{ "about": { "generatedBy": "pipeline/sequence-toolkit/reference.py", "scriptSha256": "1bc66633d1a780a7f255b02743e9258652769ed35b770f193c5d74e0070410d6", "recordedOn": "2026-10-06", "python": "3.11.15", "oracle": "primer3-py 2.3.1 (calc_hairpin, calc_homodimer, calc_heterodimer: the ntthal thermodynamic alignment of libprimer3 release 2.6.1 (bundled with primer3-py 2.3.1))", "oracleLicence": "GPL-2.0-or-later: build-time oracle only, never shipped; its primer3_config parameter files are never copied", "rule": "No value in this file comes from the Drybench engine under test.", "fixture": "Hairpin and dimer dG at 37 C, 20 cases (brief section 4.3 (3))", "tolerance": "Brief: dG = ntthal within 0.1 kcal/mol", "units": "dG and dH in cal/mol as ntthal reports them, dG also in kcal/mol; dS in cal/(K mol); structureTm_C is the structure's melting temperature", "noStructure": "When ntthal finds no structure it reports structureFound false with dG, dH, dS and Tm all 0. CSO ruling: those cases assert that the engine reports no structure with dG below -0.1 kcal/mol.", "conditions": "mv = monovalent cations (mM), dv = divalent cations (mM), dNTP (mM), dna = strand concentration (nM)", "saltMethod": "Salt by the sodium equivalent Na+ + 120 sqrt(Mg2+ - dNTP) mM (von Ahsen et al., Clin Chem 2001;47:1956-1961, as the Primer3 manual states; CSO read 6 October 2026), confirmed here by rerunning every case that has Mg2+ with that Na+ and Mg2+ = dNTP = 0 (identical results). Tm keeps Owczarzy 2008; this conversion is only the dG card's method.", "sodiumEquivalentConfirmedOn": [ "H01", "H04", "H05", "H06", "H08", "D01", "D02", "D03", "D04", "D06", "X01", "X02", "X03", "X04", "X05", "X06" ], "crossCheck": "Each case is rerun through the ntthal command-line program bundled in the primer3-py package (same library) where present; ntthalCli null means it was not found." }, "cases": [ { "id": "H01", "input": { "kind": "hairpin", "sequences": [ "CCCCCATCCGATCAGGGGG" ], "lengths": [ 19 ], "monovalent_mM": 50, "divalent_mM": 1.5, "dNTP_mM": 0.6, "sodiumEquivalent_mM": 163.84199576606164, "dna_nM": 50, "temperature_C": 37, "maxLoop": 30 }, "expected": { "structureFound": true, "dG_kcal_per_mol": -3.1769186867678436, "dG_cal_per_mol": -3176.9186867678436, "dH_cal_per_mol": -36300.0, "dS_cal_per_K_mol": -106.7969734426315, "structureTm_C": 66.7472726460212, "asciiStructure": [ "SEQ\t/////---------\\\\\\\\\\", "STR\tCCCCCATCCGATCAGGGGG" ] }, "crossCheck": { "ntthalCli": { "dg_cal_per_mol": -3176.92, "dh_cal_per_mol": -36300.0, "ds_cal_per_K_mol": -106.797, "tm_C": 66.7473, "command": "ntthal -mv 50 -dv 1.5 -n 0.6 -d 50 -t 37 -a HAIRPIN -maxloop 30 -path / -s1 CCCCCATCCGATCAGGGGG" }, "sodiumEquivalentRerun": { "mv_conc": 163.84199576606164, "dv_conc": 0, "dntp_conc": 0, "dG_cal_per_mol": -3176.9186867678436, "dH_cal_per_mol": -36300.0, "dS_cal_per_K_mol": -106.7969734426315, "structureTm_C": 66.7472726460212, "identical": true } }, "method": { "id": "santalucia-hicks-2004", "salt": "von-ahsen-2001-sodium-equivalent", "text": "Two-state nearest-neighbour thermodynamic alignment (Primer3 thal), most stable structure, dG at 37 C. Salt by the sodium equivalent Na+ + 120 sqrt(Mg2+ - dNTP) mM (von Ahsen et al., Clin Chem 2001;47:1956-1961, as the Primer3 manual states; CSO read 6 October 2026), confirmed here by rerunning every case that has Mg2+ with that Na+ and Mg2+ = dNTP = 0 (identical results). Tm keeps Owczarzy 2008; this conversion is only the dG card's method." }, "oracle": "primer3-py calc_hairpin", "oracleVersion": "2.3.1 (libprimer3 release 2.6.1 (bundled with primer3-py 2.3.1))", "recordedOn": "2026-10-06", "source": "pipeline/sequence-toolkit/reference.py (hairpin-dimer)", "call": "primer3.bindings.calc_hairpin('CCCCCATCCGATCAGGGGG', mv_conc=50, dv_conc=1.5, dntp_conc=0.6, dna_conc=50, temp_c=37, max_loop=30, output_structure=True)", "notes": "GC stem, 9-nt loop" }, { "id": "H02", "input": { "kind": "hairpin", "sequences": [ "GCGCGAAAAAACGCGC" ], "lengths": [ 16 ], "monovalent_mM": 50, "divalent_mM": 0, "dNTP_mM": 0, "sodiumEquivalent_mM": 50, "dna_nM": 50, "temperature_C": 37, "maxLoop": 30 }, "expected": { "structureFound": true, "dG_kcal_per_mol": -4.790555993437483, "dG_cal_per_mol": -4790.555993437483, "dH_cal_per_mol": -48800.0, "dS_cal_per_K_mol": -141.8972884299936, "structureTm_C": 70.7607296548232, "asciiStructure": [ "SEQ\t/////------\\\\\\\\\\", "STR\tGCGCGAAAAAACGCGC" ] }, "crossCheck": { "ntthalCli": { "dg_cal_per_mol": -4790.56, "dh_cal_per_mol": -48800.0, "ds_cal_per_K_mol": -141.897, "tm_C": 70.7607, "command": "ntthal -mv 50 -dv 0 -n 0 -d 50 -t 37 -a HAIRPIN -maxloop 30 -path / -s1 GCGCGAAAAAACGCGC" }, "sodiumEquivalentRerun": null }, "method": { "id": "santalucia-hicks-2004", "salt": "von-ahsen-2001-sodium-equivalent", "text": "Two-state nearest-neighbour thermodynamic alignment (Primer3 thal), most stable structure, dG at 37 C. Salt by the sodium equivalent Na+ + 120 sqrt(Mg2+ - dNTP) mM (von Ahsen et al., Clin Chem 2001;47:1956-1961, as the Primer3 manual states; CSO read 6 October 2026), confirmed here by rerunning every case that has Mg2+ with that Na+ and Mg2+ = dNTP = 0 (identical results). Tm keeps Owczarzy 2008; this conversion is only the dG card's method." }, "oracle": "primer3-py calc_hairpin", "oracleVersion": "2.3.1 (libprimer3 release 2.6.1 (bundled with primer3-py 2.3.1))", "recordedOn": "2026-10-06", "source": "pipeline/sequence-toolkit/reference.py (hairpin-dimer)", "call": "primer3.bindings.calc_hairpin('GCGCGAAAAAACGCGC', mv_conc=50, dv_conc=0, dntp_conc=0, dna_conc=50, temp_c=37, max_loop=30, output_structure=True)", "notes": "GC stem, A6 loop, no Mg2+ or dNTP" }, { "id": "H03", "input": { "kind": "hairpin", "sequences": [ "ATATATTTTTTATATAT" ], "lengths": [ 17 ], "monovalent_mM": 50, "divalent_mM": 0, "dNTP_mM": 0, "sodiumEquivalent_mM": 50, "dna_nM": 250, "temperature_C": 37, "maxLoop": 30 }, "expected": { "structureFound": false, "dG_kcal_per_mol": 0.0, "dG_cal_per_mol": 0.0, "dH_cal_per_mol": 0.0, "dS_cal_per_K_mol": 0.0, "structureTm_C": 0.0, "asciiStructure": [], "noStructureBelow_kcal_per_mol": -0.1, "assert": "the engine reports no structure with dG below -0.1 kcal/mol (CSO ruling, 6 October 2026)" }, "crossCheck": { "ntthalCli": { "structureFound": false, "output": "No secondary structure could be calculated", "command": "ntthal -mv 50 -dv 0 -n 0 -d 250 -t 37 -a HAIRPIN -maxloop 30 -path / -s1 ATATATTTTTTATATAT" }, "sodiumEquivalentRerun": null }, "method": { "id": "santalucia-hicks-2004", "salt": "von-ahsen-2001-sodium-equivalent", "text": "Two-state nearest-neighbour thermodynamic alignment (Primer3 thal), most stable structure, dG at 37 C. Salt by the sodium equivalent Na+ + 120 sqrt(Mg2+ - dNTP) mM (von Ahsen et al., Clin Chem 2001;47:1956-1961, as the Primer3 manual states; CSO read 6 October 2026), confirmed here by rerunning every case that has Mg2+ with that Na+ and Mg2+ = dNTP = 0 (identical results). Tm keeps Owczarzy 2008; this conversion is only the dG card's method." }, "oracle": "primer3-py calc_hairpin", "oracleVersion": "2.3.1 (libprimer3 release 2.6.1 (bundled with primer3-py 2.3.1))", "recordedOn": "2026-10-06", "source": "pipeline/sequence-toolkit/reference.py (hairpin-dimer)", "call": "primer3.bindings.calc_hairpin('ATATATTTTTTATATAT', mv_conc=50, dv_conc=0, dntp_conc=0, dna_conc=250, temp_c=37, max_loop=30, output_structure=True)", "notes": "AT palindromic stem too weak to report: no structure" }, { "id": "H04", "input": { "kind": "hairpin", "sequences": [ "ACTGCAGGCTTGCGATTTTCGCAAGCC" ], "lengths": [ 27 ], "monovalent_mM": 50, "divalent_mM": 2.0, "dNTP_mM": 0.8, "sodiumEquivalent_mM": 181.45341380123986, "dna_nM": 250, "temperature_C": 37, "maxLoop": 30 }, "expected": { "structureFound": true, "dG_kcal_per_mol": -9.208836173278076, "dG_cal_per_mol": -9208.836173278076, "dH_cal_per_mol": -72100.0, "dS_cal_per_K_mol": -202.77660430992077, "structureTm_C": 82.4137014702319, "asciiStructure": [ "SEQ\t------/////////---\\\\\\\\\\\\\\\\\\", "STR\tACTGCAGGCTTGCGATTTTCGCAAGCC" ] }, "crossCheck": { "ntthalCli": { "dg_cal_per_mol": -9208.84, "dh_cal_per_mol": -72100.0, "ds_cal_per_K_mol": -202.777, "tm_C": 82.4137, "command": "ntthal -mv 50 -dv 2.0 -n 0.8 -d 250 -t 37 -a HAIRPIN -maxloop 30 -path / -s1 ACTGCAGGCTTGCGATTTTCGCAAGCC" }, "sodiumEquivalentRerun": { "mv_conc": 181.45341380123986, "dv_conc": 0, "dntp_conc": 0, "dG_cal_per_mol": -9208.836173278076, "dH_cal_per_mol": -72100.0, "dS_cal_per_K_mol": -202.77660430992077, "structureTm_C": 82.4137014702319, "identical": true } }, "method": { "id": "santalucia-hicks-2004", "salt": "von-ahsen-2001-sodium-equivalent", "text": "Two-state nearest-neighbour thermodynamic alignment (Primer3 thal), most stable structure, dG at 37 C. Salt by the sodium equivalent Na+ + 120 sqrt(Mg2+ - dNTP) mM (von Ahsen et al., Clin Chem 2001;47:1956-1961, as the Primer3 manual states; CSO read 6 October 2026), confirmed here by rerunning every case that has Mg2+ with that Na+ and Mg2+ = dNTP = 0 (identical results). Tm keeps Owczarzy 2008; this conversion is only the dG card's method." }, "oracle": "primer3-py calc_hairpin", "oracleVersion": "2.3.1 (libprimer3 release 2.6.1 (bundled with primer3-py 2.3.1))", "recordedOn": "2026-10-06", "source": "pipeline/sequence-toolkit/reference.py (hairpin-dimer)", "call": "primer3.bindings.calc_hairpin('ACTGCAGGCTTGCGATTTTCGCAAGCC', mv_conc=50, dv_conc=2.0, dntp_conc=0.8, dna_conc=250, temp_c=37, max_loop=30, output_structure=True)", "notes": "3' hairpin with a 9-bp stem" }, { "id": "H05", "input": { "kind": "hairpin", "sequences": [ "TTTTTTTTTTTTTTTTTTTT" ], "lengths": [ 20 ], "monovalent_mM": 50, "divalent_mM": 1.5, "dNTP_mM": 0.6, "sodiumEquivalent_mM": 163.84199576606164, "dna_nM": 50, "temperature_C": 37, "maxLoop": 30 }, "expected": { "structureFound": false, "dG_kcal_per_mol": 0.0, "dG_cal_per_mol": 0.0, "dH_cal_per_mol": 0.0, "dS_cal_per_K_mol": 0.0, "structureTm_C": 0.0, "asciiStructure": [], "noStructureBelow_kcal_per_mol": -0.1, "assert": "the engine reports no structure with dG below -0.1 kcal/mol (CSO ruling, 6 October 2026)" }, "crossCheck": { "ntthalCli": { "structureFound": false, "output": "No secondary structure could be calculated", "command": "ntthal -mv 50 -dv 1.5 -n 0.6 -d 50 -t 37 -a HAIRPIN -maxloop 30 -path / -s1 TTTTTTTTTTTTTTTTTTTT" }, "sodiumEquivalentRerun": { "mv_conc": 163.84199576606164, "dv_conc": 0, "dntp_conc": 0, "dG_cal_per_mol": 0.0, "dH_cal_per_mol": 0.0, "dS_cal_per_K_mol": 0.0, "structureTm_C": 0.0, "identical": true } }, "method": { "id": "santalucia-hicks-2004", "salt": "von-ahsen-2001-sodium-equivalent", "text": "Two-state