoutSaltCorrection_C": 68.62015614210299 }, "equalStrands": { "deltaH_kcal_per_mol": -133.6000000000014, "deltaS_cal_per_K_mol": -360.700000000004, "tmWithoutSaltCorrection_C": 66.2286827008989 }, "saltCorrection": 0.00013465252972184828, "saltCorrectionApplies": "1/Tm(K) += corr", "derivation": "dH and dS recovered from two Biopython Tm_NN evaluations with saltcorr=0 at concentration terms k and 10k; they include initiation and, in equalStrands for a self-complementary oligo, the symmetry term." }, "method": { "nn": "santalucia-1998", "nnTable": "Biopython DNA_NN3", "salt": "owczarzy-2004", "saltText": "Owczarzy et al. 2004: 1/Tm = 1/Tm(1 M) + (4.29 fGC - 3.95) 1e-5 ln[Na+] + 9.40e-6 ln^2[Na+]", "concentration": "primerInExcess by default; equalStrands as the named alternative" }, "oracle": "Biopython Bio.SeqUtils.MeltingTemp.Tm_NN", "oracleVersion": "1.88", "recordedOn": "2026-10-06", "source": "pipeline/sequence-toolkit/reference.py (oligo-tm)", "call": { "primerInExcess": "Bio.SeqUtils.MeltingTemp.Tm_NN('GTAAAACGACGGCCAGT', check=True, strict=True, nn_table=DNA_NN3, dnac1=250, dnac2=0, selfcomp=False, Na=50, K=0, Tris=0, Mg=0, dNTPs=0, saltcorr=6)", "equalStrands": "Bio.SeqUtils.MeltingTemp.Tm_NN('GTAAAACGACGGCCAGT', check=True, strict=True, nn_table=DNA_NN3, dnac1=125.0, dnac2=125.0, selfcomp=False, Na=50, K=0, Tris=0, Mg=0, dNTPs=0, saltcorr=6)" }, "notes": "" }, { "id": "T04", "input": { "sequence": "TAATACGACTCACTATAGGG", "name": "T7-promoter", "length": 20, "gcPercent": 40.0, "selfComplementary": false, "oligoConcentration_nM": 250, "Na_mM": 50, "K_mM": 0, "Tris_mM": 0, "Mg_mM": 0, "dNTPs_mM": 0, "complement": "perfect complement (c_seq=None), no dangling ends, no mismatches" }, "expected": { "defaultModel": "primerInExcess", "primerInExcess": { "tm_C": 47.596985252370416, "concentrationTerm_nM": 250.0, "dnac1_nM": 250, "dnac2_nM": 0, "symmetryTerm": false }, "equalStrands": { "tm_C": 45.703750337130145, "concentrationTerm_nM": 62.5, "dnac1_nM": 125.0, "dnac2_nM": 125.0, "symmetryTerm": false, "x": 4 }, "saltRegime": { "R": 0.0, "freeMg_mM": 0, "regimeId": null, "regime": "no Mg2+: Owczarzy 2008 not applied (R = 0)", "nearBoundary": false, "appliedCorrection": "owczarzy-2004", "note": "R, the regime and nearBoundary use free Mg2+; the regime decides the Tm where Owczarzy 2008 is applied (Mg2+ > 0)." } }, "oracleIntermediates": { "primerInExcess": { "deltaH_kcal_per_mol": -148.79999999999623, "deltaS_cal_per_K_mol": -411.19999999998885, "tmWithoutSaltCorrection_C": 63.95462611136554 }, "equalStrands": { "deltaH_kcal_per_mol": -148.80000000000044, "deltaS_cal_per_K_mol": -411.20000000000124, "tmWithoutSaltCorrection_C": 61.863991910319044 }, "saltCorrection": 0.00015128413042643803, "saltCorrectionApplies": "1/Tm(K) += corr", "derivation": "dH and dS recovered from two Biopython Tm_NN evaluations with saltcorr=0 at concentration terms k and 10k; they include initiation and, in equalStrands for a self-complementary oligo, the symmetry term." }, "method": { "nn": "santalucia-1998", "nnTable": "Biopython DNA_NN3", "salt": "owczarzy-2004", "saltText": "Owczarzy et al. 2004: 1/Tm = 1/Tm(1 M) + (4.29 fGC - 3.95) 1e-5 ln[Na+] + 9.40e-6 ln^2[Na+]", "concentration": "primerInExcess by default; equalStrands as the named alternative" }, "oracle": "Biopython Bio.SeqUtils.MeltingTemp.Tm_NN", "oracleVersion": "1.88", "recordedOn": "2026-10-06", "source": "pipeline/sequence-toolkit/reference.py (oligo-tm)", "call": { "primerInExcess": "Bio.SeqUtils.MeltingTemp.Tm_NN('TAATACGACTCACTATAGGG', check=True, strict=True, nn_table=DNA_NN3, dnac1=250, dnac2=0, selfcomp=False, Na=50, K=0, Tris=0, Mg=0, dNTPs=0, saltcorr=6)", "equalStrands": "Bio.SeqUtils.MeltingTemp.Tm_NN('TAATACGACTCACTATAGGG', check=True, strict=True, nn_table=DNA_NN3, dnac1=125.0, dnac2=125.0, selfcomp=False, Na=50, K=0, Tris=0, Mg=0, dNTPs=0, saltcorr=6)" }, "notes": "reference condition for T05, T06, T19 and the acceptance cases" }, { "id": "T05", "input": { "sequence": "TAATACGACTCACTATAGGG", "name": "T7-promoter", "length": 20, "gcPercent": 40.0, "selfComplementary": false, "oligoConcentration_nM": 500, "Na_mM": 50, "K_mM": 0, "Tris_mM": 0, "Mg_mM": 0, "dNTPs_mM": 0, "complement": "perfect complement (c_seq=None), no dangling ends, no mismatches" }, "expected": { "defaultModel": "primerInExcess", "primerInExcess": { "tm_C": 48.55205880787315, "concentrationTerm_nM": 500.0, "dnac1_nM": 500, "dnac2_nM": 0, "symmetryTerm": false }, "equalStrands": { "tm_C": 46.64756578230339, "concentrationTerm_nM": 125.0, "dnac1_nM": 250.0, "dnac2_nM": 250.0, "symmetryTerm": false, "x": 4 }, "saltRegime": { "R": 0.0, "freeMg_mM": 0, "regimeId": null, "regime": "no Mg2+: Owczarzy 2008 not applied (R = 0)", "nearBoundary": false, "appliedCorrection": "owczarzy-2004", "note": "R, the regime and nearBoundary use free Mg2+; the regime decides the Tm where Owczarzy 2008 is applied (Mg2+ > 0)." } }, "oracleIntermediates": { "primerInExcess": { "deltaH_kcal_per_mol": -148.80000000000044, "deltaS_cal_per_K_mol": -411.2000000000012, "tmWithoutSaltCorrection_C": 65.00975869390612 }, "equalStrands": { "deltaH_kcal_per_mol": -148.80000000000044, "deltaS_cal_per_K_mol": -411.20000000000124, "tmWithoutSaltCorrection_C": 62.906057537631 }, "saltCorrection": 0.00015128413042643803, "saltCorrectionApplies": "1/Tm(K) += corr", "derivation": "dH and dS recovered from two Biopython Tm_NN evaluations with saltcorr=0 at concentration terms k and 10k; they include initiation and, in equalStrands for a self-complementary oligo, the symmetry term." }, "method": { "nn": "santalucia-1998", "nnTable": "Biopython DNA_NN3", "salt": "owczarzy-2004", "saltText": "Owczarzy et al. 2004: 1/Tm = 1/Tm(1 M) + (4.29 fGC - 3.95) 1e-5 ln[Na+] + 9.40e-6 ln^2[Na+]", "concentration": "primerInExcess by default; equalStrands as the named alternative" }, "oracle": "Biopython Bio.SeqUtils.MeltingTemp.Tm_NN", "oracleVersion": "1.88", "recordedOn": "2026-10-06", "source": "pipeline/sequence-toolkit/reference.py (oligo-tm)", "call": { "primerInExcess": "Bio.SeqUtils.MeltingTemp.Tm_NN('TAATACGACTCACTATAGGG', check=True, strict=True, nn_table=DNA_NN3, dnac1=500, dnac2=0, selfcomp=False, Na=50, K=0, Tris=0, Mg=0, dNTPs=0, saltcorr=6)", "equalStrands": "Bio.SeqUtils.MeltingTemp.Tm_NN('TAATACGACTCACTATAGGG', check=True, strict=True, nn_table=DNA_NN3, dnac1=250.0, dnac2=250.0, selfcomp=False, Na=50, K=0, Tris=0, Mg=0, dNTPs=0, saltcorr=6)" }, "notes": "as T04 at 0.5 uM" }, { "id": "T06", "input": { "sequence": "TAATACGACTCACTATAGGG", "name": "T7-promoter", "length": 20, "gcPercent": 40.0, "selfComplementary": false, "oligoConcentration_nM": 250, "Na_mM": 1000, "K_mM": 0, "Tris_mM": 0, "Mg_mM": 0, "dNTPs_mM": 0, "complement": "perfect complement (c_seq=None), no dangling ends, no mismatches" }, "expected": { "defaultModel": "primerInExcess", "primerInExcess": { "tm_C": 63.95462611136554, "concentrationTerm_nM": 250.0, "dnac1_nM": 250, "dnac2_nM": 0, "symmetryTerm": false }, "equalStrands": { "tm_C": 61.863991910319044, "concentrationTerm_nM": 62.5, "dnac1_nM": 125.0, "dnac2_nM": 125.0, "symmetryTerm": false, "x": 4 }, "saltRegime": { "R": 0.0, "freeMg_mM": 0, "regimeId": null, "regime": "no Mg2+: Owczarzy 2008 not applied (R = 0)", "nearBoundary": false, "appliedCorrection": "owczarzy-2004", "note": "R, the regime and nearBoundary use free Mg2+; the regime decides the Tm where Owczarzy 2008 is applied (Mg2+ > 0)." } }, "oracleIntermediates": { "primerInExcess": { "deltaH_kcal_per_mol": -148.79999999999623, "deltaS_cal_per_K_mol": -411.19999999998885, "tmWithoutSaltCorrection_C": 63.95462611136554 }, "equalStrands": { "deltaH_kcal_per_mol": -148.80000000000044, "deltaS_cal_per_K_mol": -411.20000000000124, "tmWithoutSaltCorrection_C": 61.863991910319044 }, "saltCorrection": 0.0, "saltCorrectionApplies": "1/Tm(K) += corr", "derivation": "dH and dS recovered from two Biopython Tm_NN evaluations with saltcorr=0 at concentration terms k and 10k; they include initiation and, in equalStrands for a self-complementary oligo, the symmetry term." }, "method": { "nn": "santalucia-1998", "nnTable": "Biopython DNA_NN3", "salt": "owczarzy-2004", "saltText": "Owczarzy et al. 2004: 1/Tm = 1/Tm(1 M) + (4.29 fGC - 3.95) 1e-5 ln[Na+] + 9.40e-6 ln^2[Na+]", "concentration": "primerInExcess by default; equalStrands as the named alternative" }, "oracle": "Biopython Bio.SeqUtils.MeltingTemp.Tm_NN", "oracleVersion": "1.88", "recordedOn": "2026-10-06", "source": "pipeline/sequence-toolkit/reference.py (oligo-tm)", "call": { "primerInExcess": "Bio.SeqUtils.MeltingTemp.Tm_NN('TAATACGACTCACTATAGGG', check=True, strict=True, nn_table=DNA_NN3, dnac1=250, dnac2=0, selfcomp=False, Na=1000, K=0, Tris=0, Mg=0, dNTPs=0, saltcorr=6)", "equalStrands": "Bio.SeqUtils.MeltingTemp.Tm_NN('TAATACGACTCACTATAGGG', check=True, strict=True, nn_table=DNA_NN3, dnac1=125.0, dnac2=125.0, selfcomp=False, Na=1000, K=0, Tris=0, Mg=0, dNTPs=0, saltcorr=6)" }, "notes": "as T04 at 1 M Na+" }, { "id": "T07", "input": { "sequence": "ATTTAGGTGACACTATAG", "name": "SP6", "length": 18, "gcPercent": 33.333333333333336, "selfComplementary": false, "oligoConcentration_nM": 500, "Na_mM": 50, "K_mM": 0, "Tris_mM": 0, "Mg_mM": 0, "dNTPs_mM": 0, "complement": "perfect complement (c_seq=None), no dangling ends, no mismatches" }, "expected": { "defaultModel": "primerInExcess", "primerInExcess": { "tm_C": 42.76523492809997, "concentrationTerm_nM": 500.0, "dnac1_nM": 500, "dnac2_nM": 0, "symmetryTerm": false }, "equalStrands": { "tm_C": 40.68367174972849, "concentrationTerm_nM": 125.0, "dnac1_nM": 250.0, "dnac2_nM": 250.0, "symmetryTerm": false, "x": 4 }, "saltRegime": { "R": 0.0, "freeMg_mM": 0, "regimeId": null, "regime": "no Mg2+: Owczarzy 2008 not applied (R = 0)", "nearBoundary": false, "appliedCorrection": "owczarzy-2004", "note": "R, the regime and nearBoundary use free Mg2+; the regime decides the Tm where Owczarzy 2008 is applied (Mg2+ > 0)." } }, "oracleIntermediates": { "primerInExcess": { "deltaH_kcal_per_mol": -131.20000000000007, "deltaS_cal_per_K_mol": -365.5000000000001, "tmWithoutSaltCorrection_C": 59.56734729508696 }, "equalStrands": { "deltaH_kcal_per_mol": -131.19999999999845, "deltaS_cal_per_K_mol": -365.4999999999952, "tmWithoutSaltCorrection_C": 57.25928684508733 }, "saltCorrection": 0.00015985192472880245, "saltCorrectionApplies": "1/Tm(K) += corr", "derivation": "dH and dS recovered from two Biopython Tm_NN evaluations with saltcorr=0 at concentration terms k and 10k; they include initiation and, in equalStrands for a self-complementary oligo, the symmetry term." }, "method": { "nn": "santalucia-1998", "nnTable": "Biopython DNA_NN3", "salt": "owczarzy-2004", "saltText": "Owczarzy et al. 2004: 1/Tm = 1/Tm(1 M) + (4.29 fGC - 3.95) 1e-5 ln[Na+] + 9.40e-6 ln^2[Na+]", "concentration": "primerInExcess by default; equalStrands as the named alternative" }, "oracle": "Biopython Bio.SeqUtils.MeltingTemp.Tm_NN", "oracleVersion": "1.88", "recordedOn": "2026-10-06", "source": "pipeline/sequence-toolkit/reference.py (oligo-tm)", "call": { "primerInExcess": "Bio.SeqUtils.MeltingTemp.Tm_NN('ATTTAGGTGACACTATAG', check=True, strict=True, nn_table=DNA_NN3, dnac1=500, dnac2=0, selfcomp=False, Na=50, K=0, Tris=0, Mg=0, dNTPs=0, saltcorr=6)", "equalStrands": "Bio.SeqUtils.MeltingTemp.Tm_NN('ATTTAGGTGACACTATAG', check=True, strict=True, nn_table=DNA_NN3, dnac1=250.0, dnac2=250.0, selfcomp=False, Na=50, K=0, Tris=0, Mg=0, dNTPs=0, saltcorr=6)" }, "notes": "" }, { "id": "T08", "input": { "sequence": "CGGAACTGCAGTTCCG", "name": "sc16", "length": 16, "gcPercent": 62.5, "selfComplementary": true, "oligoConcentration_nM": 250, "Na_mM": 50, "K_mM": 0, "Tris_mM": 0, "Mg_mM": 0, "dNTPs_mM": 0, "complement": "perfect complement (c_seq=None), no dangling ends, no mismatches" }, "expected": { "defaultModel": "primerInExcess", "primerInExcess": { "tm_C": 55.13965952971455, "concentrationTerm_nM": 250.0, "dnac1_nM": 250, "dnac2_nM": 0, "symmetryTerm": false }, "equalStrands": { "tm_C": 53.96874378646828, "concentrationTerm_nM": 250, "dnac1_nM": 250, "dnac2_nM": 0, "symmetryTerm": true, "x": 1 }, "saltRegime": { "R": 0.0, "freeMg_mM": 0, "regimeId": null, "regime": "no Mg2+: Owczarzy 2008 not applied (R = 0)", "nearBoundary": false, "appliedCorrection": "owczarzy-2004", "note": "R, the regime and nearBoundary use free Mg2+; the regime decides the Tm where Owczarzy 2008 is applied (Mg2+ > 0)." } }, "oracleIntermediates": { "primerInExcess": { "deltaH_kcal_per_mol": -128.39999999999907, "deltaS_cal_per_K_mol": -345.1999999999972, "tmWithoutSaltCorrection_C": 68.87970826364392 }, "equalStrands": { "deltaH_kcal_per_mol": -128.39999999999907, "deltaS_cal_per_K_mol": -346.5999999999972, "tmWithoutSaltCorrection_C": 67.60891743524786 }, "saltCorrection": 0.00012236782465595812, "saltCorrectionApplies": "1/Tm(K) += corr", "derivation": "dH and dS recovered from two Biopython Tm_NN evaluations with saltcorr=0 at concentration terms k and 10k; they include initiation and, in equalStrands for a self-complementary oligo, the symmetry term." }, "method": { "nn": "santalucia-1998", "nnTable": "Biopython DNA_NN3", "salt": "owczarzy-2004", "saltText": "Owczarzy et al. 2004: 1/Tm = 1/Tm(1 M) + (4.29 fGC - 3.95) 1e-5 ln[Na+] + 9.40e-6 ln^2[Na+]", "concentration": "primerInExcess by default; equalStrands as the named alternative" }, "oracle": "Biopython Bio.SeqUtils.MeltingTemp.Tm_NN", "oracleVersion": "1.88", "recordedOn": "2026-10-06", "source": "pipeline/sequence-toolkit/reference.py (oligo-tm)", "call": { "primerInExcess": "Bio.SeqUtils.MeltingTemp.Tm_NN('CGGAACTGCAGTTCCG', check=True, strict=True, nn_table=DNA_NN3, dnac1=250, dnac2=0, selfcomp=False, Na=50, K=0, Tris=0, Mg=0, dNTPs=0, saltcorr=6)", "equalStrands": "Bio.SeqUtils.MeltingTemp.Tm_NN('CGGAACTGCAGTTCCG', check=True, strict=True, nn_table=DNA_NN3, dnac1=250, dnac2=0, selfcomp=True, Na=50, K=0, Tris=0, Mg=0, dNTPs=0, saltcorr=6)" }, "notes": "self-complementary" }, { "id": "T09", "input": { "sequence": "TTAGCATAATTGCAATATTCAGTTAAGCTA", "name": "d30-at", "length": 30, "gcPercent": 26.666666666666668, "selfComplementary": false, "oligoConcentration_nM": 500, "Na_mM": 1000, "K_mM": 0, "Tris_mM": 0, "Mg_mM": 0, "dNTPs_mM": 0, "complement": "perfect complement (c_seq=None), no dangling ends, no mismatches" }, "expected": { "defaultModel": "primerInExcess", "primerInExcess": { "tm_C": 72.04581524273675, "concentrationTerm_nM": 500.0, "dnac1_nM": 500, "dnac2_nM": 0, "symmetryTerm": false }, "equalStrands": { "tm_C": 70.60398190342391, "concentrationTerm_nM": 125.0, "dnac1_nM": 250.0, "dnac2_nM": 250.0, "symmetryTerm": false, "x": 4 }, "saltRegime": { "R": 0.0, "freeMg_mM": 0, "regimeId": null, "regime": "no Mg2+: Owczarzy 2008 not applied (R = 0)", "nearBoundary": false, "appliedCorrection": "owczarzy-2004", "note": "R, the regime and nearBoundary use free Mg2+; the regime decides the Tm where Owczarzy 2008 is applied (Mg2+ > 