{ "about": { "method": "pairwise DNA alignment (B-0; src/lib/seq/align/)", "generatedBy": "pipeline/sequence-toolkit/align_reference.py", "recordedOn": "2026-10-20", "oracle": "Biopython 1.88 Bio.Align.PairwiseAligner under the scoring below: score, co-optimal count, and every co-optimal alignment up to 20,000 for checking (1,000 listed). The tie-order alignment is checked by sorting Biopython's set under the published order, apart from the programme; the shared pairs by intersecting it; the script's own three-state programme gives the alignment, the shared pairs by path counts, the diagonals and the numbers, and must agree with all of these.", "scoring": { "name": "dna-default-1", "alphabet": "ACGTRYSWKMBDHVN", "match": 2, "mismatch": -3, "ambiguous": 0, "gapOpen": 5, "gapExtend": 2, "gapCost": "a gap of k bases costs 5 + 2(k - 1)" }, "biopythonMapping": { "substitution_matrix": "the 15 x 15 matrix above (Bio.Align.substitution_matrices.Array over ACGTRYSWKMBDHVN)", "open_gap_score": -5, "extend_gap_score": -2, "convention": "Biopython scores a gap of k as open_gap_score + (k - 1) x extend_gap_score = -(5 + 2(k - 1)): identical to ours, no conversion", "global": "mode global, every end gap at the internal scores", "semiglobal-read": "mode global; open_left_deletion_score, extend_left_deletion_score, open_right_deletion_score, extend_right_deletion_score 0 (Biopython 1.88's names for gaps in the query, the read, at its ends); the reference is the target, the read the query", "local": "mode local", "circular": "the target is the certified text (the reference and its first m - 1 + D bases); the kept count is Biopython's count on it less Biopython's count on the text from n when that optimum is equal (the alignments starting in the repeat)" }, "modes": { "global": "every end gap penalised", "semiglobal-read": "end gaps free on the read only, never on the reference", "local": "Smith-Waterman with Gotoh gaps" }, "conventions": [ "Scoring set dna-default-1: A, C, G, T against each other +2 for a match and -3 for a mismatch; a pair in which either letter is an IUPAC ambiguity code (R Y S W K M B D H V N) scores 0. A gap of k bases costs 5 + 2(k - 1), the open term charging the first base. Integers throughout.", "Letters: upper-cased; A C G T and the eleven ambiguity codes are accepted. U is read as T only in a record whose alphabet is declared rna; in any other record it refuses with its position. Any other character refuses with its position (letters).", "Modes, never chosen automatically: global (every end gap penalised as an internal one: two designs end to end); semiglobal-read (end gaps on the read are free, so the read is placed anywhere along the reference; every read base is aligned, and read bases running past a linear reference's ends are penalised); local (the best-scoring segment pair; Smith-Waterman). A local alignment starts after a cell whose pair score floors at 0, ends on a pair whose score is the optimum, and never extends through a cell already at the optimum, so it neither begins nor ends with a zero-scoring column (Biopython's rule, after Waterman and Eggert).", "Strands: the read and its reverse complement (IUPAC codes complemented) are both aligned. The higher optimum gives the strand; equal optima on the two strands are an ambiguous placement, reported with both, never resolved. Read positions are on the read as aligned (on the minus strand, its reverse complement); on the minus strand every placement, difference and overhang also carries asSupplied: the position in the read as supplied, m - p + 1, and the read's own letters there. A deletion's asSupplied.readBetween names the two supplied read positions the gap sits between; 0 and m + 1 stand for the read's ends, so [7, 8] on a 7-base read means after base 7 and [0, 1] before base 1. strandUndetermined: the optima are equal, each strand's placement is unique, and the two strands' hulls are the same interval (ACGA against ACGT scores 3 on both strands over 1-4): which strand the read came from is not determined, as against an ambiguous placement on two different stretches. The strand is none where the better strand, or either of two equal strands, places nothing (no-alignment or no-paired-letter): ambiguous names an ambiguous placement, and nothing is placed there (the CSO's re-reading of 14 October 2026, D5).", "Circular reference: one one-turn mapping on the CSO's certified text (architecture ruling of 12 October 2026, section D; the CTO's addendum, item 2): the reference followed by its first m - 1 + D bases, the circle repeated as needed. The oracle runs with D = m; with S the best score there and b = floor((2m - S) / 2) the most deletions any alignment scoring at least S can hold, D >= b certifies that every such alignment lay inside the text; if not, it reruns once with D = b, which certifies itself (certifiedText records extension, textLength, reruns and differencesUpTo). An alignment whose first reference base outside a free end gap is at index n or beyond repeats one n bases earlier and is dropped, before counting (the kept count is Biopython's count on the text less its count on the text from n, when that optimum is equal). A read longer than n refuses. global on a circular reference refuses: it has no ends. Reference coordinates are mapped back modulo n, 1-based, with crossesOrigin when the first paired base is before n and the last at or after it (a deletion or insertion crossing the origin carries it too). Coordinates on a circular reference leave out semiglobal-read's free trailing gap, whose length depends on the text searched.", "Region (the CPO's words): a chosen stretch of the reference, from and to (1-based, inclusive; on a circle from > to runs across the origin), searched as a linear stretch (the CPO's words-2, confirmed by the CSO). Global is allowed on a region shorter than the circle, which is a proper arc whose two ends the person states; a region covering the whole circle is refused, as is a read longer than the circle (the CSO's final reading of 14 October 2026, ruling 2 (3)). Positions are in the reference's own numbering; crossesOrigin is set where a placement or gap runs from the reference's last position to its first; referenceCovered is over the region's length; overhang at the region's edge carries at 'region-edge', and only overhang past a linear reference's true first or last base carries at 'reference-end'. A region outside the reference, or running backwards on a linear one, refuses (kind region).", "Refusals, in this order, the first failing: an empty read or reference; a read over 20,000 bases; a reference over 1,000,000 bases; a letter in the read, then in the reference; a region outside the reference (or backwards on a linear one); a region covering a whole circle (region-whole-circle); global on a circular reference without a region; a read longer than a circular reference, with or without a region (the CSO's final reading of 14 October 2026, ruling 2 (3)).", "Tie order (the one alignment shown): first the end. local: the lowest reference coordinate of the last pair, then the lowest read coordinate. semiglobal-read: the lowest reference coordinate at which the read's last base is placed (before the free trailing gap), then a pair before a gap in the reference. global: the corner, ending in a pair, then a gap in the read, then a gap in the reference. Then back from the end: in a pair, the previous column is a pair, then a gap in the read, then a gap in the reference; in a gap, extend the gap before opening it, then a pair, then the other gap. Only moves on a counted optimal path are taken. Preferring the pair while walking back puts an indel in a run or repeat at its leftmost reference position, on either strand. The script's programme picks it by traceback, and independently every enumerated co-optimal set is sorted by this order (a total order: the end first, then the column kinds compared back from the end, the earlier column ranked by the later column's priority list) and the first must be the programme's choice, or nothing is written.", "Co-optimal count: Biopython's count of optimal alignments (paths through its three-state Gotoh programme), with the circular rule applied; written as a string above 2^53. overCap is a count over 1,000, shown as more than 1,000, never as 1,000. Up to 20,000 the co-optimal set is enumerated for checking (enumeration 'checked'); up to 1,000 it is also listed by Biopython's coordinates in the published tie order (enumeration 'listed'); above 20,000, 'not-enumerated'.", "Shared pairs (the D-0055 pattern; the CSO's Wave 4 D2 rule): uniquePairs are the (reference position, read position) pairs held by every co-optimal alignment, in the reference's own numbering (offset by a region; modulo n on a circle, so a pair in either copy of the certified text is the same pair: the CSO's final reading of 14 October 2026, ruling 4 item 2), in read order, computed twice: from the programme (a node is common when