nearest-neighbour thermodynamic alignment (Primer3 thal), most stable structure, dG at 37 C. Salt by the sodium equivalent Na+ + 120 sqrt(Mg2+ - dNTP) mM (von Ahsen et al., Clin Chem 2001;47:1956-1961, as the Primer3 manual states; CSO read 6 October 2026), confirmed here by rerunning every case that has Mg2+ with that Na+ and Mg2+ = dNTP = 0 (identical results). Tm keeps Owczarzy 2008; this conversion is only the dG card's method." }, "oracle": "primer3-py calc_hairpin", "oracleVersion": "2.3.1 (libprimer3 release 2.6.1 (bundled with primer3-py 2.3.1))", "recordedOn": "2026-10-06", "source": "pipeline/sequence-toolkit/reference.py (hairpin-dimer)", "call": "primer3.bindings.calc_hairpin('TTTTTTTTTTTTTTTTTTTT', mv_conc=50, dv_conc=1.5, dntp_conc=0.6, dna_conc=50, temp_c=37, max_loop=30, output_structure=True)", "notes": "poly(dT): no structure" }, { "id": "H06", "input": { "kind": "hairpin", "sequences": [ "GAATTTATTGAAAACAATAAATTC" ], "lengths": [ 24 ], "monovalent_mM": 50, "divalent_mM": 3.0, "dNTP_mM": 0.2, "sodiumEquivalent_mM": 250.79840636817812, "dna_nM": 50, "temperature_C": 37, "maxLoop": 30 }, "expected": { "structureFound": true, "dG_kcal_per_mol": -3.616759080749798, "dG_cal_per_mol": -3616.759080749798, "dH_cal_per_mol": -67400.0, "dS_cal_per_K_mol": -205.65288060374078, "structureTm_C": 54.58671733715562, "asciiStructure": [ "SEQ\t/////////------\\\\\\\\\\\\\\\\\\", "STR\tGAATTTATTGAAAACAATAAATTC" ] }, "crossCheck": { "ntthalCli": { "dg_cal_per_mol": -3616.76, "dh_cal_per_mol": -67400.0, "ds_cal_per_K_mol": -205.653, "tm_C": 54.5867, "command": "ntthal -mv 50 -dv 3.0 -n 0.2 -d 50 -t 37 -a HAIRPIN -maxloop 30 -path / -s1 GAATTTATTGAAAACAATAAATTC" }, "sodiumEquivalentRerun": { "mv_conc": 250.79840636817812, "dv_conc": 0, "dntp_conc": 0, "dG_cal_per_mol": -3616.759080749798, "dH_cal_per_mol": -67400.0, "dS_cal_per_K_mol": -205.65288060374078, "structureTm_C": 54.58671733715562, "identical": true } }, "method": { "id": "santalucia-hicks-2004", "salt": "von-ahsen-2001-sodium-equivalent", "text": "Two-state nearest-neighbour thermodynamic alignment (Primer3 thal), most stable structure, dG at 37 C. Salt by the sodium equivalent Na+ + 120 sqrt(Mg2+ - dNTP) mM (von Ahsen et al., Clin Chem 2001;47:1956-1961, as the Primer3 manual states; CSO read 6 October 2026), confirmed here by rerunning every case that has Mg2+ with that Na+ and Mg2+ = dNTP = 0 (identical results). Tm keeps Owczarzy 2008; this conversion is only the dG card's method." }, "oracle": "primer3-py calc_hairpin", "oracleVersion": "2.3.1 (libprimer3 release 2.6.1 (bundled with primer3-py 2.3.1))", "recordedOn": "2026-10-06", "source": "pipeline/sequence-toolkit/reference.py (hairpin-dimer)", "call": "primer3.bindings.calc_hairpin('GAATTTATTGAAAACAATAAATTC', mv_conc=50, dv_conc=3.0, dntp_conc=0.2, dna_conc=50, temp_c=37, max_loop=30, output_structure=True)", "notes": "AT-rich 9-bp stem that is reported" }, { "id": "H07", "input": { "kind": "hairpin", "sequences": [ "GGATCCGAATTCGGATCC" ], "lengths": [ 18 ], "monovalent_mM": 50, "divalent_mM": 0, "dNTP_mM": 0, "sodiumEquivalent_mM": 50, "dna_nM": 50, "temperature_C": 37, "maxLoop": 30 }, "expected": { "structureFound": true, "dG_kcal_per_mol": -5.1207304890604135, "dG_cal_per_mol": -5120.730489060414, "dH_cal_per_mol": -56200.0, "dS_cal_per_K_mol": -164.6921473833293, "structureTm_C": 68.09274224922007, "asciiStructure": [ "SEQ\t///////----\\\\\\\\\\\\\\", "STR\tGGATCCGAATTCGGATCC" ] }, "crossCheck": { "ntthalCli": { "dg_cal_per_mol": -5120.73, "dh_cal_per_mol": -56200.0, "ds_cal_per_K_mol": -164.692, "tm_C": 68.0927, "command": "ntthal -mv 50 -dv 0 -n 0 -d 50 -t 37 -a HAIRPIN -maxloop 30 -path / -s1 GGATCCGAATTCGGATCC" }, "sodiumEquivalentRerun": null }, "method": { "id": "santalucia-hicks-2004", "salt": "von-ahsen-2001-sodium-equivalent", "text": "Two-state nearest-neighbour thermodynamic alignment (Primer3 thal), most stable structure, dG at 37 C. Salt by the sodium equivalent Na+ + 120 sqrt(Mg2+ - dNTP) mM (von Ahsen et al., Clin Chem 2001;47:1956-1961, as the Primer3 manual states; CSO read 6 October 2026), confirmed here by rerunning every case that has Mg2+ with that Na+ and Mg2+ = dNTP = 0 (identical results). Tm keeps Owczarzy 2008; this conversion is only the dG card's method." }, "oracle": "primer3-py calc_hairpin", "oracleVersion": "2.3.1 (libprimer3 release 2.6.1 (bundled with primer3-py 2.3.1))", "recordedOn": "2026-10-06", "source": "pipeline/sequence-toolkit/reference.py (hairpin-dimer)", "call": "primer3.bindings.calc_hairpin('GGATCCGAATTCGGATCC', mv_conc=50, dv_conc=0, dntp_conc=0, dna_conc=50, temp_c=37, max_loop=30, output_structure=True)", "notes": "palindromic restriction-site primer" }, { "id": "H08", "input": { "kind": "hairpin", "sequences": [ "TTGACCGAGTGCAACGTACGGATCTGTTGCACTCGGTCAATGAC" ], "lengths": [ 44 ], "monovalent_mM": 50, "divalent_mM": 1.5, "dNTP_mM": 0.6, "sodiumEquivalent_mM": 163.84199576606164, "dna_nM": 500, "temperature_C": 37, "maxLoop": 30 }, "expected": { "structureFound": true, "dG_kcal_per_mol": -11.416979018137397, "dG_cal_per_mol": -11416.979018137397, "dH_cal_per_mol": -91700.0, "dS_cal_per_K_mol": -258.8522359563521, "structureTm_C": 81.10616341001025, "asciiStructure": [ "SEQ\t---////////////----------\\\\\\\\\\\\\\\\\\\\\\\\-------", "STR\tTTGACCGAGTGCAACGTACGGATCTGTTGCACTCGGTCAATGAC" ] }, "crossCheck": { "ntthalCli": { "dg_cal_per_mol": -11417.0, "dh_cal_per_mol": -91700.0, "ds_cal_per_K_mol": -258.852, "tm_C": 81.1062, "command": "ntthal -mv 50 -dv 1.5 -n 0.6 -d 500 -t 37 -a HAIRPIN -maxloop 30 -path / -s1 TTGACCGAGTGCAACGTACGGATCTGTTGCACTCGGTCAATGAC" }, "sodiumEquivalentRerun": { "mv_conc": 163.84199576606164, "dv_conc": 0, "dntp_conc": 0, "dG_cal_per_mol": -11416.979018137397, "dH_cal_per_mol": -91700.0, "dS_cal_per_K_mol": -258.8522359563521, "structureTm_C": 81.10616341001025, "identical": true } }, "method": { "id": "santalucia-hicks-2004", "salt": "von-ahsen-2001-sodium-equivalent", "text": "Two-state nearest-neighbour thermodynamic alignment (Primer3 thal), most stable structure, dG at 37 C. Salt by the sodium equivalent Na+ + 120 sqrt(Mg2+ - dNTP) mM (von Ahsen et al., Clin Chem 2001;47:1956-1961, as the Primer3 manual states; CSO read 6 October 2026), confirmed here by rerunning every case that has Mg2+ with that Na+ and Mg2+ = dNTP = 0 (identical results). Tm keeps Owczarzy 2008; this conversion is only the dG card's method." }, "oracle": "primer3-py calc_hairpin", "oracleVersion": "2.3.1 (libprimer3 release 2.6.1 (bundled with primer3-py 2.3.1))", "recordedOn": "2026-10-06", "source": "pipeline/sequence-toolkit/reference.py (hairpin-dimer)", "call": "primer3.bindings.calc_hairpin('TTGACCGAGTGCAACGTACGGATCTGTTGCACTCGGTCAATGAC', mv_conc=50, dv_conc=1.5, dntp_conc=0.6, dna_conc=500, temp_c=37, max_loop=30, output_structure=True)", "notes": "44-mer with an internal 12-bp stem" }, { "id": "D01", "input": { "kind": "homodimer", "sequences": [ "GCGAATTCGCATGCAAGCTT" ], "lengths": [ 20 ], "monovalent_mM": 50, "divalent_mM": 1.5, "dNTP_mM": 0.6, "sodiumEquivalent_mM": 163.84199576606164, "dna_nM": 50, "temperature_C": 37, "maxLoop": 30 }, "expected": { "structureFound": true, "dG_kcal_per_mol": -12.063251060300448, "dG_cal_per_mol": -12063.251060300448, "dH_cal_per_mol": -91800.0, "dS_cal_per_K_mol": -257.0909203279044, "structureTm_C": 39.89020509635009, "asciiStructure": [ "SEQ\t ATGCAAGCTT", "SEQ\t GCGAATTCGC", "STR\t CGCTTAAGCG", "STR\tTTCGAACGTA ----------" ] }, "crossCheck": { "ntthalCli": { "dg_cal_per_mol": -12063.3, "dh_cal_per_mol": -91800.0, "ds_cal_per_K_mol": -257.091, "tm_C": 39.8902, "command": "ntthal -mv 50 -dv 1.5 -n 0.6 -d 50 -t 37 -a ANY -maxloop 30 -path / -s1 GCGAATTCGCATGCAAGCTT -s2 GCGAATTCGCATGCAAGCTT" }, "sodiumEquivalentRerun": { "mv_conc": 163.84199576606164, "dv_conc": 0, "dntp_conc": 0, "dG_cal_per_mol": -12063.251060300448, "dH_cal_per_mol": -91800.0, "dS_cal_per_K_mol": -257.0909203279044, "structureTm_C": 39.89020509635009, "identical": true } }, "method": { "id": "santalucia-hicks-2004", "salt": "von-ahsen-2001-sodium-equivalent", "text": "Two-state nearest-neighbour thermodynamic alignment (Primer3 thal), most stable structure, dG at 37 C. Salt by the sodium equivalent Na+ + 120 sqrt(Mg2+ - dNTP) mM (von Ahsen et al., Clin Chem 2001;47:1956-1961, as the Primer3 manual states; CSO read 6 October 2026), confirmed here by rerunning every case that has Mg2+ with that Na+ and Mg2+ = dNTP = 0 (identical results). Tm keeps Owczarzy 2008; this conversion is only the dG card's method." }, "oracle": "primer3-py calc_homodimer", "oracleVersion": "2.3.1 (libprimer3 release 2.6.1 (bundled with primer3-py 2.3.1))", "recordedOn": "2026-10-06", "source": "pipeline/sequence-toolkit/reference.py (hairpin-dimer)", "call": "primer3.bindings.calc_homodimer('GCGAATTCGCATGCAAGCTT', mv_conc=50, dv_conc=1.5, dntp_conc=0.6, dna_conc=50, temp_c=37, max_loop=30, output_structure=True)", "notes": "EcoRI and SphI/HindIII palindromes" }, { "id": "D02", "input": { "kind": "homodimer", "sequences": [ "TTGCCAGTCAAGTCAGCATGC" ], "lengths": [ 21 ], "monovalent_mM": 50, "divalent_mM": 1.5, "dNTP_mM": 0.6, "sodiumEquivalent_mM": 163.84199576606164, "dna_nM": 250, "temperature_C": 37, "maxLoop": 30 }, "expected": { "structureFound": true, "dG_kcal_per_mol": -6.453686144614119, "dG_cal_per_mol": -6453.686144614119, "dH_cal_per_mol": -51000.0, "dS_cal_per_K_mol": -143.62828907104912, "structureTm_C": 15.651043100431934, "asciiStructure": [ "SEQ\tTTGCCAGTCAAGTCA ---------------", "SEQ\t GCATGC", "STR\t CGTACG", "STR\t ACTGAACTGACCGTT" ] }, "crossCheck": { "ntthalCli": { "dg_cal_per_mol": -6453.69, "dh_cal_per_mol": -51000.0, "ds_cal_per_K_mol": -143.628, "tm_C": 15.651, "command": "ntthal -mv 50 -dv 1.5 -n 0.6 -d 250 -t 37 -a ANY -maxloop 30 -path / -s1 TTGCCAGTCAAGTCAGCATGC -s2 TTGCCAGTCAAGTCAGCATGC" }, "sodiumEquivalentRerun": { "mv_conc": 163.84199576606164, "dv_conc": 0, "dntp_conc": 0, "dG_cal_per_mol": -6453.686144614119, "dH_cal_per_mol": -51000.0, "dS_cal_per_K_mol": -143.62828907104912, "structureTm_C": 15.651043100431934, "identical": true } }, "method": { "id": "santalucia-hicks-2004", "salt": "von-ahsen-2001-sodium-equivalent", "text": "Two-state nearest-neighbour thermodynamic alignment (Primer3 thal), most stable structure, dG at 37 C. Salt by the sodium equivalent Na+ + 120 sqrt(Mg2+ - dNTP) mM (von Ahsen et al., Clin Chem 2001;47:1956-1961, as the Primer3 manual states; CSO read 6 October 2026), confirmed here by rerunning every case that has Mg2+ with that Na+ and Mg2+ = dNTP = 0 (identical results). Tm keeps Owczarzy 