0)." } }, "oracleIntermediates": { "primerInExcess": { "deltaH_kcal_per_mol": -226.69999999999786, "deltaS_cal_per_K_mol": -627.8999999999934, "tmWithoutSaltCorrection_C": 72.04581524273675 }, "equalStrands": { "deltaH_kcal_per_mol": -226.70000000000272, "deltaS_cal_per_K_mol": -627.9000000000075, "tmWithoutSaltCorrection_C": 70.60398190342391 }, "saltCorrection": 0.0, "saltCorrectionApplies": "1/Tm(K) += corr", "derivation": "dH and dS recovered from two Biopython Tm_NN evaluations with saltcorr=0 at concentration terms k and 10k; they include initiation and, in equalStrands for a self-complementary oligo, the symmetry term." }, "method": { "nn": "santalucia-1998", "nnTable": "Biopython DNA_NN3", "salt": "owczarzy-2004", "saltText": "Owczarzy et al. 2004: 1/Tm = 1/Tm(1 M) + (4.29 fGC - 3.95) 1e-5 ln[Na+] + 9.40e-6 ln^2[Na+]", "concentration": "primerInExcess by default; equalStrands as the named alternative" }, "oracle": "Biopython Bio.SeqUtils.MeltingTemp.Tm_NN", "oracleVersion": "1.88", "recordedOn": "2026-10-06", "source": "pipeline/sequence-toolkit/reference.py (oligo-tm)", "call": { "primerInExcess": "Bio.SeqUtils.MeltingTemp.Tm_NN('TTAGCATAATTGCAATATTCAGTTAAGCTA', check=True, strict=True, nn_table=DNA_NN3, dnac1=500, dnac2=0, selfcomp=False, Na=1000, K=0, Tris=0, Mg=0, dNTPs=0, saltcorr=6)", "equalStrands": "Bio.SeqUtils.MeltingTemp.Tm_NN('TTAGCATAATTGCAATATTCAGTTAAGCTA', check=True, strict=True, nn_table=DNA_NN3, dnac1=250.0, dnac2=250.0, selfcomp=False, Na=1000, K=0, Tris=0, Mg=0, dNTPs=0, saltcorr=6)" }, "notes": "" }, { "id": "T10", "input": { "sequence": "GCCAGTCGGACTGCAGGCTGCCAAGTCCGTGGACA", "name": "d35", "length": 35, "gcPercent": 65.71428571428571, "selfComplementary": false, "oligoConcentration_nM": 250, "Na_mM": 50, "K_mM": 0, "Tris_mM": 0, "Mg_mM": 0, "dNTPs_mM": 0, "complement": "perfect complement (c_seq=None), no dangling ends, no mismatches" }, "expected": { "defaultModel": "primerInExcess", "primerInExcess": { "tm_C": 76.597588901005, "concentrationTerm_nM": 250.0, "dnac1_nM": 250, "dnac2_nM": 0, "symmetryTerm": false }, "equalStrands": { "tm_C": 75.42829426379137, "concentrationTerm_nM": 62.5, "dnac1_nM": 125.0, "dnac2_nM": 125.0, "symmetryTerm": false, "x": 4 }, "saltRegime": { "R": 0.0, "freeMg_mM": 0, "regimeId": null, "regime": "no Mg2+: Owczarzy 2008 not applied (R = 0)", "nearBoundary": false, "appliedCorrection": "owczarzy-2004", "note": "R, the regime and nearBoundary use free Mg2+; the regime decides the Tm where Owczarzy 2008 is applied (Mg2+ > 0)." } }, "oracleIntermediates": { "primerInExcess": { "deltaH_kcal_per_mol": -287.19999999999135, "deltaS_cal_per_K_mol": -756.9999999999761, "tmWithoutSaltCorrection_C": 91.68462393726202 }, "equalStrands": { "deltaH_kcal_per_mol": -287.19999999999914, "deltaS_cal_per_K_mol": -756.9999999999975, "tmWithoutSaltCorrection_C": 90.41245740529206 }, "saltCorrection": 0.00011823692383160387, "saltCorrectionApplies": "1/Tm(K) += corr", "derivation": "dH and dS recovered from two Biopython Tm_NN evaluations with saltcorr=0 at concentration terms k and 10k; they include initiation and, in equalStrands for a self-complementary oligo, the symmetry term." }, "method": { "nn": "santalucia-1998", "nnTable": "Biopython DNA_NN3", "salt": "owczarzy-2004", "saltText": "Owczarzy et al. 2004: 1/Tm = 1/Tm(1 M) + (4.29 fGC - 3.95) 1e-5 ln[Na+] + 9.40e-6 ln^2[Na+]", "concentration": "primerInExcess by default; equalStrands as the named alternative" }, "oracle": "Biopython Bio.SeqUtils.MeltingTemp.Tm_NN", "oracleVersion": "1.88", "recordedOn": "2026-10-06", "source": "pipeline/sequence-toolkit/reference.py (oligo-tm)", "call": { "primerInExcess": "Bio.SeqUtils.MeltingTemp.Tm_NN('GCCAGTCGGACTGCAGGCTGCCAAGTCCGTGGACA', check=True, strict=True, nn_table=DNA_NN3, dnac1=250, dnac2=0, selfcomp=False, Na=50, K=0, Tris=0, Mg=0, dNTPs=0, saltcorr=6)", "equalStrands": "Bio.SeqUtils.MeltingTemp.Tm_NN('GCCAGTCGGACTGCAGGCTGCCAAGTCCGTGGACA', check=True, strict=True, nn_table=DNA_NN3, dnac1=125.0, dnac2=125.0, selfcomp=False, Na=50, K=0, Tris=0, Mg=0, dNTPs=0, saltcorr=6)" }, "notes": "" }, { "id": "T11", "input": { "sequence": "ATTATAAGTTACATTATTAACTATCAGTAATTTGATAGCA", "name": "d40-at", "length": 40, "gcPercent": 20.0, "selfComplementary": false, "oligoConcentration_nM": 250, "Na_mM": 50, "K_mM": 0, "Tris_mM": 0, "Mg_mM": 0, "dNTPs_mM": 0, "complement": "perfect complement (c_seq=None), no dangling ends, no mismatches" }, "expected": { "defaultModel": "primerInExcess", "primerInExcess": { "tm_C": 51.964557940177656, "concentrationTerm_nM": 250.0, "dnac1_nM": 250, "dnac2_nM": 0, "symmetryTerm": false }, "equalStrands": { "tm_C": 50.99531496348209, "concentrationTerm_nM": 62.5, "dnac1_nM": 125.0, "dnac2_nM": 125.0, "symmetryTerm": false, "x": 4 }, "saltRegime": { "R": 0.0, "freeMg_mM": 0, "regimeId": null, "regime": "no Mg2+: Owczarzy 2008 not applied (R = 0)", "nearBoundary": false, "appliedCorrection": "owczarzy-2004", "note": "R, the regime and nearBoundary use free Mg2+; the regime decides the Tm where Owczarzy 2008 is applied (Mg2+ > 0)." } }, "oracleIntermediates": { "primerInExcess": { "deltaH_kcal_per_mol": -299.4999999999992, "deltaS_cal_per_K_mol": -837.9999999999977, "tmWithoutSaltCorrection_C": 71.81421897614905 }, "equalStrands": { "deltaH_kcal_per_mol": -299.5000000000077, "deltaS_cal_per_K_mol": -838.0000000000224, "tmWithoutSaltCorrection_C": 70.72320858058987 }, "saltCorrection": 0.00017698751333353126, "saltCorrectionApplies": "1/Tm(K) += corr", "derivation": "dH and dS recovered from two Biopython Tm_NN evaluations with saltcorr=0 at concentration terms k and 10k; they include initiation and, in equalStrands for a self-complementary oligo, the symmetry term." }, "method": { "nn": "santalucia-1998", "nnTable": "Biopython DNA_NN3", "salt": "owczarzy-2004", "saltText": "Owczarzy et al. 2004: 1/Tm = 1/Tm(1 M) + (4.29 fGC - 3.95) 1e-5 ln[Na+] + 9.40e-6 ln^2[Na+]", "concentration": "primerInExcess by default; equalStrands as the named alternative" }, "oracle": "Biopython Bio.SeqUtils.MeltingTemp.Tm_NN", "oracleVersion": "1.88", "recordedOn": "2026-10-06", "source": "pipeline/sequence-toolkit/reference.py (oligo-tm)", "call": { "primerInExcess": "Bio.SeqUtils.MeltingTemp.Tm_NN('ATTATAAGTTACATTATTAACTATCAGTAATTTGATAGCA', check=True, strict=True, nn_table=DNA_NN3, dnac1=250, dnac2=0, selfcomp=False, Na=50, K=0, Tris=0, Mg=0, dNTPs=0, saltcorr=6)", "equalStrands": "Bio.SeqUtils.MeltingTemp.Tm_NN('ATTATAAGTTACATTATTAACTATCAGTAATTTGATAGCA', check=True, strict=True, nn_table=DNA_NN3, dnac1=125.0, dnac2=125.0, selfcomp=False, Na=50, K=0, Tris=0, Mg=0, dNTPs=0, saltcorr=6)" }, "notes": "40-mer, 20% GC" }, { "id": "T12", "input": { "sequence": "GCGGCCGCATCCGGGCAGCGCCCAGAGCTCGCCGGTTGCG", "name": "d40-gc", "length": 40, "gcPercent": 80.0, "selfComplementary": false, "oligoConcentration_nM": 250, "Na_mM": 1000, "K_mM": 0, "Tris_mM": 0, "Mg_mM": 0, "dNTPs_mM": 0, "complement": "perfect complement (c_seq=None), no dangling ends, no mismatches" }, "expected": { "defaultModel": "primerInExcess", "primerInExcess": { "tm_C": 99.9819298750503, "concentrationTerm_nM": 250.0, "dnac1_nM": 250, "dnac2_nM": 0, "symmetryTerm": false }, "equalStrands": { "tm_C": 98.88155489603344, "concentrationTerm_nM": 62.5, "dnac1_nM": 125.0, "dnac2_nM": 125.0, "symmetryTerm": false, "x": 4 }, "saltRegime": { "R": 0.0, "freeMg_mM": 0, "regimeId": null, "regime": "no Mg2+: Owczarzy 2008 not applied (R = 0)", "nearBoundary": false, "appliedCorrection": "owczarzy-2004", "note": "R, the regime and nearBoundary use free Mg2+; the regime decides the Tm where Owczarzy 2008 is applied (Mg2+ > 0)." } }, "oracleIntermediates": { "primerInExcess": { "deltaH_kcal_per_mol": -347.4999999999823, "deltaS_cal_per_K_mol": -901.0999999999523, "tmWithoutSaltCorrection_C": 99.9819298750503 }, "equalStrands": { "deltaH_kcal_per_mol": -347.49999999999375, "deltaS_cal_per_K_mol": -901.099999999983, "tmWithoutSaltCorrection_C": 98.88155489603344 }, "saltCorrection": 0.0, "saltCorrectionApplies": "1/Tm(K) += corr", "derivation": "dH and dS recovered from two Biopython Tm_NN evaluations with saltcorr=0 at concentration terms k and 10k; they include initiation and, in equalStrands for a self-complementary oligo, the symmetry term." }, "method": { "nn": "santalucia-1998", "nnTable": "Biopython DNA_NN3", "salt": "owczarzy-2004", "saltText": "Owczarzy et al. 2004: 1/Tm = 1/Tm(1 M) + (4.29 fGC - 3.95) 1e-5 ln[Na+] + 9.40e-6 ln^2[Na+]", "concentration": "primerInExcess by default; equalStrands as the named alternative" }, "oracle": "Biopython Bio.SeqUtils.MeltingTemp.Tm_NN", "oracleVersion": "1.88", "recordedOn": "2026-10-06", "source": "pipeline/sequence-toolkit/reference.py (oligo-tm)", "call": { "primerInExcess": "Bio.SeqUtils.MeltingTemp.Tm_NN('GCGGCCGCATCCGGGCAGCGCCCAGAGCTCGCCGGTTGCG', check=True, strict=True, nn_table=DNA_NN3, dnac1=250, dnac2=0, selfcomp=False, Na=1000, K=0, Tris=0, Mg=0, dNTPs=0, saltcorr=6)", "equalStrands": "Bio.SeqUtils.MeltingTemp.Tm_NN('GCGGCCGCATCCGGGCAGCGCCCAGAGCTCGCCGGTTGCG', check=True, strict=True, nn_table=DNA_NN3, dnac1=125.0, dnac2=125.0, selfcomp=False, Na=1000, K=0, Tris=0, Mg=0, dNTPs=0, saltcorr=6)" }, "notes": "40-mer, 80% GC" }, { "id": "T13", "input": { "sequence": "CGCAAATGGGCGGTAGGCGTG", "name": "CMV-forward", "length": 21, "gcPercent": 66.66666666666667, "selfComplementary": false, "oligoConcentration_nM": 250, "Na_mM": 50, "K_mM": 0, "Tris_mM": 0, "Mg_mM": 0, "dNTPs_mM": 0, "complement": "perfect complement (c_seq=None), no dangling ends, no mismatches" }, "expected": { "defaultModel": "primerInExcess", "primerInExcess": { "tm_C": 66.33152650233001, "concentrationTerm_nM": 250.0, "dnac1_nM": 250, "dnac2_nM": 0, "symmetryTerm": false }, "equalStrands": { "tm_C": 64.50952006812747, "concentrationTerm_nM": 62.5, "dnac1_nM": 125.0, "dnac2_nM": 125.0, "symmetryTerm": false, "x": 4 }, "saltRegime": { "R": 0.0, "freeMg_mM": 0, "regimeId": null, "regime": "no Mg2+: Owczarzy 2008 not applied (R = 0)", "nearBoundary": false, "appliedCorrection": "owczarzy-2004", "note": "R, the regime and nearBoundary use free Mg2+; the regime decides the Tm where Owczarzy 2008 is applied (Mg2+ > 0)." } }, "oracleIntermediates": { "primerInExcess": { "deltaH_kcal_per_mol": -173.30000000000157, "deltaS_cal_per_K_mol": -460.0000000000043, "tmWithoutSaltCorrection_C": 80.37485448373104 }, "equalStrands": { "deltaH_kcal_per_mol": -173.29999999999873, "deltaS_cal_per_K_mol": -459.99999999999625, "tmWithoutSaltCorrection_C": 78.39942692780562 }, "saltCorrection": 0.00011701295321698038, "saltCorrectionApplies": "1/Tm(K) += corr", "derivation": "dH and dS recovered from two Biopython Tm_NN evaluations with saltcorr=0 at concentration terms k and 10k; they include initiation and, in equalStrands for a self-complementary oligo, the symmetry term." }, "method": { "nn": "santalucia-1998", "nnTable": "Biopython DNA_NN3", "salt": "owczarzy-2004", "saltText": "Owczarzy et al. 2004: 1/Tm = 1/Tm(1 M) + (4.29 fGC - 3.95) 1e-5 ln[Na+] + 9.40e-6 ln^2[Na+]", "concentration": "primerInExcess by default; equalStrands as the named alternative" }, "oracle": "Biopython Bio.SeqUtils.MeltingTemp.Tm_NN", "oracleVersion": "1.88", "recordedOn": "2026-10-06", "source": "pipeline/sequence-toolkit/reference.py (oligo-tm)", "call": { "primerInExcess": "Bio.SeqUtils.MeltingTemp.Tm_NN('CGCAAATGGGCGGTAGGCGTG', check=True, strict=True, nn_table=DNA_NN3, dnac1=250, dnac2=0, selfcomp=False, Na=50, K=0, Tris=0, Mg=0, dNTPs=0, saltcorr=6)", "equalStrands": "Bio.SeqUtils.MeltingTemp.Tm_NN('CGCAAATGGGCGGTAGGCGTG', check=True, strict=True, nn_table=DNA_NN3, dnac1=125.0, dnac2=125.0, selfcomp=False, Na=50, K=0, Tris=0, Mg=0, dNTPs=0, saltcorr=6)" }, "notes": "" }, { "id": "T14", "input": { "sequence": "GCTAGTTATTGCTCAGCGG", "name": "T7-terminator", "length": 19, "gcPercent": 52.63157894736842, "selfComplementary": false, "oligoConcentration_nM": 250, "Na_mM": 50, "K_mM": 0, "Tris_mM": 0, "Mg_mM": 0, "dNTPs_mM": 0, "complement": "perfect complement (c_seq=None), no dangling ends, no mismatches" }, "expected": { "defaultModel": "primerInExcess", "primerInExcess": { "tm_C": 54.530088236443646, "concentrationTerm_nM": 250.0, "dnac1_nM": 250, "dnac2_nM": 0, "symmetryTerm": false }, "equalStrands": { "tm_C": 52.57008559378039, "concentrationTerm_nM": 62.5, "dnac1_nM": 125.0, "dnac2_nM": 125.0, "symmetryTerm": false, "x": 4 }, "saltRegime": { "R": 0.0, "freeMg_mM": 0, "regimeId": null, "regime": "no Mg2+: Owczarzy 2008 not applied (R = 0)", "nearBoundary": false, "appliedCorrection": "owczarzy-2004", "note": "R, the regime and nearBoundary use free Mg2+; the regime decides the Tm where Owczarzy 2008 is applied (Mg2+ > 0)." } }, "oracleIntermediates": { "primerInExcess": { "deltaH_kcal_per_mol": -150.00000000000028, "deltaS_cal_per_K_mol": -407.30000000000075, "tmWithoutSaltCorrection_C": 69.70245155868042 }, "equalStrands": { "deltaH_kcal_per_mol": -149.99999999999815, "deltaS_cal_per_K_mol": -407.29999999999455, "tmWithoutSaltCorrection_C": 67.55733543118265 }, "saltCorrection": 0.00013505041490616862, "saltCorrectionApplies": "1/Tm(K) += corr", "derivation": "dH and dS recovered from two Biopython Tm_NN evaluations with saltcorr=0 at concentration terms k and 10k; they include initiation and, in equalStrands for a self-complementary oligo, the symmetry term." }, "method": { "nn": "santalucia-1998", "nnTable": "Biopython DNA_NN3", "salt": "owczarzy-2004", "saltText": "Owczarzy et al. 2004: 1/Tm = 1/Tm(1 M) + (4.29 fGC - 3.95) 1e-5 ln[Na+] + 9.40e-6 ln^2[Na+]", "concentration": "primerInExcess by default; equalStrands as the named alternative" }, "oracle": "Biopython Bio.SeqUtils.MeltingTemp.Tm_NN", "oracleVersion": "1.88", "recordedOn": "2026-10-06", "source": "pipeline/sequence-toolkit/reference.py (oligo-tm)", "call": { "primerInExcess": "Bio.SeqUtils.MeltingTemp.Tm_NN('GCTAGTTATTGCTCAGCGG', check=True, strict=True, nn_table=DNA_NN3, dnac1=250, dnac2=0, selfcomp=False, Na=50, K=0, Tris=0, Mg=0, dNTPs=0, saltcorr=6)", "equalStrands": "Bio.SeqUtils.MeltingTemp.Tm_NN('GCTAGTTATTGCTCAGCGG', check=True, strict=True, nn_table=DNA_NN3, dnac1=125.0, dnac2=125.0, selfcomp=False, Na=50, K=0, Tris=0, Mg=0, dNTPs=0, saltcorr=6)" }, "notes": "" }, { "id": "T15", "input": { "sequence": "CGTCGCCGTCCAGCTCGACCAG", "name": "EGFP-N", "length": 22, "gcPercent": 72.72727272727273, "selfComplementary": false, "oligoConcentration_nM": 500, "Na_mM": 50, "K_mM": 0, "Tris_mM": 0, "Mg_mM": 0, "dNTPs_mM": 0, "complement": "perfect complement (c_seq=None), no dangling ends, no mismatches" }, "expected": { "defaultModel": "primerInExcess", "primerInExcess": { "tm_C": 70.34793013640655, "concentrationTerm_nM": 500.0, "dnac1_nM": 500, "dnac2_nM": 0, "symmetryTerm": false }, "equalStrands": { "tm_C": 68.59248687142656, "concentrationTerm_nM": 125.0, "dnac1_nM": 250.0, "dnac2_nM": 250.0, "symmetryTerm": false, "x": 4 }, "saltRegime": { "R": 0.0, "freeMg_mM": 