the paths through it, its forward path count times its backward count summed over its copies on a circle, equal the total) and, where enumerated, as the intersection of the enumerated alignments' nodes; the two must agree. Every difference carries common: a substitution or ambiguity column when every co-optimal alignment pairs the same two letters; an insertion or deletion when every co-optimal alignment has the same run of columns with the same column just before and just after it (ruling 4 item 1, extending the CTO's B.8 flank rule to insertions; a run that trades with overhang or with a free end gap is not common), computed from the programme and again from the enumeration, where they must agree. A placement is unique when uniquePairs is not empty, otherwise ambiguous. placements are groups of co-optimal alignments linked by sharing a pair, each given by its hull (the union of its alignments' spans, from each one's first to its last paired base; on a circle the shortest arc holding them, wholeCircle where they cover it) and its read interval (first and last paired read position, as supplied on the minus strand), exact at any count: the programme makes one pass forward over the graph of counted optimal paths, carrying at each node the smallest first paired index of the paths reaching it and a label born at a path's first pair; labels join at a pair, at a gap node from which a pair lies ahead (the CTO's F3), and on a circle at the same pair of the reference in the other copy. Where the set is enumerated the groups must equal those of Biopython's set, with each group's size (alignments) and band. hull is the hull of every co-optimal alignment's span, as for a group. placementNotDetermined: one group and no pair common to all (the CSO's words), never in global, which says noCommonColumn instead (ruling 4 item 6). noCommonColumn (global only): no column pairing two letters is common to every co-optimal alignment. Every difference that is not common carries notFixed: from and to, the nearest pairs common to every co-optimal alignment before and after it on the shown alignment (ref, read, and readAsSupplied on the minus strand), or null where there is none. A pair column (substitution or ambiguity) is common by its own node alone, having no extent that can vary (the re-reading, D1); for an insertion or deletion, a free end gap next to the run adds no condition beyond the run's own nodes (D2). On a linear text (a linear reference, or a region of either kind) a hull runs from the least to the greatest paired position in the text's own order, given in the reference's numbering, with crossesOrigin where a region's stretch crosses the n|1 junction (D3); on the certified circle, of several equally short arcs the hull is the one that does not cross the origin, otherwise the one starting lowest.", "Section 5 read precisely (the CSO, 12 October 2026): the score and the co-optimal count are always the pair's; a number every co-optimal alignment shares may be shown as the pair's; a number that varies is shown only as the shown alignment's, with the variation said (variation gives, where enumerated, whether each of readAligned, referenceCovered, identity, overhangStart and overhangEnd (the overhang's length on each side, 0 where none) is shared, and its exact least and greatest value; nothing where the set is not enumerated); a placement with no pair common to every co-optimal alignment is ambiguous.", "Columns: every column of the alignment except semiglobal-read's free end gaps and overhang. identity = identical / (columns - ambiguousColumns): identical columns are pairs of the same base among A C G T; ambiguousColumns are pairs in which either letter is an ambiguity code, never identities and outside the denominator; gaps are in the denominator. readAligned is the read's span from its first to its last paired base, internal insertions included; referenceCovered is the reference's span from its first to its last paired base (over the reference's length). Two numbers, never one coverage.", "Overhang (semiglobal-read on a linear reference): read bases before the reference's first base or after its last are overhang, with side, length and bases. They stay penalised in the score; they are not columns, not in identity, not in either coverage, and not an insertion. In global, read bases before the first reference base remain an insertion after 0.", "Insertion position (ruling 4 item 3): refAfter is the reference position after the last reference letter consumed, a free leading gap counted; 0 means only before a linear reference's own first base; before a circle's first letter it is n with crossesOrigin; before a region it is the position before from. On a circular reference an insertion after n carries crossesOrigin, at a region's edge too: on an insertion the flag marks a place, the junction between n and 1 (the CSO's re-reading, D7); a linear reference has no junction.", "Differences, in reference coordinates: substitution (two different bases among A C G T), ambiguous (a pair with an ambiguity code; lettersCanAgree says whether the two letters' base sets meet; never counted in a total of differences), deletion (a run of reference bases against a gap in the read: refStart, refEnd), insertion (a run of read bases against a gap in the reference, after reference position refAfter; 0 only before a linear reference's own first base, as the insertion-position convention says). Free end gaps and overhang are not differences.", "States: aligned; no-alignment (local with no positive score: strand none, no numbers); no-paired-letter (semiglobal-read where any co-optimal alignment pairs no letter, the optimum being one gap of the whole read, -(5 + 2(m - 1)): the score and the full count only, no placement, hull, identity, coverage or difference, since an equally good alignment that places none of the read makes any placement a guess; ruling 4 item 4, widened by the CSO's re-reading of 14 October 2026, D4); wraps-past-one-turn (some co-optimal alignment's paired span exceeds n: the state and Biopython's block only (score, count, certified text), no placement number, since a span past one turn holds a reference position twice (the re-reading, D6); decided from the whole set by the groups' pass, which carries the longest span of any one path, not from the alignments listed); identity withheld (identityWithheld 'no-determinable-column' when columns - ambiguousColumns is 0); band-limited (a banded search that cannot assert the optimum: the state alone, its reason with values, the shared 12-base word counts and the way forward, never an alignment or a number; the values recorded here are the unbanded truth, kept for comparison).", "Band: cells are (i, j) for i = 0..N reference letters consumed (N the certified text's length when circular) and j = 0..m read letters consumed; a cell's diagonal is i - j. A placement's diagonals are the least and greatest diagonal of the cells that end the non-free columns of its alignments (with (0, 0) for global); a band holding them is accepted only when no optimal path touches its edge, so the narrowest is [min - 1, max + 1] and cellsNeeded counts its cells. Bands are per placement where the set is enumerated, else one over every optimal path. The 20,000 cells are a test budget, not the production one (10,000,000 unbanded). The reading runs one way: where cellsNeeded exceeds the budget, band-limited with no number is the only correct output; where it does not, any result given must equal the unbanded one. seedGuarantee is the CSO's Q3(c) condition 1: with b = floor((2m - S) / 2) (differencesUpTo, the most deleted letters an alignment scoring at least S can hold), every alignment scoring at least S holds an unbroken 12-base match when m > 12b + 11 (semiglobal-read) or S > 22b + 22 (local); global is not ruled. sharedWords is the CTO's unit: one per (read position, reference position) pair whose 12 letters agree, A C G T only; on a circle each reference position counts once, starts 0 to n - 1; above 100,000 it reads 100,000 with sharedWordsOverCap.", "Band flags (the CSO's F4): band.unionBandLimited is the whole set's flag, for one band over every optimal path; placements[].band.bandLimited is each group's, given where the set is enumerated. Neither is a placement: the union band of two distant groups can be over the budget when each group's band is not." ], "listUpTo": 1000, "checkUpTo": 20000, "caps": { "read": 20000, "reference": 1000000 }, "bandBudget": 20000, "coordinates": "Biopython's alignment coordinates, [[reference...], [read...]], 0-based on the reference text (the certified text when circular) and the read as aligned; free end gaps included, except semiglobal-read's trailing one on a circle.", "handWorked": "hand-deletion-in-run, worked by hand in the script's HAND_WORKED block; the script refuses to write if its derivation or Biopython disagrees.", "inputs": [ { "file": "pipeline/sequence-toolkit/inputs/nucleotide/J01636.1_1-1500.gb", "sha256": "66c2fa738e7b1d56a372b64eed078da4c2f6f91880cfd75d77a043ff55f8e386", "accession": "J01636.1" }, { "file": "pipeline/plasmid-map/records/J01566.1.gb", "sha256": "73d74a302a356f67f1b34b430b670d295230d3460c069aaa8256f5d0a8dee69b", "accession": "J01566.1" } ], "ruling": "CSO, 12 October 2026 (docs/board/memos/2026-10-12-cso-sequence-stage.md, item 1): independent, published, hashed; never generated by the engine under test.", "environment": { "image": "local", "python": "3.11.17", "biopython": "1.88", "recordedOn": "2026-10-20", "budget": "the CTO's addendum, item 12: the whole run within 15 minutes and 4 GB; measured on this run and recorded in docs/progress/sequence-dna-aligner.md (the measurement is not written here, so a rerun reproduces these bytes)" }, "crossCheck": { "tool": "the script's own three-state Gotoh programme (Python, integers)", "version": "align_reference.py", "ran": true, "kind": "a consistency check, written by the same hand as the expectations it checks; the independent oracle is Biopython", "result": "optimum and co-optimal count equal to Biopython's on every strand of every case; wherever Biopython's set is enumerated (up to 20,000), the tie-order alignment is the first of that set sorted by the published order, the shared nodes equal the set's intersection, and the diagonals equal the set's" } }, "cases": [ { "id": "hand-deletion-in-run", "note": "Worked by hand (HAND_WORKED in the script): one deleted T in a TT run, two co-optimal placements of the gap; the tie order deletes the first T.", "input": { "reference": { "residues": "GGACGTTCGTAA", "topology": "linear" }, "read": { "residues": "ACGTCGT" }, "modes": [ "global", "semiglobal-read", "local" ] }, "expected": { "results": [ { "mode": "global", "region": null, "strand": "+", "strandUndetermined": false, "plus": { "score": -5, "count": 2, "overCap": false, "state": "aligned", "biopython": { "score": -5, "count": 2 }, "uniquePairs": [ [ 3, 1 ], [ 4, 2 ], [ 5, 3 ], [ 8, 5 ], [ 9, 6 ], [ 10, 7 ] ], "uniquePlacement": true, "placementNotDetermined": false, "noCommonColumn": false, "hull": { "refStart": 3, "refEnd": 10, "crossesOrigin": false, "wholeCircle": false }, "selected": { "coordinates": [ [ 0, 2, 5, 6, 10, 12 ], [ 0, 0, 3, 3, 7, 7 ] ], "gappedReference": "GGACGTTCGTAA", "gappedRead": "--ACG-TCGT--", "columns": 12, "identical": 7, "mismatches": 0, "ambiguousColumns": 0, "gapColumns": 5, "gapOpens": 3, "identity": { "numerator": 7, "denominator": 12 }, "readAligned": { "bases": 7, "of": 7 }, "referenceCovered": { "bases": 8, "of": 12 }, "placement": { "refStart": 3, "refEnd": 10, "readStart": 1, "readEnd": 7, "crossesOrigin": false }, "overhang": [], "differences": [ { "kind": "deletion", "refStart": 1, "refEnd": 2, "length": 2, "bases": "GG", "readAfter": 0, "common": true }, { "kind": "deletion", "refStart": 6, "refEnd": 6, "length": 1, "bases": "T", "readAfter": 3, "common": false, "notFixed": { "from": { "ref": 5, "read": 3 }, "to": { "ref": 8, "read": 5 } } }, { "kind": "deletion", "refStart": 11, "refEnd": 12, "length": 2, "bases": "AA", "readAfter": 7, "common": true } ] }, "band": { "diagonalMin": 0, "diagonalMax": 5, "cellsNeeded": 62, "unionBandLimited": false, "scope": "every optimal path", "gridCells": 104, "searchedBanded": false, "sharedWords": 0, "sharedWordsOverCap": false, "seedGuarantee": { "differencesUpTo": 9, "guaranteed": false } }, "enumeration": "listed", "alignments": [ [ [ 0, 2, 5, 6, 10, 12 ], [ 0, 0, 3, 3, 7, 7 ] ], [ [ 0, 2, 6, 7, 10, 12 ], [ 0, 0, 4, 4, 7, 7 ] ] ], "tuples": [ [ 7, 0, 12, 0, 5, 3, 7, 8 ] ], "tupleFields": [ "identical", "ambiguousColumns", "columns", "mismatches", "gapColumns", "gapOpens", "readAligned", "referenceCovered" ], "variation": { "readAligned": { "shared": true, "min": 7, "max": 7 }, "referenceCovered": { "shared": true, "min": 8, "max": 8 }, "identity": { "shared": true, "min": { "numerator": 7, "denominator": 12 }, "max": { "numerator": 7, "denominator": 12 } }, "overhangStart": { "shared": true, "min": 0, "max": 0 }, "overhangEnd": { "shared": true, "min": 0, "max": 0 } }, "placements": [ { "refStart": 3, "refEnd": 10, "crossesOrigin": false, "wholeCircle": false, "readStart": 1, "readEnd": 7, "alignments": 2, "band": { "diagonalMin": 0, "diagonalMax": 5, "cellsNeeded": 62, "bandLimited": false } } ] }, "minus": { "score": -10, "count": 2, "overCap": false, "state": "aligned", "biopython": { "score": -10, "count": 2 }, "uniquePairs": [ [ 3, 1 ], [ 4, 2 ], [ 5, 3 ], [ 8, 5 ], [ 9, 6 ], [ 10, 7 ] ], "uniquePlacement": true, "placementNotDetermined": false, "noCommonColumn": false, "hull": { "refStart": 3, "refEnd": 10, "crossesOrigin": false, "wholeCircle": false }, "selected": { "coordinates": [ [ 0, 2, 5, 6, 10, 12 ], [ 0, 0, 3, 3, 7, 7 ] ], "gappedReference": "GGACGTTCGTAA", "gappedRead": "--ACG-ACGT--", "columns": 12, "identical": 6, "mismatches": 1, "ambiguousColumns": 0, "gapColumns": 5, "gapOpens": 3, "identity": { "numerator": 6, "denominator": 12 }, "readAligned": { "bases": 7, "of": 7 }, "referenceCovered": { "bases": 8, "of": 12 }, "placement": { "refStart": 3, "refEnd": 10, "readStart": 1, "readEnd": 7, "crossesOrigin": false, "asSupplied": { "readStart": 1, "readEnd": 7 } }, "overhang": [], "differences": [ { "kind": "deletion", "refStart": 1, "refEnd": 2, "length": 2, "bases": "GG", "readAfter": 0, "asSupplied": { "readBetween": [ 7, 8 ] }, "common": true }, { "kind": "deletion", "refStart": 6, "refEnd": 6, "length": 1, "bases": "T", "readAfter": 3, "asSupplied": { "readBetween": [ 4, 5 ] }, "common": false, "notFixed": { "from": { "ref": 5, "read": 3, "readAsSupplied": 5 }, "to": { "ref": 8, "read": 5, "readAsSupplied": 3 } } }, { "kind": "substitution", "ref": 7, "refBase": "T", "readBase": "A", "read": 4, "common": false, "notFixed": { "from": { "ref": 5, "read": 3, "readAsSupplied": 5 }, "to": { "ref": 8, "read": 5, "readAsSupplied": 3 } }, "asSupplied": { "read": 4, "readBase": "T" } }, { "kind": "deletion", "refStart": 11, "refEnd": 12, "length": 2, "bases": "AA", "readAfter": 7, "asSupplied": { "readBetween": [ 0, 1 ] }, "common": true } ] }, "band": { "diagonalMin": 0, "diagonalMax": 5, "cellsNeeded": 62, "unionBandLimited": false, "scope": "every optimal path", "gridCells": 104, "searchedBanded": false, "sharedWords": 0, "sharedWordsOverCap": false, "seedGuarantee": { "differencesUpTo": 12, "guaranteed": false } }, "enumeration": "listed", "alignments": [ [ [ 0, 2, 5, 6, 10, 12 ], [ 0, 0, 3, 3, 7, 7 ] ], [ [ 0, 2, 6, 7, 10, 12 ], [ 0, 0, 4, 4, 7, 7 ] ] ], "tuples": [ [ 6, 0, 12, 1, 5, 3, 7, 8 ] ], "tupleFields": [ "identical", "ambiguousColumns", "columns", "mismatches", "gapColumns", "gapOpens", "readAligned", "referenceCovered" ], "variation": { "readAligned": { "shared": true, "min": 7, "max": 7 }, "referenceCovered": { "shared": true, "min": 8, "max": 8 }, "identity": { "shared": true, "min": { "numerator": 1, "denominator": 2 }, "max": { "numerator": 1, "denominator": 2 } }, "overhangStart": { "shared": true, "min": 0, "max": 0 }, "overhangEnd": { "shared": true, "min": 0, "max": 0 } }, "placements": [ { "refStart": 3, "refEnd": 10, "crossesOrigin": false, "wholeCircle": false, "readStart": 1, "readEnd": 7, "asSupplied": { "readStart": 1, "readEnd": 7 }, "alignments": 2, "band": { "diagonalMin": 0, "diagonalMax": 5, "cellsNeeded": 62, "bandLimited": false } } ] } }, { "mode": "semiglobal-read", "region": null, "strand": "+", "strandUndetermined": false, "plus": { "score": 9, "count": 2, "overCap": false, "state": "aligned", "biopython": { "score": 9, "count": 2 }, "uniquePairs": [ [ 3, 1 ], [ 4, 2 ], [ 5, 3 ], [ 8, 5 ], [ 9, 6 ], [ 10, 7 ] ], "uniquePlacement": true, "placementNotDetermined": false, "noCommonColumn": false, "hull": { "refStart": 3, "refEnd": 10, "crossesOrigin": false, "wholeCircle": false }, "selected": { "coordinates": [ [ 0, 2, 5, 6, 10, 12 ], [ 0, 0, 3, 3, 7, 7 ] ], "gappedReference": "ACGTTCGT", "gappedRead": "ACG-TCGT", "columns": 8, "identical": 7, "mismatches": 0, "ambiguousColumns": 0, "gapColumns": 1, "gapOpens": 1, "identity": { "numerator": 7, "denominator": 8 }, "readAligned": { "bases": 7, "of": 7 }, "referenceCovered": { "bases": 8, "of": 12 }, "placement": { "refStart": 3, "refEnd": 10, "readStart": 1, "readEnd": 7, "crossesOrigin": false }, "overhang": [], "differences": [ { "kind": "deletion", "refStart": 6, "refEnd": 6, "length": 1, "bases": "T", "readAfter": 3, "common": false, "notFixed": { "from": { "ref": 5, "read": 3 }, "to": { "ref": 8, "read": 5 } } } ] }, "band": { "diagonalMin": 2, "diagonalMax": 3, "cellsNeeded": 32, "unionBandLimited": false, "scope": "every optimal path", "gridCells": 104, "searchedBanded": false, "sharedWords": 0, "sharedWordsOverCap": false, "seedGuarantee": { "differencesUpTo": 2, "guaranteed": false } }, "enumeration": "listed", "alignments": [ [ [ 0, 2, 5, 6, 10, 12 ], [ 0, 0, 3, 3, 7, 7 ] ], [ [ 0, 2, 6, 7, 10, 12 ], [ 0, 0, 4, 4, 7, 7 ] ] ], "tuples": [ [ 7, 0, 8, 0, 1, 1, 7, 8 ] ], "tupleFields": [ "identical", "ambiguousColumns", "columns", "mismatches", "gapColumns", "gapOpens", "readAligned", "referenceCovered" ], "variation": { "readAligned": { "shared": true, "min": 7, "max": 7 }, "referenceCovered": { "shared": true, "min": 8, "max": 8 }, "identity": { "shared": true, "min": { "numerator": 7, "denominator": 8 }, "max": { "numerator": 7, "denominator": 8 } }, "overhangStart": { "shared": true, "min": 0, "max": 0 }, "overhangEnd": { "shared": true, "min": 0, "max": 0 } }, "placements": [ { "refStart": 3, "refEnd": 10, "crossesOrigin": false, "wholeCircle": false, "readStart": 1, "readEnd": 7, "alignments": 2, "band": { "diagonalMin": 2, "diagonalMax": 3, "cellsNeeded": 32, "bandLimited": false } } ] }, "minus": { "score": 4, "count": 2, "overCap": false, "state": "aligned", "biopython": { "score": 4, "count": 2 }, "uniquePairs": [ [ 3, 1 ], [ 4, 2 ], [ 5, 3 ], [ 8, 5 ], [ 9, 6 ], [ 10, 7 ] ], "uniquePlacement": true, "placementNotDetermined": false, "noCommonColumn": false, "hull": { "refStart": 3, "refEnd": 10, "crossesOrigin": false, "wholeCircle": false }, "selected": { "coordinates": [ [ 0, 2, 5, 6, 10, 12 ], [ 0, 0, 3, 3, 7, 7 ] ], "gappedReference": "ACGTTCGT", "gappedRead": "ACG-ACGT", "columns": 8, "identical": 6, "mismatches": 1, "ambiguousColumns": 0, "gapColumns": 1, "gapOpens": 1, "identity": { "numerator": 6, "denominator": 8 }, "readAligned": { "bases": 7, "of": 7 }, "referenceCovered": { "bases": 8, "of": 12 }, "placement": { "refStart": 3, "refEnd": 10, "readStart": 1, "readEnd": 7, "crossesOrigin": false, "asSupplied": { "readStart": 1, "readEnd": 7 } }, "overhang": [], "differences": [ { "kind": "deletion", "refStart": 6, "refEnd": 6, "length": 1, "bases": "T", "readAfter": 3, "asSupplied": { "readBetween": [ 4, 5 ] }, "common": false, "notFixed": { "from": { "ref": 5, "read": 3, "readAsSupplied": 5 }, "to": { "ref": 8, "read": 5, "readAsSupplied": 3 } } }, { "kind": "substitution", "ref": 7, "refBase": "T", "readBase": "A", "read": 4, "common": false, "notFixed": { "from": { "ref": 5, "read": 3, "readAsSupplied": 5 }, "to": { "ref": 8, "read": 5, "readAsSupplied": 3 } }, "asSupplied": { "read": 4, "readBase": "T" } } ] }, "band": { "diagonalMin": 2, "diagonalMax": 3, "cellsNeeded": 32, "unionBandLimited": false, "scope": "every optimal path", "gridCells": 104, "searchedBanded": false, "sharedWords": 0, "sharedWordsOverCap": false, "seedGuarantee": { "differencesUpTo": 5, "guaranteed": false } }, "enumeration": "listed", "alignments": [ [ [ 0, 2, 5, 6, 10, 12 ], [ 0, 0, 3, 3, 7, 7 ] ], [ [ 0, 2, 6, 7, 10, 12 ], [ 0, 0, 4, 4, 7, 7 ] ] ], "tuples": [ [ 6, 0, 8, 1, 1, 1, 7, 8 ] ], "tupleFields": [ "identical", "ambiguousColumns", "columns", "mismatches", "gapColumns", "gapOpens", "readAligned", "referenceCovered" ], "variation": { "readAligned": { "shared": true, "min": 7, "max": 7 }, "referenceCovered": { "shared": true, "min": 8, "max": 8 }, "identity": { "shared": true, "min": { "numerator": 3, "denominator": 4 }, "max": { "numerator": 3, "denominator": 4 } }, "overhangStart": { "shared": true, "min": 0, "max": 0 }, "overhangEnd": { "shared": true, "min": 0, "max": 0 } }, "placements": [ { "refStart": 3, "refEnd": 10, "crossesOrigin": false, "wholeCircle": false, "readStart": 1, "readEnd": 7, "asSupplied": { "readStart": 1, "readEnd": 7 }, "alignments": 2, "band": { "diagonalMin": 2, "diagonalMax": 3, "cellsNeeded": 32, "bandLimited": false } } ] } }, { "mode": "local", "region": null, "strand": "-", "strandUndetermined": false, "plus": { "score": 9, "count": 2, "overCap": false, "state": "aligned", "biopython": { "score": 9, "count": 2 }, "uniquePairs": [ [ 3, 1 ], [ 4, 2 ], [ 5, 3 ], [ 8, 5 ], [ 9, 6 ], [ 10, 7 ] ], "uniquePlacement": true, "placementNotDetermined": false, "noCommonColumn": false, "hull": { "refStart": 3, "refEnd": 10, "crossesOrigin": false, "wholeCircle": false }, "selected": { "coordinates": [ [ 2, 5, 6, 10 ], [ 0, 3, 3, 7 ] ], "gappedReference": "ACGTTCGT", "gappedRead": "ACG-TCGT", "columns": 8, "identical": 7, "mismatches": 0, "ambiguousColumns": 0, "gapColumns": 1, "gapOpens": 1, "identity": { "numerator": 7, "denominator": 8 }, "readAligned": { "bases": 7, "of": 7 }, "referenceCovered": { "bases": 8, "of": 12 }, "placement": { "refStart": 3, "refEnd": 10, "readStart": 1, "readEnd": 7, "crossesOrigin": false }, "overhang": [], "differences": [ { "kind": "deletion", "refStart": 6, "refEnd": 6, "length": 1, "bases": "T", "readAfter": 3, "common": false, "notFixed": { "from": { "ref": 5, "read": 3 }, "to": { "ref": 8, "read": 5 } } } ] }, "band": { "diagonalMin": 2, "diagonalMax": 3, "cellsNeeded": 32, "unionBandLimited": false, "scope": "every optimal path", "gridCells": 104, "searchedBanded": false, "sharedWords": 0, "sharedWordsOverCap": false, "seedGuarantee": { "differencesUpTo": 2, "guaranteed": false } }, "enumeration": "listed", "alignments": [ [ [ 2, 5, 6, 10 ], [ 0, 3, 3, 7 ] ], [ [ 2, 6, 7, 10 ], [ 0, 4, 4, 7 ] ] ], "tuples": [ [ 7, 0, 8, 0, 1, 1, 7, 8 ] ], "tupleFields": [ "identical", "ambiguousColumns", "columns", "mismatches", "gapColumns", "gapOpens", "readAligned", "referenceCovered" ], "variation": { "readAligned": { "shared": true, "min": 7, "max": 7 }, "referenceCovered": { "shared": true, "min": 8, "max": 8 }, "identity": { "shared": true, "min": { "numerator": 7, "denominator": 8 }, "max": { "numerator": 7, "denominator": 8 } }, "overhangStart": { "shared": true, "min": 0, "max": 0 }, "overhangEnd": { "shared": true, "min": 0, "max": 0 } }, "placements": [ { "refStart": 3, "refEnd": 10, "crossesOrigin": false, "wholeCircle": false, "readStart": 1, "readEnd": 7, "alignments": 2, "band": { "diagonalMin": 2, "diagonalMax": 3, "cellsNeeded": 32, "bandLimited": false } } ] }, "minus": { "score": 10, "count": 1, "overCap": false, "state": "aligned", "biopython": { "score": 10, "count": 1 }, "uniquePairs": [ [ 2, 3 ], [ 3, 4 ], [ 4, 5 ], [ 5, 6 ], [ 6, 7 ] ], "uniquePlacement": true, "placementNotDetermined": false, "noCommonColumn": false, "hull": { "refStart": 2, "refEnd": 6, "crossesOrigin": false, "wholeCircle": false }, "selected": { "coordinates": [ [ 1, 6 ], [ 2, 7 ] ], "gappedReference": "GACGT", "gappedRead": "GACGT", "columns": 5, "identical": 5, "mismatches": 0, "ambiguousColumns": 0, "gapColumns": 0, "gapOpens": 0, "identity": { "numerator": 5, "denominator": 5 }, "readAligned": { "bases": 5, "of": 7 }, "referenceCovered": { "bases": 5, "of": 12 }, "placement": { "refStart": 2, "refEnd": 6, "readStart": 3, "readEnd": 7, "crossesOrigin": false, "asSupplied": { "readStart": 1, "readEnd": 5 } }, "overhang": [], "differences": [] }, "band": { "diagonalMin": -1, "diagonalMax": -1, "cellsNeeded": 21, "unionBandLimited": false, "scope": "every optimal path", "gridCells": 104, "searchedBanded": false, "sharedWords": 0, "sharedWordsOverCap": false, "seedGuarantee": { "differencesUpTo": 2, "guaranteed": false } }, "enumeration": "listed", "alignments": [ [ [ 1, 6 ], [ 2, 7 ] ] ], "tuples": [ [ 5, 0, 5, 0, 0, 0, 5, 5 ] ], "tupleFields": [ "identical", "ambiguousColumns", "columns", "mismatches", "gapColumns", "gapOpens", "readAligned", "referenceCovered" ], "variation": { "readAligned": { "shared": true, "min": 5, "max": 5 }, "referenceCovered": { "shared": true, "min": 5, "max": 5 }, "identity": { "shared": true, "min": { "numerator": 1, "denominator": 1 }, "max": { "numerator": 1, "denominator": 1 } }, "overhangStart": { "shared": true, "min": 0, "max": 0 }, "overhangEnd": { "shared": true, "min": 0, "max": 0 } }, "placements": [ { "refStart": 2, "refEnd": 6, "crossesOrigin": false, "wholeCircle": false, "readStart": 3, "readEnd": 7, "asSupplied": { "readStart": 1, "readEnd": 5 }, "alignments": 1, "band": { "diagonalMin": -1, "diagonalMax": -1, "cellsNeeded": 21, "bandLimited": false } } ] } } ] } }, { "id": "ties-homopolymer", "note": "A run of 12 A in the reference read as 9: the 3-base deletion can sit anywhere in the run.", "input": { "reference": { "residues": "GCTAGCATAAAAAAAAAAAACGTCAGTG", "topology": "linear" }, "read": { "residues": "TAGCATAAAAAAAAACGTCAG" }, "modes": [ "global", "semiglobal-read", "local" ] }, "expected": { "results": [ { "mode": "global", "region": null, "strand": "+", "strandUndetermined": false, "plus": { "score": 19, "count": 20, "overCap": false, "state": "aligned", "biopython": { "score": 19, "count": 20 }, "uniquePairs": [ [ 3, 1 ], [ 4, 2 ], [ 5, 3 ], [ 6, 4 ], [ 7, 5 ], [ 8, 6 ], [ 21, 16 ], [ 22, 17 ], [ 23, 18 ], [ 24, 19 ], [ 25, 20 ] ], "uniquePlacement": true, "placementNotDetermined": false, "noCommonColumn": false, "hull": { "refStart": 3, "refEnd": 28, "crossesOrigin": false, "wholeCircle": false }, "selected": { "coordinates": [ [ 0, 2, 8, 11, 25, 27, 28 ], [ 0, 0, 6, 6, 20, 20, 21 ] ], "gappedReference": "GCTAGCATAAAAAAAAAAAACGTCAGTG", "gappedRead": "--TAGCAT---AAAAAAAAACGTCA--G", "columns": 28, "identical": 21, "mismatches": 0, "ambiguousColumns": 0, "gapColumns": 7, "gapOpens": 3, "identity": { "numerator": 