2008; this conversion is only the dG card's method." }, "oracle": "primer3-py calc_homodimer", "oracleVersion": "2.3.1 (libprimer3 release 2.6.1 (bundled with primer3-py 2.3.1))", "recordedOn": "2026-10-06", "source": "pipeline/sequence-toolkit/reference.py (hairpin-dimer)", "call": "primer3.bindings.calc_homodimer('TTGCCAGTCAAGTCAGCATGC', mv_conc=50, dv_conc=1.5, dntp_conc=0.6, dna_conc=250, temp_c=37, max_loop=30, output_structure=True)", "notes": "3'-end self-dimer (GCATGC)" }, { "id": "D03", "input": { "kind": "homodimer", "sequences": [ "AAAAAAAAAAAAAAAAAAAA" ], "lengths": [ 20 ], "monovalent_mM": 50, "divalent_mM": 1.5, "dNTP_mM": 0.6, "sodiumEquivalent_mM": 163.84199576606164, "dna_nM": 50, "temperature_C": 37, "maxLoop": 30 }, "expected": { "structureFound": false, "dG_kcal_per_mol": 0.0, "dG_cal_per_mol": 0.0, "dH_cal_per_mol": 0.0, "dS_cal_per_K_mol": 0.0, "structureTm_C": 0.0, "asciiStructure": [], "noStructureBelow_kcal_per_mol": -0.1, "assert": "the engine reports no structure with dG below -0.1 kcal/mol (CSO ruling, 6 October 2026)" }, "crossCheck": { "ntthalCli": { "structureFound": false, "output": "", "command": "ntthal -mv 50 -dv 1.5 -n 0.6 -d 50 -t 37 -a ANY -maxloop 30 -path / -s1 AAAAAAAAAAAAAAAAAAAA -s2 AAAAAAAAAAAAAAAAAAAA" }, "sodiumEquivalentRerun": { "mv_conc": 163.84199576606164, "dv_conc": 0, "dntp_conc": 0, "dG_cal_per_mol": 0.0, "dH_cal_per_mol": 0.0, "dS_cal_per_K_mol": 0.0, "structureTm_C": 0.0, "identical": true } }, "method": { "id": "santalucia-hicks-2004", "salt": "von-ahsen-2001-sodium-equivalent", "text": "Two-state nearest-neighbour thermodynamic alignment (Primer3 thal), most stable structure, dG at 37 C. Salt by the sodium equivalent Na+ + 120 sqrt(Mg2+ - dNTP) mM (von Ahsen et al., Clin Chem 2001;47:1956-1961, as the Primer3 manual states; CSO read 6 October 2026), confirmed here by rerunning every case that has Mg2+ with that Na+ and Mg2+ = dNTP = 0 (identical results). Tm keeps Owczarzy 2008; this conversion is only the dG card's method." }, "oracle": "primer3-py calc_homodimer", "oracleVersion": "2.3.1 (libprimer3 release 2.6.1 (bundled with primer3-py 2.3.1))", "recordedOn": "2026-10-06", "source": "pipeline/sequence-toolkit/reference.py (hairpin-dimer)", "call": "primer3.bindings.calc_homodimer('AAAAAAAAAAAAAAAAAAAA', mv_conc=50, dv_conc=1.5, dntp_conc=0.6, dna_conc=50, temp_c=37, max_loop=30, output_structure=True)", "notes": "poly(dA): no structure" }, { "id": "D04", "input": { "kind": "homodimer", "sequences": [ "CTGACGTAAGCTTACGTCAG" ], "lengths": [ 20 ], "monovalent_mM": 50, "divalent_mM": 3.0, "dNTP_mM": 0.8, "sodiumEquivalent_mM": 227.9887636902959, "dna_nM": 500, "temperature_C": 37, "maxLoop": 30 }, "expected": { "structureFound": true, "dG_kcal_per_mol": -21.10962508516581, "dG_cal_per_mol": -21109.62508516581, "dH_cal_per_mol": -159200.0, "dS_cal_per_K_mol": -445.2373848616289, "structureTm_C": 62.66610170561444, "asciiStructure": [ "SEQ\t", "SEQ\tCTGACGTAAGCTTACGTCAG", "STR\tGACTGCATTCGAATGCAGTC", "STR\t" ] }, "crossCheck": { "ntthalCli": { "dg_cal_per_mol": -21109.6, "dh_cal_per_mol": -159200.0, "ds_cal_per_K_mol": -445.237, "tm_C": 62.6661, "command": "ntthal -mv 50 -dv 3.0 -n 0.8 -d 500 -t 37 -a ANY -maxloop 30 -path / -s1 CTGACGTAAGCTTACGTCAG -s2 CTGACGTAAGCTTACGTCAG" }, "sodiumEquivalentRerun": { "mv_conc": 227.9887636902959, "dv_conc": 0, "dntp_conc": 0, "dG_cal_per_mol": -21109.62508516581, "dH_cal_per_mol": -159200.0, "dS_cal_per_K_mol": -445.2373848616289, "structureTm_C": 62.66610170561444, "identical": true } }, "method": { "id": "santalucia-hicks-2004", "salt": "von-ahsen-2001-sodium-equivalent", "text": "Two-state nearest-neighbour thermodynamic alignment (Primer3 thal), most stable structure, dG at 37 C. Salt by the sodium equivalent Na+ + 120 sqrt(Mg2+ - dNTP) mM (von Ahsen et al., Clin Chem 2001;47:1956-1961, as the Primer3 manual states; CSO read 6 October 2026), confirmed here by rerunning every case that has Mg2+ with that Na+ and Mg2+ = dNTP = 0 (identical results). Tm keeps Owczarzy 2008; this conversion is only the dG card's method." }, "oracle": "primer3-py calc_homodimer", "oracleVersion": "2.3.1 (libprimer3 release 2.6.1 (bundled with primer3-py 2.3.1))", "recordedOn": "2026-10-06", "source": "pipeline/sequence-toolkit/reference.py (hairpin-dimer)", "call": "primer3.bindings.calc_homodimer('CTGACGTAAGCTTACGTCAG', mv_conc=50, dv_conc=3.0, dntp_conc=0.8, dna_conc=500, temp_c=37, max_loop=30, output_structure=True)", "notes": "fully self-complementary 20-mer" }, { "id": "D05", "input": { "kind": "homodimer", "sequences": [ "TAATACGACTCACTATAGGG" ], "lengths": [ 20 ], "monovalent_mM": 50, "divalent_mM": 0, "dNTP_mM": 0, "sodiumEquivalent_mM": 50, "dna_nM": 50, "temperature_C": 37, "maxLoop": 30 }, "expected": { "structureFound": true, "dG_kcal_per_mol": -3.802312489063508, "dG_cal_per_mol": -3802.312489063508, "dH_cal_per_mol": -57400.0, "dS_cal_per_K_mol": -172.81214738331934, "structureTm_C": 1.5249329576598711, "asciiStructure": [ "SEQ\tTAATACGACTCA GG----------", "SEQ\t CTATAG", "STR\t GATATC", "STR\t GG ACTCAGCATAAT" ] }, "crossCheck": { "ntthalCli": { "dg_cal_per_mol": -3802.31, "dh_cal_per_mol": -57400.0, "ds_cal_per_K_mol": -172.812, "tm_C": 1.52493, "command": "ntthal -mv 50 -dv 0 -n 0 -d 50 -t 37 -a ANY -maxloop 30 -path / -s1 