0, "regimeId": null, "regime": "no Mg2+: Owczarzy 2008 not applied (R = 0)", "nearBoundary": false, "appliedCorrection": "owczarzy-2004", "note": "R, the regime and nearBoundary use free Mg2+; the regime decides the Tm where Owczarzy 2008 is applied (Mg2+ > 0)." } }, "oracleIntermediates": { "primerInExcess": { "deltaH_kcal_per_mol": -184.19999999999703, "deltaS_cal_per_K_mol": -487.2999999999916, "tmWithoutSaltCorrection_C": 83.73772772292415 }, "equalStrands": { "deltaH_kcal_per_mol": -184.20000000000346, "deltaS_cal_per_K_mol": -487.3000000000096, "tmWithoutSaltCorrection_C": 81.84313759565111 }, "saltCorrection": 0.00010922404930573999, "saltCorrectionApplies": "1/Tm(K) += corr", "derivation": "dH and dS recovered from two Biopython Tm_NN evaluations with saltcorr=0 at concentration terms k and 10k; they include initiation and, in equalStrands for a self-complementary oligo, the symmetry term." }, "method": { "nn": "santalucia-1998", "nnTable": "Biopython DNA_NN3", "salt": "owczarzy-2004", "saltText": "Owczarzy et al. 2004: 1/Tm = 1/Tm(1 M) + (4.29 fGC - 3.95) 1e-5 ln[Na+] + 9.40e-6 ln^2[Na+]", "concentration": "primerInExcess by default; equalStrands as the named alternative" }, "oracle": "Biopython Bio.SeqUtils.MeltingTemp.Tm_NN", "oracleVersion": "1.88", "recordedOn": "2026-10-06", "source": "pipeline/sequence-toolkit/reference.py (oligo-tm)", "call": { "primerInExcess": "Bio.SeqUtils.MeltingTemp.Tm_NN('CGTCGCCGTCCAGCTCGACCAG', check=True, strict=True, nn_table=DNA_NN3, dnac1=500, dnac2=0, selfcomp=False, Na=50, K=0, Tris=0, Mg=0, dNTPs=0, saltcorr=6)", "equalStrands": "Bio.SeqUtils.MeltingTemp.Tm_NN('CGTCGCCGTCCAGCTCGACCAG', check=True, strict=True, nn_table=DNA_NN3, dnac1=250.0, dnac2=250.0, selfcomp=False, Na=50, K=0, Tris=0, Mg=0, dNTPs=0, saltcorr=6)" }, "notes": "" }, { "id": "T16", "input": { "sequence": "GCTAGTTATTGCTCAGCGG", "name": "T7-terminator", "length": 19, "gcPercent": 52.63157894736842, "selfComplementary": false, "oligoConcentration_nM": 500, "Na_mM": 1000, "K_mM": 0, "Tris_mM": 0, "Mg_mM": 0, "dNTPs_mM": 0, "complement": "perfect complement (c_seq=None), no dangling ends, no mismatches" }, "expected": { "defaultModel": "primerInExcess", "primerInExcess": { "tm_C": 70.78517095639836, "concentrationTerm_nM": 500.0, "dnac1_nM": 500, "dnac2_nM": 0, "symmetryTerm": false }, "equalStrands": { "tm_C": 68.62652764216483, "concentrationTerm_nM": 125.0, "dnac1_nM": 250.0, "dnac2_nM": 250.0, "symmetryTerm": false, "x": 4 }, "saltRegime": { "R": 0.0, "freeMg_mM": 0, "regimeId": null, "regime": "no Mg2+: Owczarzy 2008 not applied (R = 0)", "nearBoundary": false, "appliedCorrection": "owczarzy-2004", "note": "R, the regime and nearBoundary use free Mg2+; the regime decides the Tm where Owczarzy 2008 is applied (Mg2+ > 0)." } }, "oracleIntermediates": { "primerInExcess": { "deltaH_kcal_per_mol": -150.00000000000028, "deltaS_cal_per_K_mol": -407.30000000000075, "tmWithoutSaltCorrection_C": 70.78517095639836 }, "equalStrands": { "deltaH_kcal_per_mol": -149.99999999999815, "deltaS_cal_per_K_mol": -407.29999999999455, "tmWithoutSaltCorrection_C": 68.62652764216483 }, "saltCorrection": 0.0, "saltCorrectionApplies": "1/Tm(K) += corr", "derivation": "dH and dS recovered from two Biopython Tm_NN evaluations with saltcorr=0 at concentration terms k and 10k; they include initiation and, in equalStrands for a self-complementary oligo, the symmetry term." }, "method": { "nn": "santalucia-1998", "nnTable": "Biopython DNA_NN3", "salt": "owczarzy-2004", "saltText": "Owczarzy et al. 2004: 1/Tm = 1/Tm(1 M) + (4.29 fGC - 3.95) 1e-5 ln[Na+] + 9.40e-6 ln^2[Na+]", "concentration": "primerInExcess by default; equalStrands as the named alternative" }, "oracle": "Biopython Bio.SeqUtils.MeltingTemp.Tm_NN", "oracleVersion": "1.88", "recordedOn": "2026-10-06", "source": "pipeline/sequence-toolkit/reference.py (oligo-tm)", "call": { "primerInExcess": "Bio.SeqUtils.MeltingTemp.Tm_NN('GCTAGTTATTGCTCAGCGG', check=True, strict=True, nn_table=DNA_NN3, dnac1=500, dnac2=0, selfcomp=False, Na=1000, K=0, Tris=0, Mg=0, dNTPs=0, saltcorr=6)", "equalStrands": "Bio.SeqUtils.MeltingTemp.Tm_NN('GCTAGTTATTGCTCAGCGG', check=True, strict=True, nn_table=DNA_NN3, dnac1=250.0, dnac2=250.0, selfcomp=False, Na=1000, K=0, Tris=0, Mg=0, dNTPs=0, saltcorr=6)" }, "notes": "" }, { "id": "T17", "input": { "sequence": "ATTAGCATATGCTAAT", "name": "sc16-at", "length": 16, "gcPercent": 25.0, "selfComplementary": true, "oligoConcentration_nM": 250, "Na_mM": 50, "K_mM": 0, "Tris_mM": 0, "Mg_mM": 0, "dNTPs_mM": 0, "complement": "perfect complement (c_seq=None), no dangling ends, no mismatches" }, "expected": { "defaultModel": "primerInExcess", "primerInExcess": { "tm_C": 36.4964635016525, "concentrationTerm_nM": 250.0, "dnac1_nM": 250, "dnac2_nM": 0, "symmetryTerm": false }, "equalStrands": { "tm_C": 35.3213852682984, "concentrationTerm_nM": 250, "dnac1_nM": 250, "dnac2_nM": 0, "symmetryTerm": true, "x": 1 }, "saltRegime": { "R": 0.0, "freeMg_mM": 0, "regimeId": null, "regime": "no Mg2+: Owczarzy 2008 not applied (R = 0)", "nearBoundary": false, "appliedCorrection": "owczarzy-2004", "note": "R, the regime and nearBoundary use free Mg2+; the regime decides the Tm where Owczarzy 2008 is applied (Mg2+ > 0)." } }, "oracleIntermediates": { "primerInExcess": { "deltaH_kcal_per_mol": -113.80000000000037, "deltaS_cal_per_K_mol": -317.90000000000106, "tmWithoutSaltCorrection_C": 53.76193043047232 }, "equalStrands": { "deltaH_kcal_per_mol": -113.79999999999913, "deltaS_cal_per_K_mol": -319.2999999999972, "tmWithoutSaltCorrection_C": 52.45243439765585 }, "saltCorrection": 0.00017056166760675797, "saltCorrectionApplies": "1/Tm(K) += corr", "derivation": "dH and dS recovered from two Biopython Tm_NN evaluations with saltcorr=0 at concentration terms k and 10k; they include initiation and, in equalStrands for a self-complementary oligo, the symmetry term." }, "method": { "nn": "santalucia-1998", "nnTable": "Biopython DNA_NN3", "salt": "owczarzy-2004", "saltText": "Owczarzy et al. 2004: 1/Tm = 1/Tm(1 M) + (4.29 fGC - 3.95) 1e-5 ln[Na+] + 9.40e-6 ln^2[Na+]", "concentration": "primerInExcess by default; equalStrands as the named alternative" }, "oracle": "Biopython Bio.SeqUtils.MeltingTemp.Tm_NN", "oracleVersion": "1.88", "recordedOn": "2026-10-06", "source": "pipeline/sequence-toolkit/reference.py (oligo-tm)", "call": { "primerInExcess": "Bio.SeqUtils.MeltingTemp.Tm_NN('ATTAGCATATGCTAAT', check=True, strict=True, nn_table=DNA_NN3, dnac1=250, dnac2=0, selfcomp=False, Na=50, K=0, Tris=0, Mg=0, dNTPs=0, saltcorr=6)", "equalStrands": "Bio.SeqUtils.MeltingTemp.Tm_NN('ATTAGCATATGCTAAT', check=True, strict=True, nn_table=DNA_NN3, dnac1=250, dnac2=0, selfcomp=True, Na=50, K=0, Tris=0, Mg=0, dNTPs=0, saltcorr=6)" }, "notes": "self-complementary, 25% GC" }, { "id": "T18", "input": { "sequence": "GCACACGGTGCCGGCACCGTGTGC", "name": "sc24", "length": 24, "gcPercent": 75.0, "selfComplementary": true, "oligoConcentration_nM": 500, "Na_mM": 1000, "K_mM": 0, "Tris_mM": 0, "Mg_mM": 0, "dNTPs_mM": 0, "complement": "perfect complement (c_seq=None), no dangling ends, no mismatches" }, "expected": { "defaultModel": "primerInExcess", "primerInExcess": { "tm_C": 89.01673422289105, "concentrationTerm_nM": 500.0, "dnac1_nM": 500, "dnac2_nM": 0, "symmetryTerm": false }, "equalStrands": { "tm_C": 88.11969303356909, "concentrationTerm_nM": 500, "dnac1_nM": 500, "dnac2_nM": 0, "symmetryTerm": true, "x": 1 }, "saltRegime": { "R": 0.0, "freeMg_mM": 0, "regimeId": null, "regime": "no Mg2+: Owczarzy 2008 not applied (R = 0)", "nearBoundary": false, "appliedCorrection": "owczarzy-2004", "note": "R, the regime and nearBoundary use free Mg2+; the regime decides the Tm where Owczarzy 2008 is applied (Mg2+ > 0)." } }, "oracleIntermediates": { "primerInExcess": { "deltaH_kcal_per_mol": -204.20000000000783, "deltaS_cal_per_K_mol": -535.0000000000213, "tmWithoutSaltCorrection_C": 89.01673422289105 }, "equalStrands": { "deltaH_kcal_per_mol": -204.20000000000388, "deltaS_cal_per_K_mol": -536.4000000000103, "tmWithoutSaltCorrection_C": 88.11969303356909 }, "saltCorrection": 0.0, "saltCorrectionApplies": "1/Tm(K) += corr", "derivation": "dH and dS recovered from two Biopython Tm_NN evaluations with saltcorr=0 at concentration terms k and 10k; they include initiation and, in equalStrands for a self-complementary oligo, the symmetry term." }, "method": { "nn": "santalucia-1998", "nnTable": "Biopython DNA_NN3", "salt": "owczarzy-2004", "saltText": "Owczarzy et al. 2004: 1/Tm = 1/Tm(1 M) + (4.29 fGC - 3.95) 1e-5 ln[Na+] + 9.40e-6 ln^2[Na+]", "concentration": "primerInExcess by default; equalStrands as the named alternative" }, "oracle": "Biopython Bio.SeqUtils.MeltingTemp.Tm_NN", "oracleVersion": "1.88", "recordedOn": "2026-10-06", "source": "pipeline/sequence-toolkit/reference.py (oligo-tm)", "call": { "primerInExcess": "Bio.SeqUtils.MeltingTemp.Tm_NN('GCACACGGTGCCGGCACCGTGTGC', check=True, strict=True, nn_table=DNA_NN3, dnac1=500, dnac2=0, selfcomp=False, Na=1000, K=0, Tris=0, Mg=0, dNTPs=0, saltcorr=6)", "equalStrands": "Bio.SeqUtils.MeltingTemp.Tm_NN('GCACACGGTGCCGGCACCGTGTGC', check=True, strict=True, nn_table=DNA_NN3, dnac1=500, dnac2=0, selfcomp=True, Na=1000, K=0, Tris=0, Mg=0, dNTPs=0, saltcorr=6)" }, "notes": "self-complementary, 75% GC" }, { "id": "T19", "input": { "sequence": "TAATACGACTCACTATAGGG", "name": "T7-promoter", "length": 20, "gcPercent": 40.0, "selfComplementary": false, "oligoConcentration_nM": 250, "Na_mM": 50, "K_mM": 0, "Tris_mM": 0, "Mg_mM": 0, "dNTPs_mM": 0, "complement": "perfect complement (c_seq=None), no dangling ends, no mismatches" }, "expected": { "defaultModel": "primerInExcess", "primerInExcess": { "tm_C": 48.682614271718364, "concentrationTerm_nM": 250.0, "dnac1_nM": 250, "dnac2_nM": 0, "symmetryTerm": false }, "equalStrands": { "tm_C": 46.77657972141202, "concentrationTerm_nM": 62.5, "dnac1_nM": 125.0, "dnac2_nM": 125.0, "symmetryTerm": false, "x": 4 }, "saltRegime": { "R": 0.0, "freeMg_mM": 0, "regimeId": null, "regime": "no Mg2+: Owczarzy 2008 not applied (R = 0)", "nearBoundary": false, "appliedCorrection": "santalucia-1998-entropy", "note": "R, the regime and nearBoundary use free Mg2+; the regime decides the Tm where Owczarzy 2008 is applied (Mg2+ > 0)." } }, "oracleIntermediates": { "primerInExcess": { "deltaH_kcal_per_mol": -148.79999999999623, "deltaS_cal_per_K_mol": -411.19999999998885, "tmWithoutSaltCorrection_C": 63.95462611136554 }, "equalStrands": { "deltaH_kcal_per_mol": -148.80000000000044, "deltaS_cal_per_K_mol": -411.20000000000124, "tmWithoutSaltCorrection_C": 61.863991910319044 }, "saltCorrection": -20.946160056689504, "saltCorrectionApplies": "added to dS (cal/(K mol))", "derivation": "dH and dS recovered from two Biopython Tm_NN evaluations with saltcorr=0 at concentration terms k and 10k; they include initiation and, in equalStrands for a self-complementary oligo, the symmetry term." }, "method": { "nn": "santalucia-1998", "nnTable": "Biopython DNA_NN3", "salt": "santalucia-1998-entropy", "saltText": "SantaLucia 1998 entropy correction: dS += 0.368 (N - 1) ln[Na+]", "concentration": "primerInExcess by default; equalStrands as the named alternative" }, "oracle": "Biopython Bio.SeqUtils.MeltingTemp.Tm_NN", "oracleVersion": "1.88", "recordedOn": "2026-10-06", "source": "pipeline/sequence-toolkit/reference.py (oligo-tm)", "call": { "primerInExcess": "Bio.SeqUtils.MeltingTemp.Tm_NN('TAATACGACTCACTATAGGG', check=True, strict=True, nn_table=DNA_NN3, dnac1=250, dnac2=0, selfcomp=False, Na=50, K=0, Tris=0, Mg=0, dNTPs=0, saltcorr=5)", "equalStrands": "Bio.SeqUtils.MeltingTemp.Tm_NN('TAATACGACTCACTATAGGG', check=True, strict=True, nn_table=DNA_NN3, dnac1=125.0, dnac2=125.0, selfcomp=False, Na=50, K=0, Tris=0, Mg=0, dNTPs=0, saltcorr=5)" }, "notes": "as T04 with the SantaLucia 1998 entropy correction" }, { "id": "T20", "input": { "sequence": "TGCATCAGTCGAAGT", "name": "d15-mid", "length": 15, "gcPercent": 46.666666666666664, "selfComplementary": false, "oligoConcentration_nM": 500, "Na_mM": 50, "K_mM": 0, "Tris_mM": 0, "Mg_mM": 0, "dNTPs_mM": 0, "complement": "perfect complement (c_seq=None), no dangling ends, no mismatches" }, "expected": { "defaultModel": "primerInExcess", "primerInExcess": { "tm_C": 49.226405943533166, "concentrationTerm_nM": 500.0, "dnac1_nM": 500, "dnac2_nM": 0, "symmetryTerm": false }, "equalStrands": { "tm_C": 46.72157072233756, "concentrationTerm_nM": 125.0, "dnac1_nM": 250.0, "dnac2_nM": 250.0, "symmetryTerm": false, "x": 4 }, "saltRegime": { "R": 0.0, "freeMg_mM": 0, "regimeId": null, "regime": "no Mg2+: Owczarzy 2008 not applied (R = 0)", "nearBoundary": false, "appliedCorrection": "santalucia-1998-entropy", "note": "R, the regime and nearBoundary use free Mg2+; the regime decides the Tm where Owczarzy 2008 is applied (Mg2+ > 0)." } }, "oracleIntermediates": { "primerInExcess": { "deltaH_kcal_per_mol": -113.3999999999996, "deltaS_cal_per_K_mol": -307.49999999999875, "tmWithoutSaltCorrection_C": 64.0201523339793 }, "equalStrands": { "deltaH_kcal_per_mol": -113.3999999999996, "deltaS_cal_per_K_mol": -307.4999999999987, "tmWithoutSaltCorrection_C": 61.28112678349231 }, "saltCorrection": -15.43401267335016, "saltCorrectionApplies": "added to dS (cal/(K mol))", "derivation": "dH and dS recovered from two Biopython Tm_NN evaluations with saltcorr=0 at concentration terms k and 10k; they include initiation and, in equalStrands for a self-complementary oligo, the symmetry term." }, "method": { "nn": "santalucia-1998", "nnTable": "Biopython DNA_NN3", "salt": "santalucia-1998-entropy", "saltText": "SantaLucia 1998 entropy correction: dS += 0.368 (N - 1) ln[Na+]", "concentration": "primerInExcess by default; equalStrands as the named alternative" }, "oracle": "Biopython Bio.SeqUtils.MeltingTemp.Tm_NN", "oracleVersion": "1.88", "recordedOn": "2026-10-06", "source": "pipeline/sequence-toolkit/reference.py (oligo-tm)", "call": { "primerInExcess": "Bio.SeqUtils.MeltingTemp.Tm_NN('TGCATCAGTCGAAGT', check=True, strict=True, nn_table=DNA_NN3, dnac1=500, dnac2=0, selfcomp=False, Na=50, K=0, Tris=0, Mg=0, dNTPs=0, saltcorr=5)", "equalStrands": "Bio.SeqUtils.MeltingTemp.Tm_NN('TGCATCAGTCGAAGT', check=True, strict=True, nn_table=DNA_NN3, dnac1=250.0, dnac2=250.0, selfcomp=False, Na=50, K=0, Tris=0, Mg=0, dNTPs=0, saltcorr=5)" }, "notes": "" }, { "id": "T21", "input": { "sequence": "GCATCGGTACCTGATTGCAAGTCAGGTCAT", "name": "d30", "length": 30, "gcPercent": 50.0, "selfComplementary": false, "oligoConcentration_nM": 250, "Na_mM": 1000, "K_mM": 0, "Tris_mM": 0, "Mg_mM": 0, "dNTPs_mM": 0, "complement": "perfect complement (c_seq=None), no dangling ends, no mismatches" }, "expected": { "defaultModel": "primerInExcess", "primerInExcess": { "tm_C": 81.35288120324464, "concentrationTerm_nM": 250.0, "dnac1_nM": 250, "dnac2_nM": 0, "symmetryTerm": false }, "equalStrands": { "tm_C": 79.89945177330497, "concentrationTerm_nM": 