21, "denominator": 28 }, "readAligned": { "bases": 21, "of": 21 }, "referenceCovered": { "bases": 26, "of": 28 }, "placement": { "refStart": 3, "refEnd": 28, "readStart": 1, "readEnd": 21, "crossesOrigin": false }, "overhang": [], "differences": [ { "kind": "deletion", "refStart": 1, "refEnd": 2, "length": 2, "bases": "GC", "readAfter": 0, "common": true }, { "kind": "deletion", "refStart": 9, "refEnd": 11, "length": 3, "bases": "AAA", "readAfter": 6, "common": false, "notFixed": { "from": { "ref": 8, "read": 6 }, "to": { "ref": 21, "read": 16 } } }, { "kind": "deletion", "refStart": 26, "refEnd": 27, "length": 2, "bases": "GT", "readAfter": 20, "common": false, "notFixed": { "from": { "ref": 25, "read": 20 }, "to": null } } ] }, "band": { "diagonalMin": 0, "diagonalMax": 7, "cellsNeeded": 218, "unionBandLimited": false, "scope": "every optimal path", "gridCells": 638, "searchedBanded": false, "sharedWords": 8, "sharedWordsOverCap": false, "seedGuarantee": { "differencesUpTo": 11, "guaranteed": false } }, "enumeration": "listed", "alignments": [ [ [ 0, 2, 8, 11, 25, 27, 28 ], [ 0, 0, 6, 6, 20, 20, 21 ] ], [ [ 0, 2, 9, 12, 25, 27, 28 ], [ 0, 0, 7, 7, 20, 20, 21 ] ], [ [ 0, 2, 10, 13, 25, 27, 28 ], [ 0, 0, 8, 8, 20, 20, 21 ] ], [ [ 0, 2, 11, 14, 25, 27, 28 ], [ 0, 0, 9, 9, 20, 20, 21 ] ], [ [ 0, 2, 12, 15, 25, 27, 28 ], [ 0, 0, 10, 10, 20, 20, 21 ] ], [ [ 0, 2, 13, 16, 25, 27, 28 ], [ 0, 0, 11, 11, 20, 20, 21 ] ], [ [ 0, 2, 14, 17, 25, 27, 28 ], [ 0, 0, 12, 12, 20, 20, 21 ] ], [ [ 0, 2, 15, 18, 25, 27, 28 ], [ 0, 0, 13, 13, 20, 20, 21 ] ], [ [ 0, 2, 16, 19, 25, 27, 28 ], [ 0, 0, 14, 14, 20, 20, 21 ] ], [ [ 0, 2, 17, 20, 25, 27, 28 ], [ 0, 0, 15, 15, 20, 20, 21 ] ], [ [ 0, 2, 8, 11, 26, 28 ], [ 0, 0, 6, 6, 21, 21 ] ], [ [ 0, 2, 9, 12, 26, 28 ], [ 0, 0, 7, 7, 21, 21 ] ], [ [ 0, 2, 10, 13, 26, 28 ], [ 0, 0, 8, 8, 21, 21 ] ], [ [ 0, 2, 11, 14, 26, 28 ], [ 0, 0, 9, 9, 21, 21 ] ], [ [ 0, 2, 12, 15, 26, 28 ], [ 0, 0, 10, 10, 21, 21 ] ], [ [ 0, 2, 13, 16, 26, 28 ], [ 0, 0, 11, 11, 21, 21 ] ], [ [ 0, 2, 14, 17, 26, 28 ], [ 0, 0, 12, 12, 21, 21 ] ], [ [ 0, 2, 15, 18, 26, 28 ], [ 0, 0, 13, 13, 21, 21 ] ], [ [ 0, 2, 16, 19, 26, 28 ], [ 0, 0, 14, 14, 21, 21 ] ], [ [ 0, 2, 17, 20, 26, 28 ], [ 0, 0, 15, 15, 21, 21 ] ] ], "tuples": [ [ 21, 0, 28, 0, 7, 3, 21, 24 ], [ 21, 0, 28, 0, 7, 3, 21, 26 ] ], "tupleFields": [ "identical", "ambiguousColumns", "columns", "mismatches", "gapColumns", "gapOpens", "readAligned", "referenceCovered" ], "variation": { "readAligned": { "shared": true, "min": 21, "max": 21 }, "referenceCovered": { "shared": false, "min": 24, "max": 26 }, "identity": { "shared": true, "min": { "numerator": 3, "denominator": 4 }, "max": { "numerator": 3, "denominator": 4 } }, "overhangStart": { "shared": true, "min": 0, "max": 0 }, "overhangEnd": { "shared": true, "min": 0, "max": 0 } }, "placements": [ { "refStart": 3, "refEnd": 28, "crossesOrigin": false, "wholeCircle": false, "readStart": 1, "readEnd": 21, "alignments": 20, "band": { "diagonalMin": 0, "diagonalMax": 7, "cellsNeeded": 218, "bandLimited": false } } ] }, "minus": { "score": -49, "count": 11, "overCap": false, "state": "aligned", "biopython": { "score": -49, "count": 11 }, "uniquePairs": [ [ 2, 1 ], [ 3, 2 ], [ 4, 3 ], [ 5, 4 ], [ 6, 5 ], [ 7, 6 ], [ 8, 7 ], [ 22, 18 ], [ 24, 19 ], [ 27, 20 ], [ 28, 21 ] ], "uniquePlacement": true, "placementNotDetermined": false, "noCommonColumn": false, "hull": { "refStart": 2, "refEnd": 28, "crossesOrigin": false, "wholeCircle": false }, "selected": { "coordinates": [ [ 0, 1, 8, 11, 22, 23, 24, 26, 28 ], [ 0, 0, 7, 7, 18, 18, 19, 19, 21 ] ], "gappedReference": "GCTAGCATAAAAAAAAAAAACGTCAGTG", "gappedRead": "-CTGACGT---TTTTTTTTATG-C--TA", "columns": 28, "identical": 8, "mismatches": 13, "ambiguousColumns": 0, "gapColumns": 7, "gapOpens": 4, "identity": { "numerator": 8, "denominator": 28 }, "readAligned": { "bases": 21, "of": 21 }, "referenceCovered": { "bases": 27, "of": 28 }, "placement": { "refStart": 2, "refEnd": 28, "readStart": 1, "readEnd": 21, "crossesOrigin": false, "asSupplied": { "readStart": 1, "readEnd": 21 } }, "overhang": [], "differences": [ { "kind": "deletion", "refStart": 1, "refEnd": 1, "length": 1, "bases": "G", "readAfter": 0, "asSupplied": { "readBetween": [ 21, 22 ] }, "common": true }, { "kind": "substitution", "ref": 4, "refBase": "A", "readBase": "G", "read": 3, "common": true, "asSupplied": { "read": 19, "readBase": "C" } }, { "kind": "substitution", "ref": 5, "refBase": "G", "readBase": "A", "read": 4, "common": true, "asSupplied": { "read": 18, "readBase": "T" } }, { "kind": "substitution", "ref": 7, "refBase": "A", "readBase": "G", "read": 6, "common": true, "asSupplied": { "read": 16, "readBase": "C" } }, { "kind": "deletion", "refStart": 9, "refEnd": 11, "length": 3, "bases": "AAA", "readAfter": 7, "asSupplied": { "readBetween": [ 14, 15 ] }, "common": false, "notFixed": { "from": { "ref": 8, "read": 7, "readAsSupplied": 15 }, "to": { "ref": 22, "read": 18, "readAsSupplied": 4 } } }, { "kind": "substitution", "ref": 12, "refBase": "A", "readBase": "T", "read": 8, "common": false, "notFixed": { "from": { "ref": 8, "read": 7, "readAsSupplied": 15 }, "to": { "ref": 22, "read": 18, "readAsSupplied": 4 } }, "asSupplied": { "read": 14, "readBase": "A" } }, { "kind": "substitution", "ref": 13, "refBase": "A", "readBase": "T", "read": 9, "common": false, "notFixed": { "from": { "ref": 8, "read": 7, "readAsSupplied": 15 }, "to": { "ref": 22, "read": 18, "readAsSupplied": 4 } }, "asSupplied": { "read": 13, "readBase": "A" } }, { "kind": "substitution", "ref": 14, "refBase": "A", "readBase": "T", "read": 10, "common": false, "notFixed": { "from": { "ref": 8, "read": 7, "readAsSupplied": 15 }, "to": { "ref": 22, "read": 18, "readAsSupplied": 4 } }, "asSupplied": { "read": 12, "readBase": "A" } }, { "kind": "substitution", "ref": 15, "refBase": "A", "readBase": "T", "read": 11, "common": false, "notFixed": { "from": { "ref": 8, "read": 7, "readAsSupplied": 15 }, "to": { "ref": 22, "read": 18, "readAsSupplied": 4 } }, "asSupplied": { "read": 11, "readBase": "A" } }, { "kind": "substitution", "ref": 16, "refBase": "A", "readBase": "T", "read": 12, "common": false, "notFixed": { "from": { "ref": 8, "read": 7, "readAsSupplied": 15 }, "to": { "ref": 22, "read": 18, "readAsSupplied": 4 } }, "asSupplied": { "read": 10, "readBase": "A" } }, { "kind": "substitution", "ref": 17, "refBase": "A", "readBase": "T", "read": 13, "common": false, "notFixed": { "from": { "ref": 8, "read": 7, "readAsSupplied": 15 }, "to": { "ref": 22, "read": 18, "readAsSupplied": 4 } }, "asSupplied": { "read": 9, "readBase": "A" } }, { "kind": "substitution", "ref": 18, "refBase": "A", "readBase": "T", "read": 14, "common": false, "notFixed": { "from": { "ref": 8, "read": 7, "readAsSupplied": 15 }, "to": { "ref": 22, "read": 18, "readAsSupplied": 4 } }, "asSupplied": { "read": 8, "readBase": "A" } }, { "kind": "substitution", "ref": 19, "refBase": "A", "readBase": "T", "read": 15, "common": false, "notFixed": { "from": { "ref": 8, "read": 7, "readAsSupplied": 15 }, "to": { "ref": 22, "read": 18, "readAsSupplied": 4 } }, "asSupplied": { "read": 7, "readBase": "A" } }, { "kind": "substitution", "ref": 21, "refBase": "C", "readBase": "T", "read": 17, "common": false, "notFixed": { "from": { "ref": 8, "read": 7, "readAsSupplied": 15 }, "to": { "ref": 22, "read": 18, "readAsSupplied": 4 } }, "asSupplied": { "read": 5, "readBase": "A" } }, { "kind": "deletion", "refStart": 23, "refEnd": 23, "length": 1, "bases": "T", "readAfter": 18, "asSupplied": { "readBetween": [ 3, 4 ] }, "common": true }, { "kind": "deletion", "refStart": 25, "refEnd": 26, "length": 2, "bases": "AG", "readAfter": 19, "asSupplied": { "readBetween": [ 2, 3 ] }, "common": true }, { "kind": "substitution", "ref": 28, "refBase": "G", "readBase": "A", "read": 21, "common": true, "asSupplied": { "read": 1, "readBase": "T" } } ] }, "band": { "diagonalMin": 0, "diagonalMax": 7, "cellsNeeded": 218, "unionBandLimited": false, "scope": "every optimal path", "gridCells": 638, "searchedBanded": false, "sharedWords": 0, "sharedWordsOverCap": false, "seedGuarantee": { "differencesUpTo": 45, "guaranteed": false } }, "enumeration": "listed", "alignments": [ [ [ 0, 1, 8, 11, 22, 23, 24, 26, 28 ], [ 0, 0, 7, 7, 18, 18, 19, 19, 21 ] ], [ [ 0, 1, 9, 12, 22, 23, 24, 26, 28 ], [ 0, 0, 8, 8, 18, 18, 19, 19, 21 ] ], [ [ 0, 1, 10, 13, 22, 23, 24, 26, 28 ], [ 0, 0, 9, 9, 18, 18, 19, 19, 21 ] ], [ [ 0, 1, 11, 14, 22, 23, 24, 26, 28 ], [ 0, 0, 10, 10, 18, 18, 19, 19, 21 ] ], [ [ 0, 1, 12, 15, 22, 23, 24, 26, 28 ], [ 0, 0, 11, 11, 18, 18, 19, 19, 21 ] ], [ [ 0, 1, 13, 16, 22, 23, 24, 26, 28 ], [ 0, 0, 12, 12, 18, 18, 19, 19, 21 ] ], [ [ 0, 1, 14, 17, 22, 23, 24, 26, 28 ], [ 0, 0, 13, 13, 18, 18, 19, 19, 21 ] ], [ [ 0, 1, 15, 18, 22, 23, 24, 26, 28 ], [ 0, 0, 14, 14, 18, 18, 19, 19, 21 ] ], [ [ 0, 1, 16, 19, 22, 23, 24, 26, 28 ], [ 0, 0, 15, 15, 18, 18, 19, 19, 21 ] ], [ [ 0, 1, 17, 20, 22, 23, 24, 26, 28 ], [ 0, 0, 16, 16, 18, 18, 19, 