TAATACGACTCACTATAGGG -s2 TAATACGACTCACTATAGGG" }, "sodiumEquivalentRerun": null }, "method": { "id": "santalucia-hicks-2004", "salt": "von-ahsen-2001-sodium-equivalent", "text": "Two-state nearest-neighbour thermodynamic alignment (Primer3 thal), most stable structure, dG at 37 C. Salt by the sodium equivalent Na+ + 120 sqrt(Mg2+ - dNTP) mM (von Ahsen et al., Clin Chem 2001;47:1956-1961, as the Primer3 manual states; CSO read 6 October 2026), confirmed here by rerunning every case that has Mg2+ with that Na+ and Mg2+ = dNTP = 0 (identical results). Tm keeps Owczarzy 2008; this conversion is only the dG card's method." }, "oracle": "primer3-py calc_homodimer", "oracleVersion": "2.3.1 (libprimer3 release 2.6.1 (bundled with primer3-py 2.3.1))", "recordedOn": "2026-10-06", "source": "pipeline/sequence-toolkit/reference.py (hairpin-dimer)", "call": "primer3.bindings.calc_homodimer('TAATACGACTCACTATAGGG', mv_conc=50, dv_conc=0, dntp_conc=0, dna_conc=50, temp_c=37, max_loop=30, output_structure=True)", "notes": "T7 promoter primer self-dimer" }, { "id": "D06", "input": { "kind": "homodimer", "sequences": [ "GGCCATTAGTCAGTACGGCC" ], "lengths": [ 20 ], "monovalent_mM": 50, "divalent_mM": 2.0, "dNTP_mM": 0.2, "sodiumEquivalent_mM": 210.99689437998487, "dna_nM": 50, "temperature_C": 37, "maxLoop": 30 }, "expected": { "structureFound": true, "dG_kcal_per_mol": -3.5573715701965996, "dG_cal_per_mol": -3557.3715701965994, "dH_cal_per_mol": -75400.0, "dS_cal_per_K_mol": -231.63833122619187, "structureTm_C": 8.402896419512615, "asciiStructure": [ "SEQ\t ATTAGTCA --------", "SEQ\tGGCC GTAC GGCC", "STR\tCCGG CATG CCGG", "STR\t -------- ACTGATTA" ] }, "crossCheck": { "ntthalCli": { "dg_cal_per_mol": -3557.37, "dh_cal_per_mol": -75400.0, "ds_cal_per_K_mol": -231.638, "tm_C": 8.4029, "command": "ntthal -mv 50 -dv 2.0 -n 0.2 -d 50 -t 37 -a ANY -maxloop 30 -path / -s1 GGCCATTAGTCAGTACGGCC -s2 GGCCATTAGTCAGTACGGCC" }, "sodiumEquivalentRerun": { "mv_conc": 210.99689437998487, "dv_conc": 0, "dntp_conc": 0, "dG_cal_per_mol": -3557.3715701965994, "dH_cal_per_mol": -75400.0, "dS_cal_per_K_mol": -231.63833122619187, "structureTm_C": 8.402896419512615, "identical": true } }, "method": { "id": "santalucia-hicks-2004", "salt": "von-ahsen-2001-sodium-equivalent", "text": "Two-state nearest-neighbour thermodynamic alignment (Primer3 thal), most stable structure, dG at 37 C. Salt by the sodium equivalent Na+ + 120 sqrt(Mg2+ - dNTP) mM (von Ahsen et al., Clin Chem 2001;47:1956-1961, as the Primer3 manual states; CSO read 6 October 2026), confirmed here by rerunning every case that has Mg2+ with that Na+ and Mg2+ = dNTP = 0 (identical results). Tm keeps Owczarzy 2008; this conversion is only the dG card's method." }, "oracle": "primer3-py calc_homodimer", "oracleVersion": "2.3.1 (libprimer3 release 2.6.1 (bundled with primer3-py 2.3.1))", "recordedOn": "2026-10-06", "source": "pipeline/sequence-toolkit/reference.py (hairpin-dimer)", "call": "primer3.bindings.calc_homodimer('GGCCATTAGTCAGTACGGCC', mv_conc=50, dv_conc=2.0, dntp_conc=0.2, dna_conc=50, temp_c=37, max_loop=30, output_structure=True)", "notes": "weak self-dimer with GGCC ends" }, { "id": "X01", "input": { "kind": "heterodimer", "sequences": [ "TAATACGACTCACTATAGGG", "CCCTATAGTGAGTCGTATTA" ], "lengths": [ 20, 20 ], "monovalent_mM": 50, "divalent_mM": 1.5, "dNTP_mM": 0.6, "sodiumEquivalent_mM": 163.84199576606164, "dna_nM": 50, "temperature_C": 37, "maxLoop": 30 }, "expected": { "structureFound": true, "dG_kcal_per_mol": -17.312683349513186, "dG_cal_per_mol": -17312.683349513187, "dH_cal_per_mol": -148800.0, "dS_cal_per_K_mol": -423.94749847005266, "structureTm_C": 50.251175823530104, "asciiStructure": [ "SEQ\t", "SEQ\tTAATACGACTCACTATAGGG", "STR\tATTATGCTGAGTGATATCCC", "STR\t" ] }, "crossCheck": { "ntthalCli": { "dg_cal_per_mol": -17312.7, "dh_cal_per_mol": -148800.0, "ds_cal_per_K_mol": -423.947, "tm_C": 50.2512, "command": "ntthal -mv 50 -dv 1.5 -n 0.6 -d 50 -t 37 -a ANY -maxloop 30 -path / -s1 TAATACGACTCACTATAGGG -s2 CCCTATAGTGAGTCGTATTA" }, "sodiumEquivalentRerun": { "mv_conc": 163.84199576606164, "dv_conc": 0, "dntp_conc": 0, "dG_cal_per_mol": -17312.683349513187, "dH_cal_per_mol": -148800.0, "dS_cal_per_K_mol": -423.94749847005266, "structureTm_C": 50.251175823530104, "identical": true } }, "method": { "id": "santalucia-hicks-2004", "salt": "von-ahsen-2001-sodium-equivalent", "text": "Two-state nearest-neighbour thermodynamic alignment (Primer3 thal), most stable structure, dG at 37 C. Salt by the sodium equivalent Na+ + 120 sqrt(Mg2+ - dNTP) mM (von Ahsen et al., Clin Chem 2001;47:1956-1961, as the Primer3 manual states; CSO read 6 October 2026), confirmed here by rerunning every case that has Mg2+ with that Na+ and Mg2+ = dNTP = 0 (identical results). Tm keeps Owczarzy 2008; this conversion is only the dG card's method." }, "oracle": "primer3-py calc_heterodimer", "oracleVersion": "2.3.1 (libprimer3 release 2.6.1 (bundled with primer3-py 2.3.1))", "recordedOn": "2026-10-06", "source": "pipeline/sequence-toolkit/reference.py (hairpin-dimer)", "call": "primer3.bindings.calc_heterodimer('TAATACGACTCACTATAGGG', 'CCCTATAGTGAGTCGTATTA', mv_conc=50, dv_conc=1.5, dntp_conc=0.6, dna_conc=50, temp_c=37, max_loop=30, output_structure=True)", "notes": "perfect 20-bp