62.5, "dnac1_nM": 125.0, "dnac2_nM": 125.0, "symmetryTerm": false, "x": 4 }, "saltRegime": { "R": 0.0, "freeMg_mM": 0, "regimeId": null, "regime": "no Mg2+: Owczarzy 2008 not applied (R = 0)", "nearBoundary": false, "appliedCorrection": "santalucia-1998-entropy", "note": "R, the regime and nearBoundary use free Mg2+; the regime decides the Tm where Owczarzy 2008 is applied (Mg2+ > 0)." } }, "oracleIntermediates": { "primerInExcess": { "deltaH_kcal_per_mol": -237.1999999999965, "deltaS_cal_per_K_mol": -638.89999999999, "tmWithoutSaltCorrection_C": 81.35288120324464 }, "equalStrands": { "deltaH_kcal_per_mol": -237.20000000000715, "deltaS_cal_per_K_mol": -638.9000000000202, "tmWithoutSaltCorrection_C": 79.89945177330497 }, "saltCorrection": 0.0, "saltCorrectionApplies": "added to dS (cal/(K mol))", "derivation": "dH and dS recovered from two Biopython Tm_NN evaluations with saltcorr=0 at concentration terms k and 10k; they include initiation and, in equalStrands for a self-complementary oligo, the symmetry term." }, "method": { "nn": "santalucia-1998", "nnTable": "Biopython DNA_NN3", "salt": "santalucia-1998-entropy", "saltText": "SantaLucia 1998 entropy correction: dS += 0.368 (N - 1) ln[Na+]", "concentration": "primerInExcess by default; equalStrands as the named alternative" }, "oracle": "Biopython Bio.SeqUtils.MeltingTemp.Tm_NN", "oracleVersion": "1.88", "recordedOn": "2026-10-06", "source": "pipeline/sequence-toolkit/reference.py (oligo-tm)", "call": { "primerInExcess": "Bio.SeqUtils.MeltingTemp.Tm_NN('GCATCGGTACCTGATTGCAAGTCAGGTCAT', check=True, strict=True, nn_table=DNA_NN3, dnac1=250, dnac2=0, selfcomp=False, Na=1000, K=0, Tris=0, Mg=0, dNTPs=0, saltcorr=5)", "equalStrands": "Bio.SeqUtils.MeltingTemp.Tm_NN('GCATCGGTACCTGATTGCAAGTCAGGTCAT', check=True, strict=True, nn_table=DNA_NN3, dnac1=125.0, dnac2=125.0, selfcomp=False, Na=1000, K=0, Tris=0, Mg=0, dNTPs=0, saltcorr=5)" }, "notes": "1 M Na+: the entropy correction is zero (ln 1 = 0)" }, { "id": "T22", "input": { "sequence": "ATGCGTACCATGAGTCAGTTGACCAGTACGCATTGCAAGT", "name": "d40-mid", "length": 40, "gcPercent": 47.5, "selfComplementary": false, "oligoConcentration_nM": 250, "Na_mM": 50, "K_mM": 0, "Tris_mM": 0, "Mg_mM": 0, "dNTPs_mM": 0, "complement": "perfect complement (c_seq=None), no dangling ends, no mismatches" }, "expected": { "defaultModel": "primerInExcess", "primerInExcess": { "tm_C": 69.6824769853211, "concentrationTerm_nM": 250.0, "dnac1_nM": 250, "dnac2_nM": 0, "symmetryTerm": false }, "equalStrands": { "tm_C": 68.6774754821663, "concentrationTerm_nM": 62.5, "dnac1_nM": 125.0, "dnac2_nM": 125.0, "symmetryTerm": false, "x": 4 }, "saltRegime": { "R": 0.0, "freeMg_mM": 0, "regimeId": null, "regime": "no Mg2+: Owczarzy 2008 not applied (R = 0)", "nearBoundary": false, "appliedCorrection": "santalucia-1998-entropy", "note": "R, the regime and nearBoundary use free Mg2+; the regime decides the Tm where Owczarzy 2008 is applied (Mg2+ > 0)." } }, "oracleIntermediates": { "primerInExcess": { "deltaH_kcal_per_mol": -321.1999999999958, "deltaS_cal_per_K_mol": -863.6999999999883, "tmWithoutSaltCorrection_C": 86.1719028578409 }, "equalStrands": { "deltaH_kcal_per_mol": -321.20000000001534, "deltaS_cal_per_K_mol": -863.7000000000426, "tmWithoutSaltCorrection_C": 85.06805568306874 }, "saltCorrection": -42.99474959004688, "saltCorrectionApplies": "added to dS (cal/(K mol))", "derivation": "dH and dS recovered from two Biopython Tm_NN evaluations with saltcorr=0 at concentration terms k and 10k; they include initiation and, in equalStrands for a self-complementary oligo, the symmetry term." }, "method": { "nn": "santalucia-1998", "nnTable": "Biopython DNA_NN3", "salt": "santalucia-1998-entropy", "saltText": "SantaLucia 1998 entropy correction: dS += 0.368 (N - 1) ln[Na+]", "concentration": "primerInExcess by default; equalStrands as the named alternative" }, "oracle": "Biopython Bio.SeqUtils.MeltingTemp.Tm_NN", "oracleVersion": "1.88", "recordedOn": "2026-10-06", "source": "pipeline/sequence-toolkit/reference.py (oligo-tm)", "call": { "primerInExcess": "Bio.SeqUtils.MeltingTemp.Tm_NN('ATGCGTACCATGAGTCAGTTGACCAGTACGCATTGCAAGT', check=True, strict=True, nn_table=DNA_NN3, dnac1=250, dnac2=0, selfcomp=False, Na=50, K=0, Tris=0, Mg=0, dNTPs=0, saltcorr=5)", "equalStrands": "Bio.SeqUtils.MeltingTemp.Tm_NN('ATGCGTACCATGAGTCAGTTGACCAGTACGCATTGCAAGT', check=True, strict=True, nn_table=DNA_NN3, dnac1=125.0, dnac2=125.0, selfcomp=False, Na=50, K=0, Tris=0, Mg=0, dNTPs=0, saltcorr=5)" }, "notes": "" }, { "id": "T23", "input": { "sequence": "GACTGATCATGATCAGTC", "name": "sc18", "length": 18, "gcPercent": 44.44444444444444, "selfComplementary": true, "oligoConcentration_nM": 500, "Na_mM": 50, "K_mM": 0, "Tris_mM": 0, "Mg_mM": 0, "dNTPs_mM": 0, "complement": "perfect complement (c_seq=None), no dangling ends, no mismatches" }, "expected": { "defaultModel": "primerInExcess", "primerInExcess": { "tm_C": 49.07404850177841, "concentrationTerm_nM": 500.0, "dnac1_nM": 500, "dnac2_nM": 0, "symmetryTerm": false }, "equalStrands": { "tm_C": 48.016511254337615, "concentrationTerm_nM": 500, "dnac1_nM": 500, "dnac2_nM": 0, "symmetryTerm": true, "x": 1 }, "saltRegime": { "R": 0.0, "freeMg_mM": 0, "regimeId": null, "regime": "no Mg2+: Owczarzy 2008 not applied (R = 0)", "nearBoundary": false, "appliedCorrection": "santalucia-1998-entropy", "note": "R, the regime and nearBoundary use free Mg2+; the regime decides the Tm where Owczarzy 2008 is applied (Mg2+ > 0)." } }, "oracleIntermediates": { "primerInExcess": { "deltaH_kcal_per_mol": -136.99999999999986, "deltaS_cal_per_K_mol": -377.5999999999995, "tmWithoutSaltCorrection_C": 63.93249199317313 }, "equalStrands": { "deltaH_kcal_per_mol": -136.99999999999986, "deltaS_cal_per_K_mol": -378.99999999999943, "tmWithoutSaltCorrection_C": 62.77535056245944 }, "saltCorrection": -18.741301103353766, "saltCorrectionApplies": "added to dS (cal/(K mol))", "derivation": "dH and dS recovered from two Biopython Tm_NN evaluations with saltcorr=0 at concentration terms k and 10k; they include initiation and, in equalStrands for a self-complementary oligo, the symmetry term." }, "method": { "nn": "santalucia-1998", "nnTable": "Biopython DNA_NN3", "salt": "santalucia-1998-entropy", "saltText": "SantaLucia 1998 entropy correction: dS += 0.368 (N - 1) ln[Na+]", "concentration": "primerInExcess by default; equalStrands as the named alternative" }, "oracle": "Biopython Bio.SeqUtils.MeltingTemp.Tm_NN", "oracleVersion": "1.88", "recordedOn": "2026-10-06", "source": "pipeline/sequence-toolkit/reference.py (oligo-tm)", "call": { "primerInExcess": "Bio.SeqUtils.MeltingTemp.Tm_NN('GACTGATCATGATCAGTC', check=True, strict=True, nn_table=DNA_NN3, dnac1=500, dnac2=0, selfcomp=False, Na=50, K=0, Tris=0, Mg=0, dNTPs=0, saltcorr=5)", "equalStrands": "Bio.SeqUtils.MeltingTemp.Tm_NN('GACTGATCATGATCAGTC', check=True, strict=True, nn_table=DNA_NN3, dnac1=500, dnac2=0, selfcomp=True, Na=50, K=0, Tris=0, Mg=0, dNTPs=0, saltcorr=5)" }, "notes": "self-complementary" }, { "id": "T24", "input": { "sequence": "GACCATGTTGCAAGTCCATCAGTG", "name": "d24", "length": 24, "gcPercent": 50.0, "selfComplementary": false, "oligoConcentration_nM": 250, "Na_mM": 50, "K_mM": 0, "Tris_mM": 0, "Mg_mM": 0, "dNTPs_mM": 0, "complement": "perfect complement (c_seq=None), no dangling ends, no mismatches" }, "expected": { "defaultModel": "primerInExcess", "primerInExcess": { "tm_C": 59.97084513668284, "concentrationTerm_nM": 250.0, "dnac1_nM": 250, "dnac2_nM": 0, "symmetryTerm": false }, "equalStrands": { "tm_C": 58.36218942133843, "concentrationTerm_nM": 62.5, "dnac1_nM": 125.0, "dnac2_nM": 125.0, "symmetryTerm": false, "x": 4 }, "saltRegime": { "R": 0.0, "freeMg_mM": 0, "regimeId": null, "regime": "no Mg2+: Owczarzy 2008 not applied (R = 0)", "nearBoundary": false, "appliedCorrection": "santalucia-1998-entropy", "note": "R, the regime and nearBoundary use free Mg2+; the regime decides the Tm where Owczarzy 2008 is applied (Mg2+ > 0)." } }, "oracleIntermediates": { "primerInExcess": { "deltaH_kcal_per_mol": -189.0999999999971, "deltaS_cal_per_K_mol": -512.0999999999915, "tmWithoutSaltCorrection_C": 75.54613235195029 }, "equalStrands": { "deltaH_kcal_per_mol": -189.1000000000005, "deltaS_cal_per_K_mol": -512.1000000000013, "tmWithoutSaltCorrection_C": 73.78393030482118 }, "saltCorrection": -25.355877963360978, "saltCorrectionApplies": "added to dS (cal/(K mol))", "derivation": "dH and dS recovered from two Biopython Tm_NN evaluations with saltcorr=0 at concentration terms k and 10k; they include initiation and, in equalStrands for a self-complementary oligo, the symmetry term." }, "method": { "nn": "santalucia-1998", "nnTable": "Biopython DNA_NN3", "salt": "santalucia-1998-entropy", "saltText": "SantaLucia 1998 entropy correction: dS += 0.368 (N - 1) ln[Na+]", "concentration": "primerInExcess by default; equalStrands as the named alternative" }, "oracle": "Biopython Bio.SeqUtils.MeltingTemp.Tm_NN", "oracleVersion": "1.88", "recordedOn": "2026-10-06", "source": "pipeline/sequence-toolkit/reference.py (oligo-tm)", "call": { "primerInExcess": "Bio.SeqUtils.MeltingTemp.Tm_NN('GACCATGTTGCAAGTCCATCAGTG', check=True, strict=True, nn_table=DNA_NN3, dnac1=250, dnac2=0, selfcomp=False, Na=50, K=0, Tris=0, Mg=0, dNTPs=0, saltcorr=5)", "equalStrands": "Bio.SeqUtils.MeltingTemp.Tm_NN('GACCATGTTGCAAGTCCATCAGTG', check=True, strict=True, nn_table=DNA_NN3, dnac1=125.0, dnac2=125.0, selfcomp=False, Na=50, K=0, Tris=0, Mg=0, dNTPs=0, saltcorr=5)" }, "notes": "" }, { "id": "T25", "input": { "sequence": "TAATACGACTCACTATAGGG", "name": "T7-promoter", "length": 20, "gcPercent": 40.0, "selfComplementary": false, "oligoConcentration_nM": 250, "Na_mM": 50, "K_mM": 0, "Tris_mM": 0, "Mg_mM": 1.5, "dNTPs_mM": 0, "complement": "perfect complement (c_seq=None), no dangling ends, no mismatches" }, "expected": { "defaultModel": "primerInExcess", "primerInExcess": { "tm_C": 54.846927606656664, "concentrationTerm_nM": 250.0, "dnac1_nM": 250, "dnac2_nM": 0, "symmetryTerm": false }, "equalStrands": { "tm_C": 52.86740278631822, "concentrationTerm_nM": 62.5, "dnac1_nM": 125.0, "dnac2_nM": 125.0, "symmetryTerm": false, "x": 4 }, "saltRegime": { "R": 0.7745966692414833, "freeMg_mM": 1.5, "regimeId": "adjustedConstants", "regime": "0.22 <= R < 6: divalent formula with a, d and g adjusted for [Mon+]", "nearBoundary": false, "appliedCorrection": "owczarzy-2008", "note": "R, the regime and nearBoundary use free Mg2+; the regime decides the Tm where Owczarzy 2008 is applied (Mg2+ > 0).", "biopythonBranchVerified": true } }, "oracleIntermediates": { "primerInExcess": { "deltaH_kcal_per_mol": -148.79999999999623, "deltaS_cal_per_K_mol": -411.19999999998885, "tmWithoutSaltCorrection_C": 63.95462611136554 }, "equalStrands": { "deltaH_kcal_per_mol": -148.80000000000044, "deltaS_cal_per_K_mol": -411.20000000000124, "tmWithoutSaltCorrection_C": 61.863991910319044 }, "saltCorrection": 8.237096568851266e-05, "saltCorrectionApplies": "1/Tm(K) += corr", "derivation": "dH and dS recovered from two Biopython Tm_NN evaluations with saltcorr=0 at concentration terms k and 10k; they include initiation and, in equalStrands for a self-complementary oligo, the symmetry term." }, "method": { "nn": "santalucia-1998", "nnTable": "Biopython DNA_NN3", "salt": "owczarzy-2008", "saltText": "Owczarzy et al. 2008: Mg2+ and mixed-cation correction, regime by R = sqrt([Mg2+]) / [Mon+]", "concentration": "primerInExcess by default; equalStrands as the named alternative" }, "oracle": "Biopython Bio.SeqUtils.MeltingTemp.Tm_NN", "oracleVersion": "1.88", "recordedOn": "2026-10-06", "source": "pipeline/sequence-toolkit/reference.py (oligo-tm)", "call": { "primerInExcess": "Bio.SeqUtils.MeltingTemp.Tm_NN('TAATACGACTCACTATAGGG', check=True, strict=True, nn_table=DNA_NN3, dnac1=250, dnac2=0, selfcomp=False, Na=50, K=0, Tris=0, Mg=1.5, dNTPs=0, saltcorr=7)", "equalStrands": "Bio.SeqUtils.MeltingTemp.Tm_NN('TAATACGACTCACTATAGGG', check=True, strict=True, nn_table=DNA_NN3, dnac1=125.0, dnac2=125.0, selfcomp=False, Na=50, K=0, Tris=0, Mg=1.5, dNTPs=0, saltcorr=7)" }, "notes": "Owczarzy 2008, 0.22 <= R < 6" }, { "id": "T26", "input": { "sequence": "TAATACGACTCACTATAGGG", "name": "T7-promoter", "length": 20, "gcPercent": 40.0, "selfComplementary": false, "oligoConcentration_nM": 250, "Na_mM": 50, "K_mM": 0, "Tris_mM": 0, "Mg_mM": 3.0, "dNTPs_mM": 0, "complement": "perfect complement (c_seq=None), no dangling ends, no mismatches" }, "expected": { "defaultModel": "primerInExcess", "primerInExcess": { "tm_C": 56.22957147884671, "concentrationTerm_nM": 250.0, "dnac1_nM": 250, "dnac2_nM": 0, "symmetryTerm": false }, "equalStrands": { "tm_C": 54.23337322212376, "concentrationTerm_nM": 62.5, "dnac1_nM": 125.0, "dnac2_nM": 125.0, "symmetryTerm": false, "x": 4 }, "saltRegime": { "R": 1.0954451150103321, "freeMg_mM": 3.0, "regimeId": "adjustedConstants", "regime": "0.22 <= R < 6: divalent formula with a, d and g adjusted for [Mon+]", "nearBoundary": false, "appliedCorrection": "owczarzy-2008", "note": "R, the regime and nearBoundary use free Mg2+; the regime decides the Tm where Owczarzy 2008 is applied (Mg2+ > 0).", "biopythonBranchVerified": true } }, "oracleIntermediates": { "primerInExcess": { "deltaH_kcal_per_mol": -148.79999999999623, "deltaS_cal_per_K_mol": -411.19999999998885, "tmWithoutSaltCorrection_C": 63.95462611136554 }, "equalStrands": { "deltaH_kcal_per_mol": -148.80000000000044, "deltaS_cal_per_K_mol": -411.20000000000124, "tmWithoutSaltCorrection_C": 61.863991910319044 }, "saltCorrection": 6.957291289420883e-05, "saltCorrectionApplies": "1/Tm(K) += corr", "derivation": "dH and dS recovered from two Biopython Tm_NN evaluations with saltcorr=0 at concentration terms k and 10k; they include initiation and, in equalStrands for a self-complementary oligo, the symmetry term." }, "method": { "nn": "santalucia-1998", "nnTable": "Biopython DNA_NN3", "salt": "owczarzy-2008", "saltText": "Owczarzy et al. 2008: Mg2+ and mixed-cation correction, regime by R = sqrt([Mg2+]) / [Mon+]", "concentration": "primerInExcess by default; equalStrands as the named alternative" }, "oracle": "Biopython Bio.SeqUtils.MeltingTemp.Tm_NN", "oracleVersion": "1.88", "recordedOn": "2026-10-06", "source": "pipeline/sequence-toolkit/reference.py (oligo-tm)", "call": { "primerInExcess": "Bio.SeqUtils.MeltingTemp.Tm_NN('TAATACGACTCACTATAGGG', check=True, strict=True, nn_table=DNA_NN3, dnac1=250, dnac2=0, selfcomp=False, Na=50, K=0, Tris=0, Mg=3.0, dNTPs=0, saltcorr=7)", "equalStrands": "Bio.SeqUtils.MeltingTemp.Tm_NN('TAATACGACTCACTATAGGG', check=True, strict=True, nn_table=DNA_NN3, dnac1=125.0, dnac2=125.0, selfcomp=False, Na=50, K=0, Tris=0, Mg=3.0, dNTPs=0, saltcorr=7)" }, "notes": "Owczarzy 2008, 0.22 <= R < 6" }, { "id": "T27", "input": { "sequence": "CAGGAAACAGCTATGAC", "name": "M13R-27", "length": 17, "gcPercent": 47.05882352941177, "selfComplementary": false, "oligoConcentration_nM": 