19, 21 ] ], [ [ 0, 1, 18, 21, 22, 23, 24, 26, 28 ], [ 0, 0, 17, 17, 18, 18, 19, 19, 21 ] ] ], "tuples": [ [ 8, 0, 28, 13, 7, 4, 21, 27 ] ], "tupleFields": [ "identical", "ambiguousColumns", "columns", "mismatches", "gapColumns", "gapOpens", "readAligned", "referenceCovered" ], "variation": { "readAligned": { "shared": true, "min": 21, "max": 21 }, "referenceCovered": { "shared": true, "min": 27, "max": 27 }, "identity": { "shared": true, "min": { "numerator": 2, "denominator": 7 }, "max": { "numerator": 2, "denominator": 7 } }, "overhangStart": { "shared": true, "min": 0, "max": 0 }, "overhangEnd": { "shared": true, "min": 0, "max": 0 } }, "placements": [ { "refStart": 2, "refEnd": 28, "crossesOrigin": false, "wholeCircle": false, "readStart": 1, "readEnd": 21, "asSupplied": { "readStart": 1, "readEnd": 21 }, "alignments": 11, "band": { "diagonalMin": 0, "diagonalMax": 7, "cellsNeeded": 218, "bandLimited": false } } ] } }, { "mode": "semiglobal-read", "region": null, "strand": "+", "strandUndetermined": false, "plus": { "score": 33, "count": 10, "overCap": false, "state": "aligned", "biopython": { "score": 33, "count": 10 }, "uniquePairs": [ [ 3, 1 ], [ 4, 2 ], [ 5, 3 ], [ 6, 4 ], [ 7, 5 ], [ 8, 6 ], [ 21, 16 ], [ 22, 17 ], [ 23, 18 ], [ 24, 19 ], [ 25, 20 ], [ 26, 21 ] ], "uniquePlacement": true, "placementNotDetermined": false, "noCommonColumn": false, "hull": { "refStart": 3, "refEnd": 26, "crossesOrigin": false, "wholeCircle": false }, "selected": { "coordinates": [ [ 0, 2, 8, 11, 26, 28 ], [ 0, 0, 6, 6, 21, 21 ] ], "gappedReference": "TAGCATAAAAAAAAAAAACGTCAG", "gappedRead": "TAGCAT---AAAAAAAAACGTCAG", "columns": 24, "identical": 21, "mismatches": 0, "ambiguousColumns": 0, "gapColumns": 3, "gapOpens": 1, "identity": { "numerator": 21, "denominator": 24 }, "readAligned": { "bases": 21, "of": 21 }, "referenceCovered": { "bases": 24, "of": 28 }, "placement": { "refStart": 3, "refEnd": 26, "readStart": 1, "readEnd": 21, "crossesOrigin": false }, "overhang": [], "differences": [ { "kind": "deletion", "refStart": 9, "refEnd": 11, "length": 3, "bases": "AAA", "readAfter": 6, "common": false, "notFixed": { "from": { "ref": 8, "read": 6 }, "to": { "ref": 21, "read": 16 } } } ] }, "band": { "diagonalMin": 2, "diagonalMax": 5, "cellsNeeded": 132, "unionBandLimited": false, "scope": "every optimal path", "gridCells": 638, "searchedBanded": false, "sharedWords": 8, "sharedWordsOverCap": false, "seedGuarantee": { "differencesUpTo": 4, "guaranteed": false } }, "enumeration": "listed", "alignments": [ [ [ 0, 2, 8, 11, 26, 28 ], [ 0, 0, 6, 6, 21, 21 ] ], [ [ 0, 2, 9, 12, 26, 28 ], [ 0, 0, 7, 7, 21, 21 ] ], [ [ 0, 2, 10, 13, 26, 28 ], [ 0, 0, 8, 8, 21, 21 ] ], [ [ 0, 2, 11, 14, 26, 28 ], [ 0, 0, 9, 9, 21, 21 ] ], [ [ 0, 2, 12, 15, 26, 28 ], [ 0, 0, 10, 10, 21, 21 ] ], [ [ 0, 2, 13, 16, 26, 28 ], [ 0, 0, 11, 11, 21, 21 ] ], [ [ 0, 2, 14, 17, 26, 28 ], [ 0, 0, 12, 12, 21, 21 ] ], [ [ 0, 2, 15, 18, 26, 28 ], [ 0, 0, 13, 13, 21, 21 ] ], [ [ 0, 2, 16, 19, 26, 28 ], [ 0, 0, 14, 14, 21, 21 ] ], [ [ 0, 2, 17, 20, 26, 28 ], [ 0, 0, 15, 15, 21, 21 ] ] ], "tuples": [ [ 21, 0, 24, 0, 3, 1, 21, 24 ] ], "tupleFields": [ "identical", "ambiguousColumns", "columns", "mismatches", "gapColumns", "gapOpens", "readAligned", "referenceCovered" ], "variation": { "readAligned": { "shared": true, "min": 21, "max": 21 }, "referenceCovered": { "shared": true, "min": 24, "max": 24 }, "identity": { "shared": true, "min": { "numerator": 7, "denominator": 8 }, "max": { "numerator": 7, "denominator": 8 } }, "overhangStart": { "shared": true, "min": 0, "max": 0 }, "overhangEnd": { "shared": true, "min": 0, "max": 0 } }, "placements": [ { "refStart": 3, "refEnd": 26, "crossesOrigin": false, "wholeCircle": false, "readStart": 1, "readEnd": 21, "alignments": 10, "band": { "diagonalMin": 2, "diagonalMax": 5, "cellsNeeded": 132, "bandLimited": false } } ] }, "minus": { "score": -25, "count": 3, "overCap": false, "state": "aligned", "biopython": { "score": -25, "count": 3 }, "uniquePairs": [ [ 2, 1 ], [ 5, 18 ], [ 6, 19 ], [ 8, 20 ], [ 9, 21 ] ], "uniquePlacement": true, "placementNotDetermined": false, "noCommonColumn": false, "hull": { "refStart": 2, "refEnd": 9, "crossesOrigin": false, "wholeCircle": false }, "selected": { "coordinates": [ [ 0, 1, 3, 3, 4, 4, 6, 7, 9, 28 ], [ 0, 0, 2, 3, 4, 17, 19, 19, 21, 21 ] ], "gappedReference": "CT-A-------------GCATA", "gappedRead": "CTGACGTTTTTTTTTATGC-TA", "columns": 22, "identical": 7, "mismatches": 0, "ambiguousColumns": 0, "gapColumns": 15, "gapOpens": 3, "identity": { "numerator": 7, "denominator": 22 }, "readAligned": { "bases": 21, "of": 21 }, "referenceCovered": { "bases": 8, "of": 28 }, "placement": { "refStart": 2, "refEnd": 9, "readStart": 1, "readEnd": 21, "crossesOrigin": false, "asSupplied": { "readStart": 1, "readEnd": 21 } }, "overhang": [], "differences": [ { "kind": "insertion", "refAfter": 3, "length": 1, "bases": "G", "readStart": 3, "readEnd": 3, "asSupplied": { "readStart": 19, "readEnd": 19, "bases": "C" }, "common": false, "notFixed": { "from": { "ref": 2, "read": 1, "readAsSupplied": 21 }, "to": { "ref": 5, "read": 18, "readAsSupplied": 4 } } }, { "kind": "insertion", "refAfter": 4, "length": 13, "bases": "CGTTTTTTTTTAT", "readStart": 5, "readEnd": 17, "asSupplied": { "readStart": 5, "readEnd": 17, "bases": "ATAAAAAAAAACG" }, "common": false, "notFixed": { "from": { "ref": 2, "read": 1, "readAsSupplied": 21 }, "to": { "ref": 5, "read": 18, "readAsSupplied": 4 } } }, { "kind": "deletion", "refStart": 7, "refEnd": 7, "length": 1, "bases": "A", "readAfter": 19, "asSupplied": { "readBetween": [ 2, 3 ] }, "common": true } ] }, "band": { "diagonalMin": -13, "diagonalMax": 1, "cellsNeeded": 269, "unionBandLimited": false, "scope": "every optimal path", "gridCells": 638, "searchedBanded": false, "sharedWords": 0, "sharedWordsOverCap": false, "seedGuarantee": { "differencesUpTo": 33, "guaranteed": false } }, "enumeration": "listed", "alignments": [ [ [ 0, 1, 3, 3, 4, 4, 6, 7, 9, 28 ], [ 0, 0, 2, 3, 4, 17, 19, 19, 21, 21 ] ], [ [ 0, 1, 2, 2, 4, 4, 6, 7, 9, 28 ], [ 0, 0, 1, 14, 16, 17, 19, 19, 21, 21 ] ], [ [ 0, 1, 3, 3, 4, 4, 6, 7, 9, 28 ], [ 0, 0, 2, 15, 16, 17, 19, 19, 21, 21 ] ] ], "tuples": [ [ 7, 0, 22, 0, 15, 3, 21, 8 ] ], "tupleFields": [ "identical", "ambiguousColumns", "columns", "mismatches", "gapColumns", "gapOpens", "readAligned", "referenceCovered" ], "variation": { "readAligned": { "shared": true, "min": 21, "max": 21 }, "referenceCovered": { "shared": true, "min": 8, "max": 8 }, "identity": { "shared": true, "min": { "numerator": 7, "denominator": 22 }, "max": { "numerator": 7, "denominator": 22 } }, "overhangStart": { "shared": true, "min": 0, "max": 0 }, "overhangEnd": { "shared": true, "min": 0, "max": 0 } }, "placements": [ { "refStart": 2, "refEnd": 9, "crossesOrigin": false, "wholeCircle": false, "readStart": 1, "readEnd": 21, "asSupplied": { "readStart": 1, "readEnd": 21 }, "alignments": 3, "band": { "diagonalMin": -13, "diagonalMax": 1, "cellsNeeded": 269, "bandLimited": false } } ] } }, { "mode": "local", "region": null, "strand": "+", "strandUndetermined": false, "plus": { "score": 33, "count": 10, "overCap": false, "state": "aligned", "biopython": { "score": 33, "count": 10 }, "uniquePairs": [ [ 3, 1 ], [ 4, 2 ], [ 5, 3 ], [ 6, 4 ], [ 7, 5 ], [ 8, 6 ], [ 21, 16 ], [ 22, 17 ], [ 23, 18 ], [ 24, 19 ], [ 25, 20 ], [ 26, 21 ] ], "uniquePlacement": true, "placementNotDetermined": false, "noCommonColumn": false, "hull": { "refStart": 3, "refEnd": 26, "crossesOrigin": false, "wholeCircle": false }, "selected": { "coordinates": [ [ 2, 8, 11, 26 ], [ 0, 6, 6, 21 ] ], "gappedReference": "TAGCATAAAAAAAAAAAACGTCAG", "gappedRead": "TAGCAT---AAAAAAAAACGTCAG", "columns": 24, "identical": 21, "mismatches": 0, "ambiguousColumns": 0, "gapColumns": 3, "gapOpens": 1, "identity": { "numerator": 21, "denominator": 24 }, "readAligned": { "bases": 21, "of": 21 }, "referenceCovered": { "bases": 24, "of": 28 }, "placement": { "refStart": 3, "refEnd": 26, "readStart": 1, "readEnd": 21, "crossesOrigin": false }, "overhang": [], "differences": [ { "kind": "deletion", "refStart": 9, "refEnd": 11, "length": 3, "bases": "AAA", "readAfter": 6, "common": false, "notFixed": { "from": { "ref": 8, "read": 6 }, "to": { "ref": 21, "read": 16 } } } ] }, "band": { "diagonalMin": 2, "diagonalMax": 5, "cellsNeeded": 132, "unionBandLimited": false, "scope": "every optimal path", "gridCells": 638, "searchedBanded": false, "sharedWords": 8, "sharedWordsOverCap": false, "seedGuarantee": { "differencesUpTo": 4, "guaranteed": false } }, "enumeration": "listed", "alignments": [ [ [ 2, 8, 11, 26 ], [ 0, 6, 6, 21 ] ], [ [ 2, 9, 12, 26 ], [ 0, 7, 7, 21 ] ], [ [ 2, 10, 13, 26 ], [ 0, 8, 8, 21 ] ], [ [ 2, 11, 14, 26 ], [ 0, 9, 9, 21 ] ], [ [ 2, 12, 15, 26 ], [ 0, 10, 10, 21 ] ], [ [ 2, 13, 16, 26 ], [ 0, 11, 11, 21 ] ], [ [ 2, 14, 17, 26 ], [ 0, 12, 12, 21 ] ], [ [ 2, 15, 18, 26 ], [ 0, 13, 13, 21 ] ], [ [ 2, 16, 19, 26 ], [ 0, 14, 14, 21 ] ], [ [ 2, 17, 20, 26 ], [ 0, 15, 15, 21 ] ] ], "tuples": [ [ 21, 0, 24, 0, 3, 1, 21, 24 ] ], "tupleFields": [ "identical", "ambiguousColumns", "columns", "mismatches", "gapColumns", "gapOpens", "readAligned", "referenceCovered" ], "variation": { "readAligned": { "shared": true, "min": 21, "max": 21 }, "referenceCovered": { "shared": true, "min": 24, "max": 24 }, "identity": { "shared": true, "min": { "numerator": 7, "denominator": 8 }, "max": { "numerator": 7, "denominator": 8 } }, "overhangStart": { "shared": true, "min": 0, "max": 0 }, "overhangEnd": { "shared": true, "min": 0, "max": 0 } }, "placements": [ { "refStart": 3, "refEnd": 26, "crossesOrigin": false, "wholeCircle": false, "readStart": 1, "readEnd": 21, "alignments": 10, "band": { "diagonalMin": 2, "diagonalMax": 5, "cellsNeeded": 132, "bandLimited": false } } ] }, "minus": { "score": 8, "count": 2, "overCap": false, "state": "aligned", "biopython": { "score": 8, "count": 2 }, "uniquePairs": [], "uniquePlacement": false, "placementNotDetermined": false, "noCommonColumn": false, "hull": { "refStart": 1, "refEnd": 23, "crossesOrigin": false, "wholeCircle": false }, "selected": { "coordinates": [ [ 0, 4 ], [ 17, 21 ] ], "gappedReference": "GCTA", "gappedRead": "GCTA", "columns": 4, "identical": 4, "mismatches": 0, "ambiguousColumns": 0, "gapColumns": 0, "gapOpens": 0, "identity": { "numerator": 4, "denominator": 4 }, "readAligned": { "bases": 4, "of": 21 }, "referenceCovered": { "bases": 4, "of": 28 }, "placement": { "refStart": 1, "refEnd": 4, "readStart": 18, "readEnd": 21, "crossesOrigin": false, "asSupplied": { "readStart": 1, "readEnd": 4 } }, "overhang": [], "differences": [] }, "band": { "diagonalMin": -17, "diagonalMax": 16, "cellsNeeded": 566, "unionBandLimited": false, "scope": "every optimal path", "gridCells": 638, "searchedBanded": false, "sharedWords": 0, "sharedWordsOverCap": false, "seedGuarantee": { "differencesUpTo": 17, "guaranteed": false } }, "enumeration": "listed", "alignments": [ [ [ 0, 4 ], [ 17, 21 ] ], [ [ 19, 23 ], [ 3, 7 ] ] ], "tuples": [ [ 4, 0, 4, 0, 0, 0, 4, 4 ] ], "tupleFields": [ "identical", "ambiguousColumns", "columns", "mismatches", "gapColumns", "gapOpens", "readAligned", "referenceCovered" ], "variation": { "readAligned": { "shared": true, "min": 4, "max": 4 }, "referenceCovered": { "shared": true, "min": 4, "max": 4 }, "identity": { "shared": true, "min": { "numerator": 1, "denominator": 1 }, "max": { "numerator": 1, "denominator": 1 } }, "overhangStart": { "shared": true, "min": 0, "max": 0 }, "overhangEnd": { "shared": true, "min": 0, "max": 0 } }, "placements": [ { "refStart": 1, "refEnd": 4, "crossesOrigin": false, "wholeCircle": false, "readStart": 18, "readEnd": 21, "asSupplied": { "readStart": 1, "readEnd": 4 }, "alignments": 1, "band": { "diagonalMin": -17, "diagonalMax": -17, "cellsNeeded": 15, "bandLimited": false } }, { "refStart": 20, "refEnd": 23, "crossesOrigin": false, "wholeCircle": false, "readStart": 4, "readEnd": 7, "asSupplied": { "readStart": 15, "readEnd": 18 }, "alignments": 1, "band": { "diagonalMin": 16, "diagonalMax": 16, "cellsNeeded": 39, "bandLimited": false } } ] } } ] } }, { "id": "ties-dinucleotide", "note": "(CA)10 in the reference read as (CA)7: a 6-base deletion at any of the repeat's phases.", "input": { "reference": { "residues": "GGTACGTTAGGCACACACACACACACACACATTGACCAGTGG", "topology": "linear" }, "read": { "residues": "TACGTTAGGCACACACACACACATTGACCAGT" }, "modes": [ "global", "semiglobal-read", "local" ] }, "expected": { "results": [ { "mode": "global", "region": null, "strand": "+", "strandUndetermined": false, "plus": { "score": 35, "count": 15, "overCap": false, "state": "aligned", "biopython": { "score": 35, "count": 15 }, "uniquePairs": [ [ 3, 1 ], [ 4, 2 ], [ 5, 3 ], [ 6, 4 ], [ 7, 5 ], [ 8, 6 ], [ 9, 7 ], [ 10, 8 ], [ 11, 9 ], [ 32, 24 ], [ 33, 25 ], [ 34, 26 ], [ 35, 27 ], [ 36, 28 ], [ 37, 29 ], [ 38, 30 ], [ 39, 31 ], [ 40, 32 ] ], "uniquePlacement": true, "placementNotDetermined": false, "noCommonColumn": false, "hull": { "refStart": 3, "refEnd": 40, "crossesOrigin": false, "wholeCircle": false }, "selected": { "coordinates": [ [ 0, 2, 11, 17, 40, 42 ], [ 0, 0, 9, 9, 32, 32 ] ], "gappedReference": "GGTACGTTAGGCACACACACACACACACACATTGACCAGTGG", "gappedRead": "--TACGTTAGG------CACACACACACACATTGACCAGT--", "columns": 42, "identical": 32, "mismatches": 0, "ambiguousColumns": 0, "gapColumns": 10, "gapOpens": 3, "identity": { "numerator": 32, "denominator": 42 }, "readAligned": { "bases": 32, "of": 32 }, "referenceCovered": { "bases": 38, "of": 42 }, "placement": { "refStart": 3, "refEnd": 40, "readStart": 1, "readEnd": 32, "crossesOrigin": false }, "overhang": [], "differences": [ { "kind": "deletion", "refStart": 1, "refEnd": 2, "length": 2, "bases": "GG", "readAfter": 0, "common": true }, { "kind": "deletion", "refStart": 12, "refEnd": 17, "length": 6, "bases": "CACACA", "readAfter": 9, "common": false, "notFixed": { "from": { "ref": 11, "read": 9 }, "to": { "ref": 32, "read": 24 } } }, { "kind": "deletion", "refStart": 41, "refEnd": 42, "length": 2, "bases": "GG", "readAfter": 32, "common": true } ] }, "band": { "diagonalMin": 0, "diagonalMax": 10, "cellsNeeded": 427, "unionBandLimited": false, "scope": "every optimal path", "gridCells": 1419, "searchedBanded": false, "sharedWords": 32, "sharedWordsOverCap": false, "seedGuarantee": { "differencesUpTo": 14, "guaranteed": false } }, "enumeration": "listed", "alignments": [ [ [ 0, 2, 11, 17, 40, 42 ], [ 0, 0, 9, 9, 32, 32 ] ], [ [ 0, 2, 12, 18, 40, 42 ], [ 0, 0, 10, 10, 32, 32 ] ], [ [ 0, 2, 13, 19, 40, 42 ], [ 0, 0, 11, 11, 32, 32 ] ], [ [ 0, 2, 14, 20, 40, 42 ], [ 0, 0, 12, 12, 32, 32 ] ], [ [ 0, 2, 15, 21, 40, 42 ], [ 0, 0, 13, 13, 32, 32 ] ], [ [ 0, 2, 16, 22, 40, 42 ], [ 0, 0, 14, 14, 32, 32 ] ], [ [ 0, 2, 17, 23, 40, 42 ], [ 0, 0, 15, 15, 32, 32 ] ], [ [ 0, 2, 18, 24, 40, 42 ], [ 0, 0, 16, 16, 32, 32 ] ], [ [ 0, 2, 19, 25, 40, 42 ], [ 0, 0, 17, 17, 32, 32 ] ], [ [ 0, 2, 20, 26, 40, 42 ], [ 0, 0, 18, 18, 32, 32 ] ], [ [ 0, 2, 21, 27, 40, 42 ], [ 0, 0, 19, 19, 32, 32 ] ], [ [ 0, 2, 22, 28, 40, 42 ], [ 0, 0, 20, 20, 32, 32 ] ], [ [ 0, 2, 23, 29, 40, 42 ], [ 0, 0, 21, 21, 32, 32 ] ], [ [ 0, 2, 24, 30, 40, 42 ], [ 0, 0, 22, 22, 32, 32 ] ], [ [ 0, 2, 25, 31, 40, 42 ], [ 0, 0, 23, 23, 32, 32 ] ] ], "tuples": [ [ 32, 0, 42, 0, 10, 3, 32, 38 ] ], "tupleFields": [ "identical", "ambiguousColumns", "columns", "mismatches", "gapColumns", "gapOpens", "readAligned", "referenceCovered" ], "variation": { "readAligned": { "shared": true, "min": 32, "max": 32 }, "referenceCovered": { "shared": true, "min": 38, "max": 38 }, "identity": { "shared": true, "min": { "numerator": 16, "denominator": 21 }, "max": { "numerator": 16, "denominator": 21 } }, "overhangStart": { "shared": true, "min": 0, "max": 0 }, "overhangEnd": { "shared": true, "min": 0, "max": 0 } }, "placements": [ { "refStart": 3, "refEnd": 40, "crossesOrigin": false, "wholeCircle": false, "readStart": 1, "readEnd": 32, "alignments": 15, "band": { "diagonalMin": 0, "diagonalMax": 10, "cellsNeeded": 427, "bandLimited": false } } ] }, "minus": { "score": -67, "count": 2, "overCap": false, "state": "aligned", "biopython": { "score": -67, "count": 2 }, "uniquePairs": [ [ 4, 1 ], [ 5, 2 ], [ 8, 3 ], [ 9, 4 ], [ 10, 5 ], [ 11, 6 ], [ 12, 7 ], [ 13, 8 ], [ 21, 9 ], [ 22, 10 ], [ 23, 11 ], [ 24, 12 ], [ 25, 13 ], [ 26, 14 ], [ 27, 15 ], [ 28, 16 ], [ 29, 17 ], [ 30, 18 ], [ 31, 19 ], [ 32, 20 ], [ 33, 22 ], [ 34, 23 ], [ 35, 24 ], [ 36, 25 ], [ 37, 26 ], [ 38, 27 ], [ 39, 30 ], [ 40, 31 ] ], "uniquePlacement": true, "placementNotDetermined": false, "noCommonColumn": false, "hull": { "refStart": 4, "refEnd": 42, "crossesOrigin": false, "wholeCircle": false }, "selected": { "coordinates": [ [ 0, 3, 5, 7, 13, 20, 32, 32, 38, 38, 40, 41, 42 ], [ 0, 0, 2, 2, 8, 8, 20, 21, 27, 29, 31, 31, 32 ] ], "gappedReference": "GGTACGTTAGGCACACACACACACACACACAT-TGACCA--GTGG", "gappedRead": "---AC--TGGTCA-------ATGTGTGTGTGTGTGCCTAACGT-A", "columns": 45, "identical": 14, "mismatches": 15, "ambiguousColumns": 0, "gapColumns": 16, "gapOpens": 6, "identity": { "numerator": 14, "denominator": 45 }, "readAligned": { "bases": 32, "of": 32 }, "referenceCovered": { "bases": 39, "of": 42 }, "placement": { "refStart": 4, "refEnd": 42, "readStart": 1, "readEnd": 32, "crossesOrigin": false, "asSupplied": { "readStart": 1, "readEnd": 32 } }, "overhang": [], "differences": [ { "kind": "deletion", "refStart": 1, "refEnd": 3, "length": 3, "bases": "GGT", "readAfter": 0, "asSupplied": { "readBetween": [ 32, 33 ] }, "common": true }, { "kind": "deletion", "refStart": 6, "refEnd": 7, "length": 2, "bases": "GT", "readAfter": 2, "asSupplied": { "readBetween": [ 30, 31 ] }, "common": true }, { "kind": "substitution", "ref": 9, "refBase": "A", "readBase": "G", "read": 4, "common": true, "asSupplied": { "read": 29, "readBase": "C" } }, { "kind": "substitution", "ref": 11, "refBase": "G", "readBase": "T", "read": 6, "common": true, "asSupplied": { "read": 