duplex" }, { "id": "X02", "input": { "kind": "heterodimer", "sequences": [ "AGCTTGACCTGAAGGCATGC", "TCAGTCCATGGATGGCATGC" ], "lengths": [ 20, 20 ], "monovalent_mM": 50, "divalent_mM": 1.5, "dNTP_mM": 0.6, "sodiumEquivalent_mM": 163.84199576606164, "dna_nM": 250, "temperature_C": 37, "maxLoop": 30 }, "expected": { "structureFound": true, "dG_kcal_per_mol": -6.295416144614115, "dG_cal_per_mol": -6295.416144614115, "dH_cal_per_mol": -51400.0, "dS_cal_per_K_mol": -145.42828907104914, "structureTm_C": 14.979254174241419, "asciiStructure": [ "SEQ\tAGCTTGACCTGAAG --------------", "SEQ\t GCATGC", "STR\t CGTACG", "STR\t GTAGGTACCTGACT" ] }, "crossCheck": { "ntthalCli": { "dg_cal_per_mol": -6295.42, "dh_cal_per_mol": -51400.0, "ds_cal_per_K_mol": -145.428, "tm_C": 14.9793, "command": "ntthal -mv 50 -dv 1.5 -n 0.6 -d 250 -t 37 -a ANY -maxloop 30 -path / -s1 AGCTTGACCTGAAGGCATGC -s2 TCAGTCCATGGATGGCATGC" }, "sodiumEquivalentRerun": { "mv_conc": 163.84199576606164, "dv_conc": 0, "dntp_conc": 0, "dG_cal_per_mol": -6295.416144614115, "dH_cal_per_mol": -51400.0, "dS_cal_per_K_mol": -145.42828907104914, "structureTm_C": 14.979254174241419, "identical": true } }, "method": { "id": "santalucia-hicks-2004", "salt": "von-ahsen-2001-sodium-equivalent", "text": "Two-state nearest-neighbour thermodynamic alignment (Primer3 thal), most stable structure, dG at 37 C. Salt by the sodium equivalent Na+ + 120 sqrt(Mg2+ - dNTP) mM (von Ahsen et al., Clin Chem 2001;47:1956-1961, as the Primer3 manual states; CSO read 6 October 2026), confirmed here by rerunning every case that has Mg2+ with that Na+ and Mg2+ = dNTP = 0 (identical results). Tm keeps Owczarzy 2008; this conversion is only the dG card's method." }, "oracle": "primer3-py calc_heterodimer", "oracleVersion": "2.3.1 (libprimer3 release 2.6.1 (bundled with primer3-py 2.3.1))", "recordedOn": "2026-10-06", "source": "pipeline/sequence-toolkit/reference.py (hairpin-dimer)", "call": "primer3.bindings.calc_heterodimer('AGCTTGACCTGAAGGCATGC', 'TCAGTCCATGGATGGCATGC', mv_conc=50, dv_conc=1.5, dntp_conc=0.6, dna_conc=250, temp_c=37, max_loop=30, output_structure=True)", "notes": "primer pair with complementary 3' ends" }, { "id": "X03", "input": { "kind": "heterodimer", "sequences": [ "AAAAAAAAAAAAAAAAAAAA", "CCCCCCCCCCCCCCCCCCCC" ], "lengths": [ 20, 20 ], "monovalent_mM": 50, "divalent_mM": 1.5, "dNTP_mM": 0.6, "sodiumEquivalent_mM": 163.84199576606164, "dna_nM": 50, "temperature_C": 37, "maxLoop": 30 }, "expected": { "structureFound": false, "dG_kcal_per_mol": 0.0, "dG_cal_per_mol": 0.0, "dH_cal_per_mol": 0.0, "dS_cal_per_K_mol": 0.0, "structureTm_C": 0.0, "asciiStructure": [], "noStructureBelow_kcal_per_mol": -0.1, "assert": "the engine reports no structure with dG below -0.1 kcal/mol (CSO ruling, 6 October 2026)" }, "crossCheck": { "ntthalCli": { "structureFound": false, "output": "", "command": "ntthal -mv 50 -dv 1.5 -n 0.6 -d 50 -t 37 -a ANY -maxloop 30 -path / -s1 AAAAAAAAAAAAAAAAAAAA -s2 CCCCCCCCCCCCCCCCCCCC" }, "sodiumEquivalentRerun": { "mv_conc": 163.84199576606164, "dv_conc": 0, "dntp_conc": 0, "dG_cal_per_mol": 0.0, "dH_cal_per_mol": 0.0, "dS_cal_per_K_mol": 0.0, "structureTm_C": 0.0, "identical": true } }, "method": { "id": "santalucia-hicks-2004", "salt": "von-ahsen-2001-sodium-equivalent", "text": "Two-state nearest-neighbour thermodynamic alignment (Primer3 thal), most stable structure, dG at 37 C. Salt by the sodium equivalent Na+ + 120 sqrt(Mg2+ - dNTP) mM (von Ahsen et al., Clin Chem 2001;47:1956-1961, as the Primer3 manual states; CSO read 6 October 2026), confirmed here by rerunning every case that has Mg2+ with that Na+ and Mg2+ = dNTP = 0 (identical results). Tm keeps Owczarzy 2008; this conversion is only the dG card's method." }, "oracle": "primer3-py calc_heterodimer", "oracleVersion": "2.3.1 (libprimer3 release 2.6.1 (bundled with primer3-py 2.3.1))", "recordedOn": "2026-10-06", "source": "pipeline/sequence-toolkit/reference.py (hairpin-dimer)", "call": "primer3.bindings.calc_heterodimer('AAAAAAAAAAAAAAAAAAAA', 'CCCCCCCCCCCCCCCCCCCC', mv_conc=50, dv_conc=1.5, dntp_conc=0.6, dna_conc=50, temp_c=37, max_loop=30, output_structure=True)", "notes": "no complementarity: no structure" }, { "id": "X04", "input": { "kind": "heterodimer", "sequences": [ "GTAAAACGACGGCCAGT", "CAGGAAACAGCTATGAC" ], "lengths": [ 17, 17 ], "monovalent_mM": 50, "divalent_mM": 1.5, "dNTP_mM": 0.6, "sodiumEquivalent_mM": 163.84199576606164, "dna_nM": 50, "temperature_C": 37, "maxLoop": 30 }, "expected": { "structureFound": true, "dG_kcal_per_mol": -2.683046228927782, "dG_cal_per_mol": -2683.046228927782, "dH_cal_per_mol": -24600.0, "dS_cal_per_K_mol": -70.66565781419384, "structureTm_C": -42.872870427125406, "asciiStructure": [ "SEQ\t GTAAAACGACGG AGT", "SEQ\t CC", "STR\t GG", "STR\tCAGTATCGACAAA AC-" ] }, "crossCheck": { "ntthalCli": { "dg_cal_per_mol": -2683.05, "dh_cal_per_mol": -24600.0, "ds_cal_per_K_mol": -70.6657, "tm_C": -42.8729, "command": "ntthal -mv 50 -dv 1.5 -n 0.6 -d 50 -t 37 -a ANY -maxloop 30 -path / -s1 GTAAAACGACGGCCAGT -s2 CAGGAAACAGCTATGAC" }, "sodiumEquivalentRerun": { "mv_conc": 163.84199576606164, "dv_conc": 0, "dntp_conc": 0, "dG_cal_per_mol": -2683.046228927782, "dH_cal_per_mol": -24600.0, "dS_cal_per_K_mol": -70.66565781419384, "structureTm_C": -42.872870427125406, "identical": true } }, "method": { "id": "santalucia-hicks-2004", "salt": "von-ahsen-2001-sodium-equivalent", "text": "Two-state nearest-neighbour thermodynamic alignment (Primer3 thal), most stable structure, dG at 37 C. Salt by the sodium equivalent Na+ + 120 sqrt(Mg2+ - dNTP) mM (von Ahsen et al., Clin Chem 2001;47:1956-1961, as the Primer3 manual states; CSO read 6 October 2026), confirmed here by rerunning every case that has Mg2+ with that Na+ and Mg2+ = dNTP = 0 (identical results). Tm keeps Owczarzy 2008; this conversion is only the dG card's method." }, "oracle": "primer3-py calc_heterodimer", "oracleVersion": "2.3.1 (libprimer3 release 2.6.1 (bundled with primer3-py 2.3.1))", "recordedOn": "2026-10-06", "source": "pipeline/sequence-toolkit/reference.py (hairpin-dimer)", "call": "primer3.bindings.calc_heterodimer('GTAAAACGACGGCCAGT', 'CAGGAAACAGCTATGAC', mv_conc=50, dv_conc=1.5, dntp_conc=0.6, dna_conc=50, temp_c=37, max_loop=30, output_structure=True)", "notes": "M13 forward and reverse pair" }, { "id": "X05", "input": { "kind": "heterodimer", "sequences": [ "CGCAAATGGGCGGTAGGCGTG", "TAGAAGGCACAGTCGAGG" ], "lengths": [ 21, 18 ], "monovalent_mM": 50, "divalent_mM": 3.0, "dNTP_mM": 0.8, "sodiumEquivalent_mM": 227.9887636902959, "dna_nM": 500, "temperature_C": 37, "maxLoop": 30 }, "expected": { "structureFound": true, "dG_kcal_per_mol": -2.7107173818703996, "dG_cal_per_mol": -2710.7173818703995, "dH_cal_per_mol": -30200.0, "dS_cal_per_K_mol": -88.63221866235564, "structureTm_C": -21.941093476906133, "asciiStructure": [ "SEQ\t CGCAAA G GGTAGGCGTG", "SEQ\t TG GC", "STR\t AC CG", "STR\tGGAGCTG A GAAGAT----" ] }, "crossCheck": { "ntthalCli": { "dg_cal_per_mol": -2710.72, "dh_cal_per_mol": -30200.0, "ds_cal_per_K_mol": -88.6322, "tm_C": -21.9411, "command": "ntthal -mv 50 -dv 3.0 -n 0.8 -d 500 -t 37 -a ANY -maxloop 30 -path / -s1 CGCAAATGGGCGGTAGGCGTG -s2 TAGAAGGCACAGTCGAGG" }, "sodiumEquivalentRerun": { "mv_conc": 227.9887636902959, "dv_conc": 0, "dntp_conc": 0, "dG_cal_per_mol": -2710.7173818703995, "dH_cal_per_mol": -30200.0, "dS_cal_per_K_mol": -88.63221866235564, "structureTm_C": -21.941093476906133, "identical": true } }, "method": { "id": "santalucia-hicks-2004", "salt": "von-ahsen-2001-sodium-equivalent", "text": "Two-state nearest-neighbour thermodynamic alignment (Primer3 thal), most stable structure, dG at 37 C. Salt by the sodium equivalent Na+ + 120 sqrt(Mg2+ - dNTP) mM (von Ahsen et al., Clin Chem 2001;47:1956-1961, as the Primer3 manual states; CSO read 6 October 2026), confirmed here by rerunning every case that has Mg2+ with that Na+ and Mg2+ = dNTP = 0 (identical results). Tm keeps Owczarzy 2008; this conversion is only the dG card's method." }, "oracle": "primer3-py calc_heterodimer", "oracleVersion": "2.3.1 (libprimer3 release 2.6.1 (bundled with primer3-py 2.3.1))", "recordedOn": "2026-10-06", "source": "pipeline/sequence-toolkit/reference.py (hairpin-dimer)", "call": "primer3.bindings.calc_heterodimer('CGCAAATGGGCGGTAGGCGTG', 'TAGAAGGCACAGTCGAGG', mv_conc=50, dv_conc=3.0, dntp_conc=0.8, dna_conc=500, temp_c=37, max_loop=30, output_structure=True)", "notes": "CMV forward and BGH reverse pair" }, { "id": "X06", "input": { "kind": "heterodimer", "sequences": [ "TAATACGACTCACTATAGGG", "CCCTATAGTAAGTCGTATTA" ], "lengths": [ 20, 20 ], "monovalent_mM": 50, "divalent_mM": 1.5, "dNTP_mM": 0.6, "sodiumEquivalent_mM": 163.84199576606164, "dna_nM": 50, "temperature_C": 37, "maxLoop": 30 }, "expected": { "structureFound": true, "dG_kcal_per_mol": -12.49110212059156, "dG_cal_per_mol": -12491.10212059156, "dH_cal_per_mol": -121100.0, "dS_cal_per_K_mol": -350.1818406558389, "structureTm_C": 40.301235715325845, "asciiStructure": [ "SEQ\t C", "SEQ\tTAATACGACT ACTATAGGG", "STR\tATTATGCTGA TGATATCCC", "STR\t A" ] }, "crossCheck": { "ntthalCli": { "dg_cal_per_mol": -12491.1, "dh_cal_per_mol": -121100.0, "ds_cal_per_K_mol": -350.182, "tm_C": 40.3012, "command": "ntthal -mv 50 -dv 1.5 -n 0.6 -d 50 -t 37 -a ANY -maxloop 30 -path / -s1 TAATACGACTCACTATAGGG -s2 CCCTATAGTAAGTCGTATTA" }, "sodiumEquivalentRerun": { "mv_conc": 163.84199576606164, "dv_conc": 0, "dntp_conc": 0, "dG_cal_per_mol": -12491.10212059156, "dH_cal_per_mol": -121100.0, "dS_cal_per_K_mol": -350.1818406558389, "structureTm_C": 40.301235715325845, "identical": true } }, "method": { "id": "santalucia-hicks-2004", "salt": "von-ahsen-2001-sodium-equivalent", "text": "Two-state nearest-neighbour thermodynamic alignment (Primer3 thal), most stable structure, dG at 37 C. Salt by the sodium equivalent Na+ + 120 sqrt(Mg2+ - dNTP) mM (von Ahsen et al., Clin Chem 2001;47:1956-1961, as the Primer3 manual states; CSO read 6 October 2026), confirmed here by rerunning every case that has Mg2+ with that Na+ and Mg2+ = dNTP = 0 (identical results). Tm keeps Owczarzy 2008; this conversion is only the dG card's method." }, "oracle": "primer3-py calc_heterodimer", "oracleVersion": "2.3.1 (libprimer3 release 2.6.1 (bundled with primer3-py 2.3.1))", "recordedOn": "2026-10-06", "source": "pipeline/sequence-toolkit/reference.py (hairpin-dimer)", "call": "primer3.bindings.calc_heterodimer('TAATACGACTCACTATAGGG', 'CCCTATAGTAAGTCGTATTA', mv_conc=50, dv_conc=1.5, dntp_conc=0.6, dna_conc=50, temp_c=37, max_loop=30, output_structure=True)", "notes": "20-bp duplex with one internal C-A mismatch (position 11 of the first strand)" } ] }