500, "Na_mM": 50, "K_mM": 0, "Tris_mM": 0, "Mg_mM": 2.0, "dNTPs_mM": 0, "complement": "perfect complement (c_seq=None), no dangling ends, no mismatches" }, "expected": { "defaultModel": "primerInExcess", "primerInExcess": { "tm_C": 56.05375775853423, "concentrationTerm_nM": 500.0, "dnac1_nM": 500, "dnac2_nM": 0, "symmetryTerm": false }, "equalStrands": { "tm_C": 53.771563941166505, "concentrationTerm_nM": 125.0, "dnac1_nM": 250.0, "dnac2_nM": 250.0, "symmetryTerm": false, "x": 4 }, "saltRegime": { "R": 0.8944271909999159, "freeMg_mM": 2.0, "regimeId": "adjustedConstants", "regime": "0.22 <= R < 6: divalent formula with a, d and g adjusted for [Mon+]", "nearBoundary": false, "appliedCorrection": "owczarzy-2008", "note": "R, the regime and nearBoundary use free Mg2+; the regime decides the Tm where Owczarzy 2008 is applied (Mg2+ > 0).", "biopythonBranchVerified": true } }, "oracleIntermediates": { "primerInExcess": { "deltaH_kcal_per_mol": -129.8999999999988, "deltaS_cal_per_K_mol": -356.2999999999963, "tmWithoutSaltCorrection_C": 64.13984366249252 }, "equalStrands": { "deltaH_kcal_per_mol": -129.8999999999988, "deltaS_cal_per_K_mol": -356.2999999999964, "tmWithoutSaltCorrection_C": 61.74456778997882 }, "saltCorrection": 7.282329122466826e-05, "saltCorrectionApplies": "1/Tm(K) += corr", "derivation": "dH and dS recovered from two Biopython Tm_NN evaluations with saltcorr=0 at concentration terms k and 10k; they include initiation and, in equalStrands for a self-complementary oligo, the symmetry term." }, "method": { "nn": "santalucia-1998", "nnTable": "Biopython DNA_NN3", "salt": "owczarzy-2008", "saltText": "Owczarzy et al. 2008: Mg2+ and mixed-cation correction, regime by R = sqrt([Mg2+]) / [Mon+]", "concentration": "primerInExcess by default; equalStrands as the named alternative" }, "oracle": "Biopython Bio.SeqUtils.MeltingTemp.Tm_NN", "oracleVersion": "1.88", "recordedOn": "2026-10-06", "source": "pipeline/sequence-toolkit/reference.py (oligo-tm)", "call": { "primerInExcess": "Bio.SeqUtils.MeltingTemp.Tm_NN('CAGGAAACAGCTATGAC', check=True, strict=True, nn_table=DNA_NN3, dnac1=500, dnac2=0, selfcomp=False, Na=50, K=0, Tris=0, Mg=2.0, dNTPs=0, saltcorr=7)", "equalStrands": "Bio.SeqUtils.MeltingTemp.Tm_NN('CAGGAAACAGCTATGAC', check=True, strict=True, nn_table=DNA_NN3, dnac1=250.0, dnac2=250.0, selfcomp=False, Na=50, K=0, Tris=0, Mg=2.0, dNTPs=0, saltcorr=7)" }, "notes": "Owczarzy 2008, 0.22 <= R < 6" }, { "id": "T28", "input": { "sequence": "ATTAGTAAATTAGCT", "name": "d15-at", "length": 15, "gcPercent": 20.0, "selfComplementary": false, "oligoConcentration_nM": 250, "Na_mM": 50, "K_mM": 0, "Tris_mM": 0, "Mg_mM": 1.5, "dNTPs_mM": 0, "complement": "perfect complement (c_seq=None), no dangling ends, no mismatches" }, "expected": { "defaultModel": "primerInExcess", "primerInExcess": { "tm_C": 39.09070419891674, "concentrationTerm_nM": 250.0, "dnac1_nM": 250, "dnac2_nM": 0, "symmetryTerm": false }, "equalStrands": { "tm_C": 36.54420097523172, "concentrationTerm_nM": 62.5, "dnac1_nM": 125.0, "dnac2_nM": 125.0, "symmetryTerm": false, "x": 4 }, "saltRegime": { "R": 0.7745966692414833, "freeMg_mM": 1.5, "regimeId": "adjustedConstants", "regime": "0.22 <= R < 6: divalent formula with a, d and g adjusted for [Mon+]", "nearBoundary": false, "appliedCorrection": "owczarzy-2008", "note": "R, the regime and nearBoundary use free Mg2+; the regime decides the Tm where Owczarzy 2008 is applied (Mg2+ > 0).", "biopythonBranchVerified": true } }, "oracleIntermediates": { "primerInExcess": { "deltaH_kcal_per_mol": -104.59999999999954, "deltaS_cal_per_K_mol": -295.09999999999854, "tmWithoutSaltCorrection_C": 48.39342182830893 }, "equalStrands": { "deltaH_kcal_per_mol": -104.60000000000056, "deltaS_cal_per_K_mol": -295.1000000000018, "tmWithoutSaltCorrection_C": 45.693576155244216 }, "saltCorrection": 9.265752423218516e-05, "saltCorrectionApplies": "1/Tm(K) += corr", "derivation": "dH and dS recovered from two Biopython Tm_NN evaluations with saltcorr=0 at concentration terms k and 10k; they include initiation and, in equalStrands for a self-complementary oligo, the symmetry term." }, "method": { "nn": "santalucia-1998", "nnTable": "Biopython DNA_NN3", "salt": "owczarzy-2008", "saltText": "Owczarzy et al. 2008: Mg2+ and mixed-cation correction, regime by R = sqrt([Mg2+]) / [Mon+]", "concentration": "primerInExcess by default; equalStrands as the named alternative" }, "oracle": "Biopython Bio.SeqUtils.MeltingTemp.Tm_NN", "oracleVersion": "1.88", "recordedOn": "2026-10-06", "source": "pipeline/sequence-toolkit/reference.py (oligo-tm)", "call": { "primerInExcess": "Bio.SeqUtils.MeltingTemp.Tm_NN('ATTAGTAAATTAGCT', check=True, strict=True, nn_table=DNA_NN3, dnac1=250, dnac2=0, selfcomp=False, Na=50, K=0, Tris=0, Mg=1.5, dNTPs=0, saltcorr=7)", "equalStrands": "Bio.SeqUtils.MeltingTemp.Tm_NN('ATTAGTAAATTAGCT', check=True, strict=True, nn_table=DNA_NN3, dnac1=125.0, dnac2=125.0, selfcomp=False, Na=50, K=0, Tris=0, Mg=1.5, dNTPs=0, saltcorr=7)" }, "notes": "15-mer, 20% GC; 0.22 <= R < 6" }, { "id": "T29", "input": { "sequence": "ACGTTGACCAGGTATCAGCATTGCA", "name": "d25", "length": 25, "gcPercent": 48.0, "selfComplementary": false, "oligoConcentration_nM": 500, "Na_mM": 50, "K_mM": 0, "Tris_mM": 0, "Mg_mM": 2.5, "dNTPs_mM": 0, "complement": "perfect complement (c_seq=None), no dangling ends, no mismatches" }, "expected": { "defaultModel": "primerInExcess", "primerInExcess": { "tm_C": 70.597606435486, "concentrationTerm_nM": 500.0, "dnac1_nM": 500, "dnac2_nM": 0, "symmetryTerm": false }, "equalStrands": { "tm_C": 68.94158274807586, "concentrationTerm_nM": 125.0, "dnac1_nM": 250.0, "dnac2_nM": 250.0, "symmetryTerm": false, "x": 4 }, "saltRegime": { "R": 1.0, "freeMg_mM": 2.5, "regimeId": "adjustedConstants", "regime": "0.22 <= R < 6: divalent formula with a, d and g adjusted for [Mon+]", "nearBoundary": false, "appliedCorrection": "owczarzy-2008", "note": "R, the regime and nearBoundary use free Mg2+; the regime decides the Tm where Owczarzy 2008 is applied (Mg2+ > 0).", "biopythonBranchVerified": true } }, "oracleIntermediates": { "primerInExcess": { "deltaH_kcal_per_mol": -195.59999999999994, "deltaS_cal_per_K_mol": -526.2999999999995, "tmWithoutSaltCorrection_C": 79.20072329869487 }, "equalStrands": { "deltaH_kcal_per_mol": -195.5999999999963, "deltaS_cal_per_K_mol": -526.2999999999892, "tmWithoutSaltCorrection_C": 77.46098007547596 }, "saltCorrection": 7.102986220851876e-05, "saltCorrectionApplies": "1/Tm(K) += corr", "derivation": "dH and dS recovered from two Biopython Tm_NN evaluations with saltcorr=0 at concentration terms k and 10k; they include initiation and, in equalStrands for a self-complementary oligo, the symmetry term." }, "method": { "nn": "santalucia-1998", "nnTable": "Biopython DNA_NN3", "salt": "owczarzy-2008", "saltText": "Owczarzy et al. 2008: Mg2+ and mixed-cation correction, regime by R = sqrt([Mg2+]) / [Mon+]", "concentration": "primerInExcess by default; equalStrands as the named alternative" }, "oracle": "Biopython Bio.SeqUtils.MeltingTemp.Tm_NN", "oracleVersion": "1.88", "recordedOn": "2026-10-06", "source": "pipeline/sequence-toolkit/reference.py (oligo-tm)", "call": { "primerInExcess": "Bio.SeqUtils.MeltingTemp.Tm_NN('ACGTTGACCAGGTATCAGCATTGCA', check=True, strict=True, nn_table=DNA_NN3, dnac1=500, dnac2=0, selfcomp=False, Na=50, K=0, Tris=0, Mg=2.5, dNTPs=0, saltcorr=7)", "equalStrands": "Bio.SeqUtils.MeltingTemp.Tm_NN('ACGTTGACCAGGTATCAGCATTGCA', check=True, strict=True, nn_table=DNA_NN3, dnac1=250.0, dnac2=250.0, selfcomp=False, Na=50, K=0, Tris=0, Mg=2.5, dNTPs=0, saltcorr=7)" }, "notes": "0.22 <= R < 6" }, { "id": "T30", "input": { "sequence": "GCATCGGTACCTGATTGCAAGTCAGGTCAT", "name": "d30", "length": 30, "gcPercent": 50.0, "selfComplementary": false, "oligoConcentration_nM": 250, "Na_mM": 50, "K_mM": 0, "Tris_mM": 0, "Mg_mM": 3.0, "dNTPs_mM": 0, "complement": "perfect complement (c_seq=None), no dangling ends, no mismatches" }, "expected": { "defaultModel": "primerInExcess", "primerInExcess": { "tm_C": 72.84275095929524, "concentrationTerm_nM": 250.0, "dnac1_nM": 250, "dnac2_nM": 0, "symmetryTerm": false }, "equalStrands": { "tm_C": 71.45812918482812, "concentrationTerm_nM": 62.5, "dnac1_nM": 125.0, "dnac2_nM": 125.0, "symmetryTerm": false, "x": 4 }, "saltRegime": { "R": 1.0954451150103321, "freeMg_mM": 3.0, "regimeId": "adjustedConstants", "regime": "0.22 <= R < 6: divalent formula with a, d and g adjusted for [Mon+]", "nearBoundary": false, "appliedCorrection": "owczarzy-2008", "note": "R, the regime and nearBoundary use free Mg2+; the regime decides the Tm where Owczarzy 2008 is applied (Mg2+ > 0).", "biopythonBranchVerified": true } }, "oracleIntermediates": { "primerInExcess": { "deltaH_kcal_per_mol": -237.1999999999965, "deltaS_cal_per_K_mol": -638.89999999999, "tmWithoutSaltCorrection_C": 81.35288120324464 }, "equalStrands": { "deltaH_kcal_per_mol": -237.20000000000715, "deltaS_cal_per_K_mol": -638.9000000000202, "tmWithoutSaltCorrection_C": 79.89945177330497 }, "saltCorrection": 6.938241907282133e-05, "saltCorrectionApplies": "1/Tm(K) += corr", "derivation": "dH and dS recovered from two Biopython Tm_NN evaluations with saltcorr=0 at concentration terms k and 10k; they include initiation and, in equalStrands for a self-complementary oligo, the symmetry term." }, "method": { "nn": "santalucia-1998", "nnTable": "Biopython DNA_NN3", "salt": "owczarzy-2008", "saltText": "Owczarzy et al. 2008: Mg2+ and mixed-cation correction, regime by R = sqrt([Mg2+]) / [Mon+]", "concentration": "primerInExcess by default; equalStrands as the named alternative" }, "oracle": "Biopython Bio.SeqUtils.MeltingTemp.Tm_NN", "oracleVersion": "1.88", "recordedOn": "2026-10-06", "source": "pipeline/sequence-toolkit/reference.py (oligo-tm)", "call": { "primerInExcess": "Bio.SeqUtils.MeltingTemp.Tm_NN('GCATCGGTACCTGATTGCAAGTCAGGTCAT', check=True, strict=True, nn_table=DNA_NN3, dnac1=250, dnac2=0, selfcomp=False, Na=50, K=0, Tris=0, Mg=3.0, dNTPs=0, saltcorr=7)", "equalStrands": "Bio.SeqUtils.MeltingTemp.Tm_NN('GCATCGGTACCTGATTGCAAGTCAGGTCAT', check=True, strict=True, nn_table=DNA_NN3, dnac1=125.0, dnac2=125.0, selfcomp=False, Na=50, K=0, Tris=0, Mg=3.0, dNTPs=0, saltcorr=7)" }, "notes": "0.22 <= R < 6" }, { "id": "T31", "input": { "sequence": "GCGGCCGCATCCGGGCAGCGCCCAGAGCTCGCCGGTTGCG", "name": "d40-gc", "length": 40, "gcPercent": 80.0, "selfComplementary": false, "oligoConcentration_nM": 250, "Na_mM": 50, "K_mM": 0, "Tris_mM": 0, "Mg_mM": 1.5, "dNTPs_mM": 0, "complement": "perfect complement (c_seq=None), no dangling ends, no mismatches" }, "expected": { "defaultModel": "primerInExcess", "primerInExcess": { "tm_C": 91.54970840008644, "concentrationTerm_nM": 250.0, "dnac1_nM": 250, "dnac2_nM": 0, "symmetryTerm": false }, "equalStrands": { "tm_C": 90.49843505297594, "concentrationTerm_nM": 62.5, "dnac1_nM": 125.0, "dnac2_nM": 125.0, "symmetryTerm": false, "x": 4 }, "saltRegime": { "R": 0.7745966692414833, "freeMg_mM": 1.5, "regimeId": "adjustedConstants", "regime": "0.22 <= R < 6: divalent formula with a, d and g adjusted for [Mon+]", "nearBoundary": false, "appliedCorrection": "owczarzy-2008", "note": "R, the regime and nearBoundary use free Mg2+; the regime decides the Tm where Owczarzy 2008 is applied (Mg2+ > 0).", "biopythonBranchVerified": true } }, "oracleIntermediates": { "primerInExcess": { "deltaH_kcal_per_mol": -347.4999999999823, "deltaS_cal_per_K_mol": -901.0999999999523, "tmWithoutSaltCorrection_C": 99.9819298750503 }, "equalStrands": { "deltaH_kcal_per_mol": -347.49999999999375, "deltaS_cal_per_K_mol": -901.099999999983, "tmWithoutSaltCorrection_C": 98.88155489603344 }, "saltCorrection": 6.196467475589614e-05, "saltCorrectionApplies": "1/Tm(K) += corr", "derivation": "dH and dS recovered from two Biopython Tm_NN evaluations with saltcorr=0 at concentration terms k and 10k; they include initiation and, in equalStrands for a self-complementary oligo, the symmetry term." }, "method": { "nn": "santalucia-1998", "nnTable": "Biopython DNA_NN3", "salt": "owczarzy-2008", "saltText": "Owczarzy et al. 2008: Mg2+ and mixed-cation correction, regime by R = sqrt([Mg2+]) / [Mon+]", "concentration": "primerInExcess by default; equalStrands as the named alternative" }, "oracle": "Biopython Bio.SeqUtils.MeltingTemp.Tm_NN", "oracleVersion": "1.88", "recordedOn": "2026-10-06", "source": "pipeline/sequence-toolkit/reference.py (oligo-tm)", "call": { "primerInExcess": "Bio.SeqUtils.MeltingTemp.Tm_NN('GCGGCCGCATCCGGGCAGCGCCCAGAGCTCGCCGGTTGCG', check=True, strict=True, nn_table=DNA_NN3, dnac1=250, dnac2=0, selfcomp=False, Na=50, K=0, Tris=0, Mg=1.5, dNTPs=0, saltcorr=7)", "equalStrands": "Bio.SeqUtils.MeltingTemp.Tm_NN('GCGGCCGCATCCGGGCAGCGCCCAGAGCTCGCCGGTTGCG', check=True, strict=True, nn_table=DNA_NN3, dnac1=125.0, dnac2=125.0, selfcomp=False, Na=50, K=0, Tris=0, Mg=1.5, dNTPs=0, saltcorr=7)" }, "notes": "40-mer, 80% GC; 0.22 <= R < 6" }, { "id": "T32", "input": { "sequence": "CTGACGTAAGCTTACGTCAG", "name": "sc20", "length": 20, "gcPercent": 50.0, "selfComplementary": true, "oligoConcentration_nM": 500, "Na_mM": 50, "K_mM": 0, "Tris_mM": 0, "Mg_mM": 2.0, "dNTPs_mM": 0, "complement": "perfect complement (c_seq=None), no dangling ends, no mismatches" }, "expected": { "defaultModel": "primerInExcess", "primerInExcess": { "tm_C": 61.912553920010225, "concentrationTerm_nM": 500.0, "dnac1_nM": 500, "dnac2_nM": 0, "symmetryTerm": false }, "equalStrands": { "tm_C": 60.92818253390294, "concentrationTerm_nM": 500, "dnac1_nM": 500, "dnac2_nM": 0, "symmetryTerm": true, "x": 1 }, "saltRegime": { "R": 0.8944271909999159, "freeMg_mM": 2.0, "regimeId": "adjustedConstants", "regime": "0.22 <= R < 6: divalent formula with a, d and g adjusted for [Mon+]", "nearBoundary": false, "appliedCorrection": "owczarzy-2008", "note": "R, the regime and nearBoundary use free Mg2+; the regime decides the Tm where Owczarzy 2008 is applied (Mg2+ > 0).", "biopythonBranchVerified": true } }, "oracleIntermediates": { "primerInExcess": { "deltaH_kcal_per_mol": -159.20000000000093, "deltaS_cal_per_K_mol": -434.80000000000257, "tmWithoutSaltCorrection_C": 70.22822269225713 }, "equalStrands": { "deltaH_kcal_per_mol": -159.20000000000093, "deltaS_cal_per_K_mol": -436.20000000000255, "tmWithoutSaltCorrection_C": 69.19445959603553 }, "saltCorrection": 7.227673728490557e-05, "saltCorrectionApplies": "1/Tm(K) += corr", "derivation": "dH and dS recovered from two Biopython Tm_NN evaluations with saltcorr=0 at concentration terms k and 10k; they include initiation and, in equalStrands for a self-complementary oligo, the symmetry term." }, "method": { "nn": "santalucia-1998", "nnTable": "Biopython DNA_NN3", "salt": "owczarzy-2008", "saltText": "Owczarzy et al. 2008: Mg2+ and mixed-cation correction, regime by R = sqrt([Mg2+]) / [Mon+]", "concentration": "primerInExcess by default; equalStrands as the named alternative" }, "oracle": "Biopython Bio.SeqUtils.MeltingTemp.Tm_NN", "oracleVersion": "1.88", "recordedOn": "2026-10-06", "source": "pipeline/sequence-toolkit/reference.py (oligo-tm)", "call": { "primerInExcess": "Bio.SeqUtils.MeltingTemp.Tm_NN('CTGACGTAAGCTTACGTCAG', check=True, strict=True, nn_table=DNA_NN3, dnac1=500, dnac2=0, selfcomp=False, Na=50, K=0, Tris=0, Mg=2.0, dNTPs=0, saltcorr=7)", "equalStrands": "Bio.SeqUtils.MeltingTemp.Tm_NN('CTGACGTAAGCTTACGTCAG', check=True, strict=True, nn_table=DNA_NN3, dnac1=500, dnac2=0, selfcomp=True, Na=50, K=0, Tris=0, Mg=2.0, dNTPs=0, saltcorr=7)" }, "notes": "self-complementary; 0.22 <= R < 6" }, { "id": "T33", "input": { "sequence": "AGCTTGACCTGAAGTCAGCA", "name": "d20-mid", "length": 20, "gcPercent": 50.0, "selfComplementary": false, "oligoConcentration_nM": 500, "Na_mM": 50, "K_mM": 0, "Tris_mM": 0, "Mg_mM": 1.5, "dNTPs_mM": 0, "complement": "perfect complement (c_seq=None), no dangling ends, no mismatches" }, "expected": { "defaultModel": "primerInExcess", "primerInExcess": { "tm_C": 65.2021962988776, "concentrationTerm_nM": 500.0, "dnac1_nM": 500, "dnac2_nM": 0, "symmetryTerm": false }, "equalStrands": { "tm_C": 63.15623002208571, "concentrationTerm_nM": 125.0, "dnac1_nM": 250.0, "dnac2_nM": 250.0, "symmetryTerm": false, "x": 4 }, "saltRegime": { "R": 0.7745966692414833, "freeMg_mM": 1.5, "regimeId": "adjustedConstants", "regime": "0.22 <= R < 6: divalent formula with a, d and g adjusted for [Mon+]", "nearBoundary": false, "appliedCorrection": "owczarzy-2008", "note": "R, the regime and nearBoundary use free Mg2+; the regime decides the Tm where Owczarzy 2008 is applied (Mg2+ > 0).", "biopythonBranchVerified": true } }, "oracleIntermediates": { "primerInExcess": { "deltaH_kcal_per_mol": -153.19999999999942, "deltaS_cal_per_K_mol": -412.0999999999981, "tmWithoutSaltCorrection_C": 74.29846271791871 }, "equalStrands": { "deltaH_kcal_per_mol": -153.19999999999942, "deltaS_cal_per_K_mol": -412.09999999999803, "tmWithoutSaltCorrection_C": 72.14136079767991 }, "saltCorrection": 7.737555505382209e-05, "saltCorrectionApplies": "1/Tm(K) += corr", "derivation": "dH and dS recovered from two Biopython Tm_NN evaluations with saltcorr=0 at concentration terms k and 10k; they include initiation and, in equalStrands for a self-complementary oligo, the symmetry term." }, "method": { "nn": "santalucia-1998", "nnTable": "Biopython DNA_NN3", "salt": "owczarzy-2008", "saltText": "Owczarzy et al. 2008: Mg2+ and mixed-cation correction, regime by R = sqrt([Mg2+]) / [Mon+]", "concentration": "primerInExcess by default; equalStrands as the named alternative" }, "oracle": "Biopython Bio.SeqUtils.MeltingTemp.Tm_NN", "oracleVersion": "1.88", "recordedOn": "2026-10-06", "source": "pipeline/sequence-toolkit/reference.py (oligo-tm)", "call": { "primerInExcess": "Bio.SeqUtils.MeltingTemp.Tm_NN('AGCTTGACCTGAAGTCAGCA', check=True, strict=True, nn_table=DNA_NN3, dnac1=500, dnac2=0, selfcomp=False, Na=50, K=0, Tris=0, Mg=1.5, dNTPs=0, saltcorr=7)", "equalStrands": "Bio.SeqUtils.MeltingTemp.Tm_NN('AGCTTGACCTGAAGTCAGCA', check=True, strict=True, nn_table=DNA_NN3, dnac1=250.0, dnac2=250.0, selfcomp=False, Na=50, K=0, Tris=0, Mg=1.5, dNTPs=0, saltcorr=7)" }, "notes": "0.22 <= R < 6" }, { "id": "T34", "input": { "sequence": "TTGGCAGTCACCATGAGCCTAC", "name": "d22", "length": 22, "gcPercent": 54.54545454545455, "selfComplementary": false, "oligoConcentration_nM": 250, "Na_mM": 1000, "K_mM": 0, "Tris_mM": 0, "Mg_mM": 1.5, "dNTPs_mM": 0, "complement": "perfect complement (c_seq=None), no dangling ends, no mismatches" }, "expected": { "defaultModel": "primerInExcess", "primerInExcess": { "tm_C": 76.25316375543139, "concentrationTerm_nM": 250.0, "dnac1_nM": 250, "dnac2_nM": 0, "symmetryTerm": false }, "equalStrands": { "tm_C": 74.29759380638683, "concentrationTerm_nM": 62.5, "dnac1_nM": 125.0, "dnac2_nM": 125.0, "symmetryTerm": false, "x": 4 }, "saltRegime": { "R": 0.03872983346207417, "freeMg_mM": 1.5, "regimeId": "monovalent2004", "regime": "R < 0.22: monovalent (Owczarzy 2004) formula", "nearBoundary": false, "appliedCorrection": "owczarzy-2008", "note": "R, the regime and nearBoundary use free Mg2+; the regime decides the Tm where Owczarzy 2008 is applied (Mg2+ > 0).", "biopythonBranchVerified": true } }, "oracleIntermediates": { "primerInExcess": { "deltaH_kcal_per_mol": -170.99999999999756, "deltaS_cal_per_K_mol": -459.19999999999277, "tmWithoutSaltCorrection_C": 76.25316375543139 }, "equalStrands": { "deltaH_kcal_per_mol": -170.99999999999756, "deltaS_cal_per_K_mol": -459.19999999999277, "tmWithoutSaltCorrection_C": 74.29759380638683 }, "saltCorrection": 0.0, "saltCorrectionApplies": "1/Tm(K) += corr", "derivation": "dH and dS recovered from two Biopython Tm_NN evaluations with saltcorr=0 at concentration terms k and 10k; they include initiation and, in equalStrands for a self-complementary oligo, the symmetry term." }, "method": { "nn": "santalucia-1998", "nnTable": "Biopython DNA_NN3", "salt": "owczarzy-2008", "saltText": "Owczarzy et al. 2008: Mg2+ and mixed-cation correction, regime by R = sqrt([Mg2+]) / [Mon+]", "concentration": "primerInExcess by default; equalStrands as the named alternative" }, "oracle": "Biopython Bio.SeqUtils.MeltingTemp.Tm_NN", "oracleVersion": "1.88", "recordedOn": "2026-10-06", "source": "pipeline/sequence-toolkit/reference.py (oligo-tm)", "call": { "primerInExcess": "Bio.SeqUtils.MeltingTemp.Tm_NN('TTGGCAGTCACCATGAGCCTAC', check=True, strict=True, nn_table=DNA_NN3, dnac1=250, dnac2=0, selfcomp=False, Na=1000, K=0, Tris=0, Mg=1.5, dNTPs=0, saltcorr=7)", "equalStrands": "Bio.SeqUtils.MeltingTemp.Tm_NN('TTGGCAGTCACCATGAGCCTAC', check=True, strict=True, nn_table=DNA_NN3, dnac1=125.0, dnac2=125.0, selfcomp=False, Na=1000, K=0, Tris=0, Mg=1.5, dNTPs=0, saltcorr=7)" }, "notes": "R < 0.22: the monovalent (2004) formula applies" }, { "id": "T35", "input": { "sequence": "GACTCGGTACCAGTGCACTGGTACCGAGTC", "name": "sc30", "length": 30, "gcPercent": 60.0, "selfComplementary": true, "oligoConcentration_nM": 500, "Na_mM": 1000, "K_mM": 0, "Tris_mM": 0, "Mg_mM": 3.0, "dNTPs_mM": 0, "complement": "perfect complement (c_seq=None), no dangling ends, no mismatches" }, "expected": { "defaultModel": "primerInExcess", "primerInExcess": { "tm_C": 84.25156521551372, "concentrationTerm_nM": 500.0, "dnac1_nM": 500, "dnac2_nM": 0, "symmetryTerm": false }, "equalStrands": { "tm_C": 83.51533646421586, "concentrationTerm_nM": 500, "dnac1_nM": 500, "dnac2_nM": 0, "symmetryTerm": true, "x": 1 }, "saltRegime": { "R": 0.05477225575051661, "freeMg_mM": 3.0, "regimeId": "monovalent2004", "regime": "R < 0.22: monovalent (Owczarzy 2004) formula", "nearBoundary": false, "appliedCorrection": "owczarzy-2008", "note": "R, the regime and nearBoundary use free Mg2+; the regime decides the Tm where Owczarzy 2008 is applied (Mg2+ > 0).", "biopythonBranchVerified": true } }, "oracleIntermediates": { "primerInExcess": { "deltaH_kcal_per_mol": -242.4000000000065, "deltaS_cal_per_K_mol": -649.400000000018, "tmWithoutSaltCorrection_C": 84.25156521551372 }, "equalStrands": { "deltaH_kcal_per_mol": -242.40000000000092, "deltaS_cal_per_K_mol": -650.8000000000025, "tmWithoutSaltCorrection_C": 83.51533646421586 }, "saltCorrection": 0.0, "saltCorrectionApplies": "1/Tm(K) += corr", "derivation": "dH and dS recovered from two Biopython Tm_NN evaluations with saltcorr=0 at concentration terms k and 10k; they include initiation and, in equalStrands for a self-complementary oligo, the symmetry term." }, "method": { "nn": "santalucia-1998", "nnTable": "Biopython DNA_NN3", "salt": "owczarzy-2008", "saltText": "Owczarzy et al. 2008: Mg2+ and mixed-cation correction, regime by R = sqrt([Mg2+]) / [Mon+]", "concentration": "primerInExcess by default; equalStrands as the named alternative" }, "oracle": "Biopython Bio.SeqUtils.MeltingTemp.Tm_NN", "oracleVersion": "1.88", "recordedOn": "2026-10-06", "source": "pipeline/sequence-toolkit/reference.py (oligo-tm)", "call": { "primerInExcess": "Bio.SeqUtils.MeltingTemp.Tm_NN('GACTCGGTACCAGTGCACTGGTACCGAGTC', check=True, strict=True, nn_table=DNA_NN3, dnac1=500, dnac2=0, selfcomp=False, Na=1000, K=0, Tris=0, Mg=3.0, dNTPs=0, saltcorr=7)", "equalStrands": "Bio.SeqUtils.MeltingTemp.Tm_NN('GACTCGGTACCAGTGCACTGGTACCGAGTC', check=True, strict=True, nn_table=DNA_NN3, dnac1=500, dnac2=0, selfcomp=True, Na=1000, K=0, Tris=0, Mg=3.0, dNTPs=0, saltcorr=7)" }, "notes": "self-complementary; R < 0.22" }, { "id": "T36", "input": { "sequence": "TAGAAGGCACAGTCGAGG", "name": "BGH-reverse", "length": 18, "gcPercent": 55.55555555555556, "selfComplementary": false, "oligoConcentration_nM": 250, "Na_mM": 50, "K_mM": 0, "Tris_mM": 0, "Mg_mM": 0.11, "dNTPs_mM": 0, "complement": "perfect complement (c_seq=None), no dangling ends, no mismatches" }, "expected": { "defaultModel": "primerInExcess", "primerInExcess": { "tm_C": 54.888463442459, "concentrationTerm_nM": 250.0, "dnac1_nM": 250, "dnac2_nM": 0, "symmetryTerm": false }, "equalStrands": { "tm_C": 52.765188512699126, "concentrationTerm_nM": 62.5, "dnac1_nM": 125.0, "dnac2_nM": 125.0, "symmetryTerm": false, "x": 4 }, "saltRegime": { "R": 0.2097617696340303, "freeMg_mM": 0.11, "regimeId": "monovalent2004", "regime": "R < 0.22: monovalent (Owczarzy 2004) formula", "nearBoundary": true, "appliedCorrection": "owczarzy-2008", "note": "R, the regime and nearBoundary use free Mg2+; the regime decides the Tm where Owczarzy 2008 is applied (Mg2+ > 0).", "biopythonBranchVerified": true } }, "oracleIntermediates": { "primerInExcess": { "deltaH_kcal_per_mol": -138.6999999999995, "deltaS_cal_per_K_mol": -374.3999999999984, "tmWithoutSaltCorrection_C": 69.65263928600501 }, "equalStrands": { "deltaH_kcal_per_mol": -138.6999999999995, "deltaS_cal_per_K_mol": -374.39999999999833, "tmWithoutSaltCorrection_C": 67.33461218617083 }, "saltCorrection": 0.00013129261038758773, "saltCorrectionApplies": "1/Tm(K) += corr", "derivation": "dH and dS recovered from two Biopython Tm_NN evaluations with saltcorr=0 at concentration terms k and 10k; they include initiation and, in equalStrands for a self-complementary oligo, the symmetry term." }, "method": { "nn": "santalucia-1998", "nnTable": "Biopython DNA_NN3", "salt": "owczarzy-2008", "saltText": "Owczarzy et al. 2008: Mg2+ and mixed-cation correction, regime by R = sqrt([Mg2+]) / [Mon+]", "concentration": "primerInExcess by default; equalStrands as the named alternative" }, "oracle": "Biopython Bio.SeqUtils.MeltingTemp.Tm_NN", "oracleVersion": "1.88", "recordedOn": "2026-10-06", "source": "pipeline/sequence-toolkit/reference.py (oligo-tm)", "call": { "primerInExcess": "Bio.SeqUtils.MeltingTemp.Tm_NN('TAGAAGGCACAGTCGAGG', check=True, strict=True, nn_table=DNA_NN3, dnac1=250, dnac2=0, selfcomp=False, Na=50, K=0, Tris=0, Mg=0.11, dNTPs=0, saltcorr=7)", "equalStrands": "Bio.SeqUtils.MeltingTemp.Tm_NN('TAGAAGGCACAGTCGAGG', check=True, strict=True, nn_table=DNA_NN3, dnac1=125.0, dnac2=125.0, selfcomp=False, Na=50, K=0, Tris=0, Mg=0.11, dNTPs=0, saltcorr=7)" }, "notes": "regime boundary: R just below 0.22 (Mg2+ outside 1.5-3 mM on purpose)" }, { "id": "T37", "input": { "sequence": "TAGAAGGCACAGTCGAGG", "name": "BGH-reverse", "length": 18, "gcPercent": 55.55555555555556, "selfComplementary": false, "oligoConcentration_nM": 250, "Na_mM": 50, "K_mM": 0, "Tris_mM": 0, "Mg_mM": 0.133, "dNTPs_mM": 0, "complement": "perfect complement (c_seq=None), no dangling ends, no mismatches" }, "expected": { "defaultModel": "primerInExcess", "primerInExcess": { "tm_C": 54.14963240617908, "concentrationTerm_nM": 250.0, "dnac1_nM": 250, "dnac2_nM": 0, "symmetryTerm": false }, "equalStrands": { "tm_C": 52.03588026595162, "concentrationTerm_nM": 62.5, "dnac1_nM": 125.0, "dnac2_nM": 125.0, "symmetryTerm": false, "x": 4 }, "saltRegime": { "R": 0.23065125189341593, "freeMg_mM": 0.133, "regimeId": "adjustedConstants", "regime": "0.22 <= R < 6: divalent formula with a, d and g adjusted for [Mon+]", "nearBoundary": true, "appliedCorrection": "owczarzy-2008", "note": "R, the regime and nearBoundary use free Mg2+; the regime decides the Tm where Owczarzy 2008 is applied (Mg2+ > 0).", "biopythonBranchVerified": true } }, "oracleIntermediates": { "primerInExcess": { "deltaH_kcal_per_mol": -138.6999999999995, "deltaS_cal_per_K_mol": -374.3999999999984, "tmWithoutSaltCorrection_C": 69.65263928600501 }, "equalStrands": { "deltaH_kcal_per_mol": -138.6999999999995, "deltaS_cal_per_K_mol": -374.39999999999833, "tmWithoutSaltCorrection_C": 67.33461218617083 }, "saltCorrection": 0.0001381739793480812, "saltCorrectionApplies": "1/Tm(K) += corr", "derivation": "dH and dS recovered from two Biopython Tm_NN evaluations with saltcorr=0 at concentration terms k and 10k; they include initiation and, in equalStrands for a self-complementary oligo, the symmetry term." }, "method": { "nn": "santalucia-1998", "nnTable": "Biopython DNA_NN3", "salt": "owczarzy-2008", "saltText": "Owczarzy et al. 2008: Mg2+ and mixed-cation correction, regime by R = sqrt([Mg2+]) / [Mon+]", "concentration": "primerInExcess by default; equalStrands as the named alternative" }, "oracle": "Biopython Bio.SeqUtils.MeltingTemp.Tm_NN", "oracleVersion": "1.88", "recordedOn": "2026-10-06", "source": "pipeline/sequence-toolkit/reference.py (oligo-tm)", "call": { "primerInExcess": "Bio.SeqUtils.MeltingTemp.Tm_NN('TAGAAGGCACAGTCGAGG', check=True, strict=True, nn_table=DNA_NN3, dnac1=250, dnac2=0, selfcomp=False, Na=50, K=0, Tris=0, Mg=0.133, dNTPs=0, saltcorr=7)", "equalStrands": "Bio.SeqUtils.MeltingTemp.Tm_NN('TAGAAGGCACAGTCGAGG', check=True, strict=True, nn_table=DNA_NN3, dnac1=125.0, dnac2=125.0, selfcomp=False, Na=50, K=0, Tris=0, Mg=0.133, dNTPs=0, saltcorr=7)" }, "notes": "regime boundary: R just above 0.22 (Mg2+ outside 1.5-3 mM on purpose)" }, { "id": "T38", "input": { "sequence": "GGGCTGGCAAGCCACGTTTGGTG", "name": "pGEX-5", "length": 23, "gcPercent": 65.21739130434783, "selfComplementary": false, "oligoConcentration_nM": 250, "Na_mM": 9.3, "K_mM": 0, "Tris_mM": 0, "Mg_mM": 3.0, "dNTPs_mM": 0, "complement": "perfect complement (c_seq=None), no dangling ends, no mismatches" }, "expected": { "defaultModel": "primerInExcess", "primerInExcess": { "tm_C": 74.4887207892587, "concentrationTerm_nM": 250.0, "dnac1_nM": 250, "dnac2_nM": 0, "symmetryTerm": false }, "equalStrands": { "tm_C": 72.7157070602035, "concentrationTerm_nM": 62.5, "dnac1_nM": 125.0, "dnac2_nM": 125.0, "symmetryTerm": false, "x": 4 }, "saltRegime": { "R": 5.889489865646947, "freeMg_mM": 3.0, "regimeId": "adjustedConstants", "regime": "0.22 <= R < 6: divalent formula with a, d and g adjusted for [Mon+]", "nearBoundary": true, "appliedCorrection": "owczarzy-2008", "note": "R, the regime and nearBoundary use free Mg2+; the regime decides the Tm where Owczarzy 2008 is applied (Mg2+ > 0).", "biopythonBranchVerified": true } }, "oracleIntermediates": { "primerInExcess": { "deltaH_kcal_per_mol": -186.79999999999757, "deltaS_cal_per_K_mol": -494.79999999999296, "tmWithoutSaltCorrection_C": 82.65546669586064 }, "equalStrands": { "deltaH_kcal_per_mol": -186.80000000000086, "deltaS_cal_per_K_mol": -494.8000000000022, "tmWithoutSaltCorrection_C": 80.79839353315032 }, "saltCorrection": 6.60249808507799e-05, "saltCorrectionApplies": "1/Tm(K) += corr", "derivation": "dH and dS recovered from two Biopython Tm_NN evaluations with saltcorr=0 at concentration terms k and 10k; they include initiation and, in equalStrands for a self-complementary oligo, the symmetry term." }, "method": { "nn": "santalucia-1998", "nnTable": "Biopython DNA_NN3", "salt": "owczarzy-2008", "saltText": "Owczarzy et al. 2008: Mg2+ and mixed-cation correction, regime by R = sqrt([Mg2+]) / [Mon+]", "concentration": "primerInExcess by default; equalStrands as the named alternative" }, "oracle": "Biopython Bio.SeqUtils.MeltingTemp.Tm_NN", "oracleVersion": "1.88", "recordedOn": "2026-10-06", "source": "pipeline/sequence-toolkit/reference.py (oligo-tm)", "call": { "primerInExcess": "Bio.SeqUtils.MeltingTemp.Tm_NN('GGGCTGGCAAGCCACGTTTGGTG', check=True, strict=True, nn_table=DNA_NN3, dnac1=250, dnac2=0, selfcomp=False, Na=9.3, K=0, Tris=0, Mg=3.0, dNTPs=0, saltcorr=7)", "equalStrands": "Bio.SeqUtils.MeltingTemp.Tm_NN('GGGCTGGCAAGCCACGTTTGGTG', check=True, strict=True, nn_table=DNA_NN3, dnac1=125.0, dnac2=125.0, selfcomp=False, Na=9.3, K=0, Tris=0, Mg=3.0, dNTPs=0, saltcorr=7)" }, "notes": "regime boundary: R just below 6 (Na+ outside 50 mM/1 M on purpose)" }, { "id": "T39", "input": { "sequence": "GGGCTGGCAAGCCACGTTTGGTG", "name": "pGEX-5", "length": 23, "gcPercent": 65.21739130434783, "selfComplementary": false, "oligoConcentration_nM": 250, "Na_mM": 8.9, "K_mM": 0, "Tris_mM": 0, "Mg_mM": 3.0, "dNTPs_mM": 0, "complement": "perfect complement (c_seq=None), no dangling ends, no mismatches" }, "expected": { "defaultModel": "primerInExcess", "primerInExcess": { "tm_C": 74.90123380080132, "concentrationTerm_nM": 250.0, "dnac1_nM": 250, "dnac2_nM": 0, "symmetryTerm": false }, "equalStrands": { "tm_C": 73.12402056458905, "concentrationTerm_nM": 62.5, "dnac1_nM": 125.0, "dnac2_nM": 125.0, "symmetryTerm": false, "x": 4 }, "saltRegime": { "R": 6.154186039383889, "freeMg_mM": 3.0, "regimeId": "originalConstants", "regime": "R >= 6: divalent formula, original constants", "nearBoundary": true, "appliedCorrection": "owczarzy-2008", "note": "R, the regime and nearBoundary use free Mg2+; the regime decides the Tm where Owczarzy 2008 is applied (Mg2+ > 0).", "biopythonBranchVerified": true } }, "oracleIntermediates": { "primerInExcess": { "deltaH_kcal_per_mol": -186.79999999999757, "deltaS_cal_per_K_mol": -494.79999999999296, "tmWithoutSaltCorrection_C": 82.65546669586064 }, "equalStrands": { "deltaH_kcal_per_mol": -186.80000000000086, "deltaS_cal_per_K_mol": -494.8000000000022, "tmWithoutSaltCorrection_C": 80.79839353315032 }, "saltCorrection": 6.261567211820194e-05, "saltCorrectionApplies": "1/Tm(K) += corr", "derivation": "dH and dS recovered from two Biopython Tm_NN evaluations with saltcorr=0 at concentration terms k and 10k; they include initiation and, in equalStrands for a self-complementary oligo, the symmetry term." }, "method": { "nn": "santalucia-1998", "nnTable": "Biopython DNA_NN3", "salt": "owczarzy-2008", "saltText": "Owczarzy et al. 2008: Mg2+ and mixed-cation correction, regime by R = sqrt([Mg2+]) / [Mon+]", "concentration": "primerInExcess by default; equalStrands as the named alternative" }, "oracle": "Biopython Bio.SeqUtils.MeltingTemp.Tm_NN", "oracleVersion": "1.88", "recordedOn": "2026-10-06", "source": "pipeline/sequence-toolkit/reference.py (oligo-tm)", "call": { "primerInExcess": "Bio.SeqUtils.MeltingTemp.Tm_NN('GGGCTGGCAAGCCACGTTTGGTG', check=True, strict=True, nn_table=DNA_NN3, dnac1=250, dnac2=0, selfcomp=False, Na=8.9, K=0, Tris=0, Mg=3.0, dNTPs=0, saltcorr=7)", "equalStrands": "Bio.SeqUtils.MeltingTemp.Tm_NN('GGGCTGGCAAGCCACGTTTGGTG', check=True, strict=True, nn_table=DNA_NN3, dnac1=125.0, dnac2=125.0, selfcomp=False, Na=8.9, K=0, Tris=0, Mg=3.0, dNTPs=0, saltcorr=7)" }, "notes": "regime boundary: R just above 6 (Na+ outside 50 mM/1 M on purpose)" }, { "id": "T40", "input": { "sequence": "ATTAACCCTCACTAAAGGGA", "name": "T3", "length": 20, "gcPercent": 40.0, "selfComplementary": false, "oligoConcentration_nM": 250, "Na_mM": 0, "K_mM": 0, "Tris_mM": 0, "Mg_mM": 2.0, "dNTPs_mM": 0, "complement": "perfect complement (c_seq=None), no dangling ends, no mismatches" }, "expected": { "defaultModel": "primerInExcess", "primerInExcess": { "tm_C": 58.953003564420555, "concentrationTerm_nM": 250.0, "dnac1_nM": 250, "dnac2_nM": 0, "symmetryTerm": false }, "equalStrands": { "tm_C": 56.88085390624377, "concentrationTerm_nM": 62.5, "dnac1_nM": 125.0, "dnac2_nM": 125.0, "symmetryTerm": false, "x": 4 }, "saltRegime": { "R": null, "freeMg_mM": 2.0, "regimeId": "originalConstants", "regime": "no monovalent ions: R undefined; divalent formula with the original constants", "nearBoundary": false, "appliedCorrection": "owczarzy-2008", "note": "R, the regime and nearBoundary use free Mg2+; the regime decides the Tm where Owczarzy 2008 is applied (Mg2+ > 0).", "biopythonBranchVerified": true } }, "oracleIntermediates": { "primerInExcess": { "deltaH_kcal_per_mol": -145.69999999999814, "deltaS_cal_per_K_mol": -398.09999999999445, "tmWithoutSaltCorrection_C": 67.02736066079353 }, "equalStrands": { "deltaH_kcal_per_mol": -145.70000000000016, "deltaS_cal_per_K_mol": -398.1000000000003, "tmWithoutSaltCorrection_C": 64.85355633288106 }, "saltCorrection": 7.147098079124461e-05, "saltCorrectionApplies": "1/Tm(K) += corr", "derivation": "dH and dS recovered from two Biopython Tm_NN evaluations with saltcorr=0 at concentration terms k and 10k; they include initiation and, in equalStrands for a self-complementary oligo, the symmetry term." }, "method": { "nn": "santalucia-1998", "nnTable": "Biopython DNA_NN3", "salt": "owczarzy-2008", "saltText": "Owczarzy et al. 2008: Mg2+ and mixed-cation correction, regime by R = sqrt([Mg2+]) / [Mon+]", "concentration": "primerInExcess by default; equalStrands as the named alternative" }, "oracle": "Biopython Bio.SeqUtils.MeltingTemp.Tm_NN", "oracleVersion": "1.88", "recordedOn": "2026-10-06", "source": "pipeline/sequence-toolkit/reference.py (oligo-tm)", "call": { "primerInExcess": "Bio.SeqUtils.MeltingTemp.Tm_NN('ATTAACCCTCACTAAAGGGA', check=True, strict=True, nn_table=DNA_NN3, dnac1=250, dnac2=0, selfcomp=False, Na=0, K=0, Tris=0, Mg=2.0, dNTPs=0, saltcorr=7)", "equalStrands": "Bio.SeqUtils.MeltingTemp.Tm_NN('ATTAACCCTCACTAAAGGGA', check=True, strict=True, nn_table=DNA_NN3, dnac1=125.0, dnac2=125.0, selfcomp=False, Na=0, K=0, Tris=0, Mg=2.0, dNTPs=0, saltcorr=7)" }, "notes": "no monovalent ions: R undefined, divalent formula with the original constants" }, { "id": "T41", "input": { "sequence": "TAATACGACTCACTATAGGG", "name": "T7-promoter", "length": 20, "gcPercent": 40.0, "selfComplementary": false, "oligoConcentration_nM": 250, "Na_mM": 50, "K_mM": 0, "Tris_mM": 0, "Mg_mM": 1.5, "dNTPs_mM": 0.8, "complement": "perfect complement (c_seq=None), no dangling ends, no mismatches" }, "expected": { "defaultModel": "primerInExcess", "primerInExcess": { "tm_C": 53.17372495090177, "concentrationTerm_nM": 250.0, "dnac1_nM": 250, "dnac2_nM": 0, "symmetryTerm": false }, "equalStrands": { "tm_C": 51.21428449422842, "concentrationTerm_nM": 62.5, "dnac1_nM": 125.0, "dnac2_nM": 125.0, "symmetryTerm": false, "x": 4 }, "saltRegime": { "R": 0.5421143124076605, "freeMg_mM": 0.7347198192930765, "regimeId": "adjustedConstants", "regime": "0.22 <= R < 6: divalent formula with a, d and g adjusted for [Mon+]", "nearBoundary": false, "appliedCorrection": "owczarzy-2008", "note": "R, the regime and nearBoundary use free Mg2+; the regime decides the Tm where Owczarzy 2008 is applied (Mg2+ > 0).", "biopythonBranchVerified": true } }, "oracleIntermediates": { "primerInExcess": { "deltaH_kcal_per_mol": -148.79999999999623, "deltaS_cal_per_K_mol": -411.19999999998885, "tmWithoutSaltCorrection_C": 63.95462611136554 }, "equalStrands": { "deltaH_kcal_per_mol": -148.80000000000044, "deltaS_cal_per_K_mol": -411.20000000000124, "tmWithoutSaltCorrection_C": 61.863991910319044 }, "saltCorrection": 9.80035262499388e-05, "saltCorrectionApplies": "1/Tm(K) += corr", "derivation": "dH and dS recovered from two Biopython Tm_NN evaluations with saltcorr=0 at concentration terms k and 10k; they include initiation and, in equalStrands for a self-complementary oligo, the symmetry term." }, "method": { "nn": "santalucia-1998", "nnTable": "Biopython DNA_NN3", "salt": "owczarzy-2008", "saltText": "Owczarzy et al. 2008: Mg2+ and mixed-cation correction, regime by R = sqrt([Mg2+]) / [Mon+]", "concentration": "primerInExcess by default; equalStrands as the named alternative" }, "oracle": "Biopython Bio.SeqUtils.MeltingTemp.Tm_NN", "oracleVersion": "1.88", "recordedOn": "2026-10-06", "source": "pipeline/sequence-toolkit/reference.py (oligo-tm)", "call": { "primerInExcess": "Bio.SeqUtils.MeltingTemp.Tm_NN('TAATACGACTCACTATAGGG', check=True, strict=True, nn_table=DNA_NN3, dnac1=250, dnac2=0, selfcomp=False, Na=50, K=0, Tris=0, Mg=1.5, dNTPs=0.8, saltcorr=7)", "equalStrands": "Bio.SeqUtils.MeltingTemp.Tm_NN('TAATACGACTCACTATAGGG', check=True, strict=True, nn_table=DNA_NN3, dnac1=125.0, dnac2=125.0, selfcomp=False, Na=50, K=0, Tris=0, Mg=1.5, dNTPs=0.8, saltcorr=7)" }, "notes": "dNTPs: a typical PCR (0.2 mM each dNTP); free Mg2+ 0.73 mM" }, { "id": "T42", "input": { "sequence": "GTAAAACGACGGCCAGT", "name": "M13F-20", "length": 17, "gcPercent": 52.94117647058823, "selfComplementary": false, "oligoConcentration_nM": 500, "Na_mM": 50, "K_mM": 0, "Tris_mM": 0, "Mg_mM": 3.0, "dNTPs_mM": 0.8, "complement": "perfect complement (c_seq=None), no dangling ends, no mismatches" }, "expected": { "defaultModel": "primerInExcess", "primerInExcess": { "tm_C": 61.985715325610045, "concentrationTerm_nM": 500.0, "dnac1_nM": 500, "dnac2_nM": 0, "symmetryTerm": false }, "equalStrands": { "tm_C": 59.68587486898616, "concentrationTerm_nM": 125.0, "dnac1_nM": 250.0, "dnac2_nM": 250.0, "symmetryTerm": false, "x": 4 }, "saltRegime": { "R": 0.9406119570751826, "freeMg_mM": 2.2118771344820134, "regimeId": "adjustedConstants", "regime": "0.22 <= R < 6: divalent formula with a, d and g adjusted for [Mon+]", "nearBoundary": false, "appliedCorrection": "owczarzy-2008", "note": "R, the regime and nearBoundary use free Mg2+; the regime decides the Tm where Owczarzy 2008 is applied (Mg2+ > 0).", "biopythonBranchVerified": true } }, "oracleIntermediates": { "primerInExcess": { "deltaH_kcal_per_mol": -133.5999999999997, "deltaS_cal_per_K_mol": -360.6999999999991, "tmWithoutSaltCorrection_C": 69.82857640859629 }, "equalStrands": { "deltaH_kcal_per_mol": -133.5999999999997, "deltaS_cal_per_K_mol": -360.6999999999991, "tmWithoutSaltCorrection_C": 67.42022126032538 }, "saltCorrection": 6.823179809265988e-05, "saltCorrectionApplies": "1/Tm(K) += corr", "derivation": "dH and dS recovered from two Biopython Tm_NN evaluations with saltcorr=0 at concentration terms k and 10k; they include initiation and, in equalStrands for a self-complementary oligo, the symmetry term." }, "method": { "nn": "santalucia-1998", "nnTable": "Biopython DNA_NN3", "salt": "owczarzy-2008", "saltText": "Owczarzy et al. 2008: Mg2+ and mixed-cation correction, regime by R = sqrt([Mg2+]) / [Mon+]", "concentration": "primerInExcess by default; equalStrands as the named alternative" }, "oracle": "Biopython Bio.SeqUtils.MeltingTemp.Tm_NN", "oracleVersion": "1.88", "recordedOn": "2026-10-06", "source": "pipeline/sequence-toolkit/reference.py (oligo-tm)", "call": { "primerInExcess": "Bio.SeqUtils.MeltingTemp.Tm_NN('GTAAAACGACGGCCAGT', check=True, strict=True, nn_table=DNA_NN3, dnac1=500, dnac2=0, selfcomp=False, Na=50, K=0, Tris=0, Mg=3.0, dNTPs=0.8, saltcorr=7)", "equalStrands": "Bio.SeqUtils.MeltingTemp.Tm_NN('GTAAAACGACGGCCAGT', check=True, strict=True, nn_table=DNA_NN3, dnac1=250.0, dnac2=250.0, selfcomp=False, Na=50, K=0, Tris=0, Mg=3.0, dNTPs=0.8, saltcorr=7)" }, "notes": "dNTPs; free Mg2+ 2.21 mM" }, { "id": "T43", "input": { "sequence": "ACGTTGACCAGGTATCAGCATTGCA", "name": "d25", "length": 25, "gcPercent": 48.0, "selfComplementary": false, "oligoConcentration_nM": 250, "Na_mM": 50, "K_mM": 0, "Tris_mM": 0, "Mg_mM": 1.0, "dNTPs_mM": 1.2, "complement": "perfect complement (c_seq=None), no dangling ends, no mismatches" }, "expected": { "defaultModel": "primerInExcess", "primerInExcess": { "tm_C": 61.73211769660634, "concentrationTerm_nM": 250.0, "dnac1_nM": 250, "dnac2_nM": 0, "symmetryTerm": false }, "equalStrands": { "tm_C": 60.16021717775203, "concentrationTerm_nM": 62.5, "dnac1_nM": 125.0, "dnac2_nM": 125.0, "symmetryTerm": false, "x": 4 }, "saltRegime": { "R": 0.19999999999999998, "freeMg_mM": 0.1, "regimeId": "monovalent2004", "regime": "R < 0.22: monovalent (Owczarzy 2004) formula", "nearBoundary": true, "appliedCorrection": "owczarzy-2008", "note": "R, the regime and nearBoundary use free Mg2+; the regime decides the Tm where Owczarzy 2008 is applied (Mg2+ > 0).", "biopythonBranchVerified": true } }, "oracleIntermediates": { "primerInExcess": { "deltaH_kcal_per_mol": -195.5999999999963, "deltaS_cal_per_K_mol": -526.2999999999892, "tmWithoutSaltCorrection_C": 78.32869886249466 }, "equalStrands": { "deltaH_kcal_per_mol": -195.59999999999994, "deltaS_cal_per_K_mol": -526.2999999999995, "tmWithoutSaltCorrection_C": 76.59753512724564 }, "saltCorrection": 0.00014100277726360072, "saltCorrectionApplies": "1/Tm(K) += corr", "derivation": "dH and dS recovered from two Biopython Tm_NN evaluations with saltcorr=0 at concentration terms k and 10k; they include initiation and, in equalStrands for a self-complementary oligo, the symmetry term." }, "method": { "nn": "santalucia-1998", "nnTable": "Biopython DNA_NN3", "salt": "owczarzy-2008", "saltText": "Owczarzy et al. 2008: Mg2+ and mixed-cation correction, regime by R = sqrt([Mg2+]) / [Mon+]", "concentration": "primerInExcess by default; equalStrands as the named alternative" }, "oracle": "Biopython Bio.SeqUtils.MeltingTemp.Tm_NN", "oracleVersion": "1.88", "recordedOn": "2026-10-06", "source": "pipeline/sequence-toolkit/reference.py (oligo-tm)", "call": { "primerInExcess": "Bio.SeqUtils.MeltingTemp.Tm_NN('ACGTTGACCAGGTATCAGCATTGCA', check=True, strict=True, nn_table=DNA_NN3, dnac1=250, dnac2=0, selfcomp=False, Na=50, K=0, Tris=0, Mg=1.0, dNTPs=1.2, saltcorr=7)", "equalStrands": "Bio.SeqUtils.MeltingTemp.Tm_NN('ACGTTGACCAGGTATCAGCATTGCA', check=True, strict=True, nn_table=DNA_NN3, dnac1=125.0, dnac2=125.0, selfcomp=False, Na=50, K=0, Tris=0, Mg=1.0, dNTPs=1.2, saltcorr=7)" }, "notes": "dNTPs exceed Mg2+: free Mg2+ 0.10 mM puts R at 0.200 (2004 formula), where total Mg2+ would give 0.632" }, { "id": "T44", "input": { "sequence": "ATGCGTACCATGAGTCAGTTGACCAGTACGCATTGCAAGT", "name": "d40-mid", "length": 40, "gcPercent": 47.5, "selfComplementary": false, "oligoConcentration_nM": 250, "Na_mM": 1000, "K_mM": 0, "Tris_mM": 0, "Mg_mM": 2.5, "dNTPs_mM": 0.8, "complement": "perfect complement (c_seq=None), no dangling ends, no mismatches" }, "expected": { "defaultModel": "primerInExcess", "primerInExcess": { "tm_C": 86.1719028578409, "concentrationTerm_nM": 250.0, "dnac1_nM": 250, "dnac2_nM": 0, "symmetryTerm": false }, "equalStrands": { "tm_C": 85.06805568306874, "concentrationTerm_nM": 62.5, "dnac1_nM": 125.0, "dnac2_nM": 125.0, "symmetryTerm": false, "x": 4 }, "saltRegime": { "R": 0.04141558205580999, "freeMg_mM": 1.7152504370215302, "regimeId": "monovalent2004", "regime": "R < 0.22: monovalent (Owczarzy 2004) formula", "nearBoundary": false, "appliedCorrection": "owczarzy-2008", "note": "R, the regime and nearBoundary use free Mg2+; the regime decides the Tm where Owczarzy 2008 is applied (Mg2+ > 0).", "biopythonBranchVerified": true } }, "oracleIntermediates": { "primerInExcess": { "deltaH_kcal_per_mol": -321.1999999999958, "deltaS_cal_per_K_mol": -863.6999999999883, "tmWithoutSaltCorrection_C": 86.1719028578409 }, "equalStrands": { "deltaH_kcal_per_mol": -321.20000000001534, "deltaS_cal_per_K_mol": -863.7000000000426, "tmWithoutSaltCorrection_C": 85.06805568306874 }, "saltCorrection": 0.0, "saltCorrectionApplies": "1/Tm(K) += corr", "derivation": "dH and dS recovered from two Biopython Tm_NN evaluations with saltcorr=0 at concentration terms k and 10k; they include initiation and, in equalStrands for a self-complementary oligo, the symmetry term." }, "method": { "nn": "santalucia-1998", "nnTable": "Biopython DNA_NN3", "salt": "owczarzy-2008", "saltText": "Owczarzy et al. 2008: Mg2+ and mixed-cation correction, regime by R = sqrt([Mg2+]) / [Mon+]", "concentration": "primerInExcess by default; equalStrands as the named alternative" }, "oracle": "Biopython Bio.SeqUtils.MeltingTemp.Tm_NN", "oracleVersion": "1.88", "recordedOn": "2026-10-06", "source": "pipeline/sequence-toolkit/reference.py (oligo-tm)", "call": { "primerInExcess": "Bio.SeqUtils.MeltingTemp.Tm_NN('ATGCGTACCATGAGTCAGTTGACCAGTACGCATTGCAAGT', check=True, strict=True, nn_table=DNA_NN3, dnac1=250, dnac2=0, selfcomp=False, Na=1000, K=0, Tris=0, Mg=2.5, dNTPs=0.8, saltcorr=7)", "equalStrands": "Bio.SeqUtils.MeltingTemp.Tm_NN('ATGCGTACCATGAGTCAGTTGACCAGTACGCATTGCAAGT', check=True, strict=True, nn_table=DNA_NN3, dnac1=125.0, dnac2=125.0, selfcomp=False, Na=1000, K=0, Tris=0, Mg=2.5, dNTPs=0.8, saltcorr=7)" }, "notes": "dNTPs at 1 M Na+: R < 0.22" }, { "id": "T45", "input": { "sequence": "GGGCTGGCAAGCCACGTTTGGTG", "name": "pGEX-5", "length": 23, "gcPercent": 65.21739130434783, "selfComplementary": false, "oligoConcentration_nM": 250, "Na_mM": 9, "K_mM": 0, "Tris_mM": 0, "Mg_mM": 3.0, "dNTPs_mM": 0.2, "complement": "perfect complement (c_seq=None), no dangling ends, no mismatches" }, "expected": { "defaultModel": "primerInExcess", "primerInExcess": { "tm_C": 74.40219484124566, "concentrationTerm_nM": 250.0, "dnac1_nM": 250, "dnac2_nM": 0, "symmetryTerm": false }, "equalStrands": { "tm_C": 72.6300613454602, "concentrationTerm_nM": 62.5, "dnac1_nM": 125.0, "dnac2_nM": 125.0, "symmetryTerm": false, "x": 4 }, "saltRegime": { "R": 5.881915147942838, "freeMg_mM": 2.802350990415553, "regimeId": "adjustedConstants", "regime": "0.22 <= R < 6: divalent formula with a, d and g adjusted for [Mon+]", "nearBoundary": true, "appliedCorrection": "owczarzy-2008", "note": "R, the regime and nearBoundary use free Mg2+; the regime decides the Tm where Owczarzy 2008 is applied (Mg2+ > 0).", "biopythonBranchVerified": true } }, "oracleIntermediates": { "primerInExcess": { "deltaH_kcal_per_mol": -186.79999999999757, "deltaS_cal_per_K_mol": -494.79999999999296, "tmWithoutSaltCorrection_C": 82.65546669586064 }, "equalStrands": { "deltaH_kcal_per_mol": -186.80000000000086, "deltaS_cal_per_K_mol": -494.8000000000022, "tmWithoutSaltCorrection_C": 80.79839353315032 }, "saltCorrection": 6.674112127244555e-05, "saltCorrectionApplies": "1/Tm(K) += corr", "derivation": "dH and dS recovered from two Biopython Tm_NN evaluations with saltcorr=0 at concentration terms k and 10k; they include initiation and, in equalStrands for a self-complementary oligo, the symmetry term." }, "method": { "nn": "santalucia-1998", "nnTable": "Biopython DNA_NN3", "salt": "owczarzy-2008", "saltText": "Owczarzy et al. 2008: Mg2+ and mixed-cation correction, regime by R = sqrt([Mg2+]) / [Mon+]", "concentration": "primerInExcess by default; equalStrands as the named alternative" }, "oracle": "Biopython Bio.SeqUtils.MeltingTemp.Tm_NN", "oracleVersion": "1.88", "recordedOn": "2026-10-06", "source": "pipeline/sequence-toolkit/reference.py (oligo-tm)", "call": { "primerInExcess": "Bio.SeqUtils.MeltingTemp.Tm_NN('GGGCTGGCAAGCCACGTTTGGTG', check=True, strict=True, nn_table=DNA_NN3, dnac1=250, dnac2=0, selfcomp=False, Na=9, K=0, Tris=0, Mg=3.0, dNTPs=0.2, saltcorr=7)", "equalStrands": "Bio.SeqUtils.MeltingTemp.Tm_NN('GGGCTGGCAAGCCACGTTTGGTG', check=True, strict=True, nn_table=DNA_NN3, dnac1=125.0, dnac2=125.0, selfcomp=False, Na=9, K=0, Tris=0, Mg=3.0, dNTPs=0.2, saltcorr=7)" }, "notes": "dNTPs near the R = 6 boundary: free Mg2+ gives R 5.88, total Mg2+ would give 6.09" } ], "refusals": [ { "id": "R01", "input": { "raw": "TAATACGACNCACTATAGGG", "label": "ambiguity code N", "conditions": { "C": 250, "Na": 50, "Mg": 0, "dNTPs": 0, "saltcorr": 6 } }, "expected": { "refuse": true, "tm_C": null, "offendingCharacters": [ { "character": "N", "position": 10 } ], "reason": "not A, C, G or T: N at 10" }, "mustNotEqual_C": { "primerInExcess": 47.560051509281266, "equalStrands": 45.56037638636343 }, "oracleBehaviour": { "checkTrue": "Biopython Tm_NN(check=True) returns the mustNotEqual_C values instead of refusing", "checkFalseStrict": { "primerInExcess": "check=False raises ValueError: no thermodynamic data for neighbors 'CN/GN' available", "equalStrands": "check=False raises ValueError: no thermodynamic data for neighbors 'CN/GN' available" } }, "method": "refusal rule (CSO ruling, 6 October 2026); conditions as input.conditions", "oracle": "rule; Biopython Bio.SeqUtils.MeltingTemp.Tm_NN for the must-not-equal values", "oracleVersion": "1.88", "recordedOn": "2026-10-06", "source": "pipeline/sequence-toolkit/reference.py (oligo-tm, refusals)" }, { "id": "R02", "input": { "raw": "GTAAAACGACGGCCAGY", "label": "ambiguity code Y", "conditions": { "C": 250, "Na": 50, "Mg": 0, "dNTPs": 0, "saltcorr": 6 } }, "expected": { "refuse": true, "tm_C": null, "offendingCharacters": [ { "character": "Y", "position": 17 } ], "reason": "not A, C, G or T: Y at 17" }, "mustNotEqual_C": { "primerInExcess": 51.834278746752375, "equalStrands": 49.56667246710708 }, "oracleBehaviour": { "checkTrue": "Biopython Tm_NN(check=True) returns the mustNotEqual_C values instead of refusing", "checkFalseStrict": { "primerInExcess": "check=False raises ValueError: no thermodynamic data for neighbors 'GY/CR' available", "equalStrands": "check=False raises ValueError: no thermodynamic data for neighbors 'GY/CR' available" } }, "method": "refusal rule (CSO ruling, 6 October 2026); conditions as input.conditions", "oracle": "rule; Biopython Bio.SeqUtils.MeltingTemp.Tm_NN for the must-not-equal values", "oracleVersion": "1.88", "recordedOn": "2026-10-06", "source": "pipeline/sequence-toolkit/reference.py (oligo-tm, refusals)" }, { "id": "R03", "input": { "raw": "TAATACNACTCRCTATAGGG", "label": "two ambiguity codes (N, R)", "conditions": { "C": 250, "Na": 50, "Mg": 0, "dNTPs": 0, "saltcorr": 6 } }, "expected": { "refuse": true, "tm_C": null, "offendingCharacters": [ { "character": "N", "position": 7 }, { "character": "R", "position": 12 } ], "reason": "not A, C, G or T: N at 7, R at 12" }, "mustNotEqual_C": { "primerInExcess": 43.4901168385955, "equalStrands": 41.37337842449455 }, "oracleBehaviour": { "checkTrue": "Biopython Tm_NN(check=True) returns the mustNotEqual_C values instead of refusing", "checkFalseStrict": { "primerInExcess": "check=False raises ValueError: no thermodynamic data for neighbors 'CN/GN' available", "equalStrands": "check=False raises ValueError: no thermodynamic data for neighbors 'CN/GN' available" } }, "method": "refusal rule (CSO ruling, 6 October 2026); conditions as input.conditions", "oracle": "rule; Biopython Bio.SeqUtils.MeltingTemp.Tm_NN for the must-not-equal values", "oracleVersion": "1.88", "recordedOn": "2026-10-06", "source": "pipeline/sequence-toolkit/reference.py (oligo-tm, refusals)" }, { "id": "R04", "input": { "raw": "TAATACGACICACTATAGGG", "label": "inosine: no inosine parameters in the engine", "conditions": { "C": 250, "Na": 50, "Mg": 0, "dNTPs": 0, "saltcorr": 6 } }, "expected": { "refuse": true, "tm_C": null, "offendingCharacters": [ { "character": "I", "position": 10 } ], "reason": "not A, C, G or T: I at 10" }, "mustNotEqual_C": { "primerInExcess": 43.79542095597304, "equalStrands": 41.712919125324845 }, "oracleBehaviour": { "checkTrue": "Biopython Tm_NN(check=True) returns the mustNotEqual_C values instead of refusing", "checkFalseStrict": { "primerInExcess": "check=False returns 43.79542095597304 C", "equalStrands": "check=False returns 41.712919125324845 C" } }, "method": "refusal rule (CSO ruling, 6 October 2026); conditions as input.conditions", "oracle": "rule; Biopython Bio.SeqUtils.MeltingTemp.Tm_NN for the must-not-equal values", "oracleVersion": "1.88", "recordedOn": "2026-10-06", "source": "pipeline/sequence-toolkit/reference.py (oligo-tm, refusals)" }, { "id": "R05", "input": { "raw": "TAATACGACUCACTATAGGG", "label": "U in a DNA oligo", "conditions": { "C": 250, "Na": 50, "Mg": 0, "dNTPs": 0, "saltcorr": 6 } }, "expected": { "refuse": true, "tm_C": null, "offendingCharacters": [ { "character": "U", "position": 10 } ], "reason": "not A, C, G or T: U at 10" }, "mustNotEqual_C": { "primerInExcess": 47.596985252370416, "equalStrands": 45.703750337130145 }, "oracleBehaviour": { "checkTrue": "Biopython Tm_NN(check=True) returns the mustNotEqual_C values instead of refusing", "checkFalseStrict": { "primerInExcess": "check=False raises ValueError: no thermodynamic data for neighbors 'CU/GA' available", "equalStrands": "check=False raises ValueError: no thermodynamic data for neighbors 'CU/GA' available" } }, "method": "refusal rule (CSO ruling, 6 October 2026); conditions as input.conditions", "oracle": "rule; Biopython Bio.SeqUtils.MeltingTemp.Tm_NN for the must-not-equal values", "oracleVersion": "1.88", "recordedOn": "2026-10-06", "source": "pipeline/sequence-toolkit/reference.py (oligo-tm, refusals)" }, { "id": "R06", "input": { "raw": "TAATACGAC-TCACTATAGGG", "label": "gap character", "conditions": { "C": 250, "Na": 50, "Mg": 0, "dNTPs": 0, "saltcorr": 6 } }, "expected": { "refuse": true, "tm_C": null, "offendingCharacters": [ { "character": "-", "position": 10 } ], "reason": "not A, C, G or T: - at 10" }, "mustNotEqual_C": { "primerInExcess": 47.596985252370416, "equalStrands": 45.703750337130145 }, "oracleBehaviour": { "checkTrue": "Biopython Tm_NN(check=True) returns the mustNotEqual_C values instead of refusing", "checkFalseStrict": { "primerInExcess": "check=False raises ValueError: no thermodynamic data for neighbors 'C-/G-' available", "equalStrands": "check=False raises ValueError: no thermodynamic data for neighbors 'C-/G-' available" } }, "method": "refusal rule (CSO ruling, 6 October 2026); conditions as input.conditions", "oracle": "rule; Biopython Bio.SeqUtils.MeltingTemp.Tm_NN for the must-not-equal values", "oracleVersion": "1.88", "recordedOn": "2026-10-06", "source": "pipeline/sequence-toolkit/reference.py (oligo-tm, refusals)" }, { "id": "R07", "input": { "raw": "A", "label": "a 1-nt oligo has no nearest-neighbour pair", "conditions": { "C": 250, "Na": 50, "Mg": 0, "dNTPs": 0, "saltcorr": 6 } }, "expected": { "refuse": true, "tm_C": null, "offendingCharacters": [], "reason": "1 nt: a nearest-neighbour Tm needs at least 2 nt" }, "mustNotEqual_C": { "primerInExcess": -491.4325050698026, "equalStrands": -466.1987740504893 }, "oracleBehaviour": { "checkTrue": "Biopython Tm_NN(check=True) returns the mustNotEqual_C values instead of refusing", "checkFalseStrict": { "primerInExcess": "check=False returns -491.4325050698026 C", "equalStrands": "check=False returns -466.1987740504893 C" } }, "method": "refusal rule (CSO ruling, 6 October 2026); conditions as input.conditions", "oracle": "rule; Biopython Bio.SeqUtils.MeltingTemp.Tm_NN for the must-not-equal values", "oracleVersion": "1.88", "recordedOn": "2026-10-06", "source": "pipeline/sequence-toolkit/reference.py (oligo-tm, refusals)" } ], "acceptance": [ { "id": "A01", "input": { "raw": "taatacgactcactataggg", "label": "lower case", "conditions": { "C": 250, "Na": 50, "Mg": 0, "dNTPs": 0, "saltcorr": 6 } }, "expected": { "cleanSequence": "TAATACGACTCACTATAGGG", "primerInExcess": { "tm_C": 47.596985252370416 }, "equalStrands": { "tm_C": 45.703750337130145 } }, "crossCheck": { "biopythonOnRawInput": { "primerInExcess": 47.596985252370416, "equalStrands": 45.703750337130145 }, "equal": true }, "method": "acceptance rule (CSO ruling, 6 October 2026): lower case and line breaks give the clean sequence's Tm", "oracle": "Biopython Bio.SeqUtils.MeltingTemp.Tm_NN on the clean sequence", "oracleVersion": "1.88", "recordedOn": "2026-10-06", "source": "pipeline/sequence-toolkit/reference.py (oligo-tm, acceptance)" }, { "id": "A02", "input": { "raw": "TAATACGACT\nCACTATAGGG", "label": "line break (LF)", "conditions": { "C": 250, "Na": 50, "Mg": 0, "dNTPs": 0, "saltcorr": 6 } }, "expected": { "cleanSequence": "TAATACGACTCACTATAGGG", "primerInExcess": { "tm_C": 47.596985252370416 }, "equalStrands": { "tm_C": 45.703750337130145 } }, "crossCheck": { "biopythonOnRawInput": { "primerInExcess": 47.596985252370416, "equalStrands": 45.703750337130145 }, "equal": true }, "method": "acceptance rule (CSO ruling, 6 October 2026): lower case and line breaks give the clean sequence's Tm", "oracle": "Biopython Bio.SeqUtils.MeltingTemp.Tm_NN on the clean sequence", "oracleVersion": "1.88", "recordedOn": "2026-10-06", "source": "pipeline/sequence-toolkit/reference.py (oligo-tm, acceptance)" }, { "id": "A03", "input": { "raw": "TAATACGACT\r\nCACTATAGGG", "label": "line break (CRLF)", "conditions": { "C": 250, "Na": 50, "Mg": 0, "dNTPs": 0, "saltcorr": 6 } }, "expected": { "cleanSequence": "TAATACGACTCACTATAGGG", "primerInExcess": { "tm_C": 47.596985252370416 }, "equalStrands": { "tm_C": 45.703750337130145 } }, "crossCheck": { "biopythonOnRawInput": { "primerInExcess": 47.596985252370416, "equalStrands": 45.703750337130145 }, "equal": true }, "method": "acceptance rule (CSO ruling, 6 October 2026): lower case and line breaks give the clean sequence's Tm", "oracle": "Biopython Bio.SeqUtils.MeltingTemp.Tm_NN on the clean sequence", "oracleVersion": "1.88", "recordedOn": "2026-10-06", "source": "pipeline/sequence-toolkit/reference.py (oligo-tm, acceptance)" } ] }