27, "readBase": "A" } }, { "kind": "deletion", "refStart": 14, "refEnd": 20, "length": 7, "bases": "CACACAC", "readAfter": 8, "asSupplied": { "readBetween": [ 24, 25 ] }, "common": true }, { "kind": "substitution", "ref": 22, "refBase": "C", "readBase": "T", "read": 10, "common": true, "asSupplied": { "read": 23, "readBase": "A" } }, { "kind": "substitution", "ref": 23, "refBase": "A", "readBase": "G", "read": 11, "common": true, "asSupplied": { "read": 22, "readBase": "C" } }, { "kind": "substitution", "ref": 24, "refBase": "C", "readBase": "T", "read": 12, "common": true, "asSupplied": { "read": 21, "readBase": "A" } }, { "kind": "substitution", "ref": 25, "refBase": "A", "readBase": "G", "read": 13, "common": true, "asSupplied": { "read": 20, "readBase": "C" } }, { "kind": "substitution", "ref": 26, "refBase": "C", "readBase": "T", "read": 14, "common": true, "asSupplied": { "read": 19, "readBase": "A" } }, { "kind": "substitution", "ref": 27, "refBase": "A", "readBase": "G", "read": 15, "common": true, "asSupplied": { "read": 18, "readBase": "C" } }, { "kind": "substitution", "ref": 28, "refBase": "C", "readBase": "T", "read": 16, "common": true, "asSupplied": { "read": 17, "readBase": "A" } }, { "kind": "substitution", "ref": 29, "refBase": "A", "readBase": "G", "read": 17, "common": true, "asSupplied": { "read": 16, "readBase": "C" } }, { "kind": "substitution", "ref": 30, "refBase": "C", "readBase": "T", "read": 18, "common": true, "asSupplied": { "read": 15, "readBase": "A" } }, { "kind": "substitution", "ref": 31, "refBase": "A", "readBase": "G", "read": 19, "common": true, "asSupplied": { "read": 14, "readBase": "C" } }, { "kind": "insertion", "refAfter": 32, "length": 1, "bases": "G", "readStart": 21, "readEnd": 21, "asSupplied": { "readStart": 12, "readEnd": 12, "bases": "C" }, "common": true }, { "kind": "substitution", "ref": 35, "refBase": "A", "readBase": "C", "read": 24, "common": true, "asSupplied": { "read": 9, "readBase": "G" } }, { "kind": "substitution", "ref": 37, "refBase": "C", "readBase": "T", "read": 26, "common": true, "asSupplied": { "read": 7, "readBase": "A" } }, { "kind": "insertion", "refAfter": 38, "length": 2, "bases": "AC", "readStart": 28, "readEnd": 29, "asSupplied": { "readStart": 4, "readEnd": 5, "bases": "GT" }, "common": true }, { "kind": "deletion", "refStart": 41, "refEnd": 41, "length": 1, "bases": "G", "readAfter": 31, "asSupplied": { "readBetween": [ 1, 2 ] }, "common": false, "notFixed": { "from": { "ref": 40, "read": 31, "readAsSupplied": 2 }, "to": null } }, { "kind": "substitution", "ref": 42, "refBase": "G", "readBase": "A", "read": 32, "common": false, "notFixed": { "from": { "ref": 40, "read": 31, "readAsSupplied": 2 }, "to": null }, "asSupplied": { "read": 1, "readBase": "T" } } ] }, "band": { "diagonalMin": 0, "diagonalMax": 12, "cellsNeeded": 488, "unionBandLimited": false, "scope": "every optimal path", "gridCells": 1419, "searchedBanded": false, "sharedWords": 0, "sharedWordsOverCap": false, "seedGuarantee": { "differencesUpTo": 65, "guaranteed": false } }, "enumeration": "listed", "alignments": [ [ [ 0, 3, 5, 7, 13, 20, 32, 32, 38, 38, 40, 41, 42 ], [ 0, 0, 2, 2, 8, 8, 20, 21, 27, 29, 31, 31, 32 ] ], [ [ 0, 3, 5, 7, 13, 20, 32, 32, 38, 38, 41, 42 ], [ 0, 0, 2, 2, 8, 8, 20, 21, 27, 29, 32, 32 ] ] ], "tuples": [ [ 14, 0, 45, 15, 16, 6, 32, 38 ], [ 14, 0, 45, 15, 16, 6, 32, 39 ] ], "tupleFields": [ "identical", "ambiguousColumns", "columns", "mismatches", "gapColumns", "gapOpens", "readAligned", "referenceCovered" ], "variation": { "readAligned": { "shared": true, "min": 32, "max": 32 }, "referenceCovered": { "shared": false, "min": 38, "max": 39 }, "identity": { "shared": true, "min": { "numerator": 14, "denominator": 45 }, "max": { "numerator": 14, "denominator": 45 } }, "overhangStart": { "shared": true, "min": 0, "max": 0 }, "overhangEnd": { "shared": true, "min": 0, "max": 0 } }, "placements": [ { "refStart": 4, "refEnd": 42, "crossesOrigin": false, "wholeCircle": false, "readStart": 1, "readEnd": 32, "asSupplied": { "readStart": 1, "readEnd": 32 }, "alignments": 2, "band": { "diagonalMin": 0, "diagonalMax": 12, "cellsNeeded": 488, "bandLimited": false } } ] } }, { "mode": "semiglobal-read", "region": null, "strand": "+", "strandUndetermined": false, "plus": { "score": 49, "count": 15, "overCap": false, "state": "aligned", "biopython": { "score": 49, "count": 15 }, "uniquePairs": [ [ 3, 1 ], [ 4, 2 ], [ 5, 3 ], [ 6, 4 ], [ 7, 5 ], [ 8, 6 ], [ 9, 7 ], [ 10, 8 ], [ 11, 9 ], [ 32, 24 ], [ 33, 25 ], [ 34, 26 ], [ 35, 27 ], [ 36, 28 ], [ 37, 29 ], [ 38, 30 ], [ 39, 31 ], [ 40, 32 ] ], "uniquePlacement": true, "placementNotDetermined": false, "noCommonColumn": false, "hull": { "refStart": 3, "refEnd": 40, "crossesOrigin": false, "wholeCircle": false }, "selected": { "coordinates": [ [ 0, 2, 11, 17, 40, 42 ], [ 0, 0, 9, 9, 32, 32 ] ], "gappedReference": "TACGTTAGGCACACACACACACACACACATTGACCAGT", "gappedRead": "TACGTTAGG------CACACACACACACATTGACCAGT", "columns": 38, "identical": 32, "mismatches": 0, "ambiguousColumns": 0, "gapColumns": 6, "gapOpens": 1, "identity": { "numerator": 32, "denominator": 38 }, "readAligned": { "bases": 32, "of": 32 }, "referenceCovered": { "bases": 38, "of": 42 }, "placement": { "refStart": 3, "refEnd": 40, "readStart": 1, "readEnd": 32, "crossesOrigin": false }, "overhang": [], "differences": [ { "kind": "deletion", "refStart": 12, "refEnd": 17, "length": 6, "bases": "CACACA", "readAfter": 9, "common": false, "notFixed": { "from": { "ref": 11, "read": 9 }, "to": { "ref": 32, "read": 24 } } } ] }, "band": { "diagonalMin": 2, "diagonalMax": 8, "cellsNeeded": 297, "unionBandLimited": false, "scope": "every optimal path", "gridCells": 1419, "searchedBanded": false, "sharedWords": 32, "sharedWordsOverCap": false, "seedGuarantee": { "differencesUpTo": 7, "guaranteed": false } }, "enumeration": "listed", "alignments": [ [ [ 0, 2, 11, 17, 40, 42 ], [ 0, 0, 9, 9, 32, 32 ] ], [ [ 0, 2, 12, 18, 40, 42 ], [ 0, 0, 10, 10, 32, 32 ] ], [ [ 0, 2, 13, 19, 40, 42 ], [ 0, 0, 11, 11, 32, 32 ] ], [ [ 0, 2, 14, 20, 40, 42 ], [ 0, 0, 12, 12, 32, 32 ] ], [ [ 0, 2, 15, 21, 40, 42 ], [ 0, 0, 13, 13, 32, 32 ] ], [ [ 0, 2, 16, 22, 40, 42 ], [ 0, 0, 14, 14, 32, 32 ] ], [ [ 0, 2, 17, 23, 40, 42 ], [ 0, 0, 15, 15, 32, 32 ] ], [ [ 0, 2, 18, 24, 40, 42 ], [ 0, 0, 16, 16, 32, 32 ] ], [ [ 0, 2, 19, 25, 40, 42 ], [ 0, 0, 17, 17, 32, 32 ] ], [ [ 0, 2, 20, 26, 40, 42 ], [ 0, 0, 18, 18, 32, 32 ] ], [ [ 0, 2, 21, 27, 40, 42 ], [ 0, 0, 19, 19, 32, 32 ] ], [ [ 0, 2, 22, 28, 40, 42 ], [ 0, 0, 20, 20, 32, 32 ] ], [ [ 0, 2, 23, 29, 40, 42 ], [ 0, 0, 21, 21, 32, 32 ] ], [ [ 0, 2, 24, 30, 40, 42 ], [ 0, 0, 22, 22, 32, 32 ] ], [ [ 0, 2, 25, 31, 40, 42 ], [ 0, 0, 23, 23, 32, 32 ] ] ], "tuples": [ [ 32, 0, 38, 0, 6, 1, 32, 38 ] ], "tupleFields": [ "identical", "ambiguousColumns", "columns", "mismatches", "gapColumns", "gapOpens", "readAligned", "referenceCovered" ], "variation": { "readAligned": { "shared": true, "min": 32, "max": 32 }, "referenceCovered": { "shared": true, "min": 38, "max": 38 }, "identity": { "shared": true, "min": { "numerator": 16, "denominator": 19 }, "max": { "numerator": 16, "denominator": 19 } }, "overhangStart": { "shared": true, "min": 0, "max": 0 }, "overhangEnd": { "shared": true, "min": 0, "max": 0 } }, "placements": [ { "refStart": 3, "refEnd": 40, "crossesOrigin": false, "wholeCircle": false, "readStart": 1, "readEnd": 32, "alignments": 15, "band": { "diagonalMin": 2, "diagonalMax": 8, "cellsNeeded": 297, "bandLimited": false } } ] }, "minus": { "score": -33, "count": 6, "overCap": false, "state": "aligned", "biopython": { "score": -33, "count": 6 }, "uniquePairs": [ [ 1, 4 ], [ 2, 5 ], [ 3, 6 ], [ 4, 9 ], [ 5, 10 ], [ 6, 11 ], [ 7, 12 ], [ 11, 23 ], [ 12, 24 ] ], "uniquePlacement": true, "placementNotDetermined": false, "noCommonColumn": false, "hull": { "refStart": 1, "refEnd": 21, "crossesOrigin": false, "wholeCircle": false }, "selected": { "coordinates": [ [ 0, 0, 3, 3, 7, 7, 12, 12, 17, 42 ], [ 0, 3, 6, 8, 12, 19, 24, 27, 32, 32 ] ], "gappedReference": "GGT--ACGT-------TAGGC---ACACA", "gappedRead": "GGTCAATGTGTGTGTGTGTGCCTAACGTA", "columns": 29, "identical": 12, "mismatches": 5, "ambiguousColumns": 0, "gapColumns": 12, "gapOpens": 3, "identity": { "numerator": 12, "denominator": 29 }, "readAligned": { "bases": 29, "of": 32 }, "referenceCovered": { "bases": 17, "of": 42 }, "placement": { "refStart": 1, "refEnd": 17, "readStart": 4, "readEnd": 32, "crossesOrigin": false, "asSupplied": { "readStart": 1, "readEnd": 29 } }, "overhang": [ { "side": "start", "at": "reference-end", "length": 3, "bases": "ACT", "readStart": 1, "readEnd": 3, "asSupplied": { "readStart": 30, "readEnd": 32, "bases": "AGT" } } ], "differences": [ { "kind": "insertion", "refAfter": 3, "length": 2, "bases": "CA", "readStart": 7, "readEnd": 8, "asSupplied": { "readStart": 25, "readEnd": 26, "bases": "TG" }, "common": true }, { "kind": "substitution", "ref": 5, "refBase": "C", "readBase": "T", "read": 10, "common": true, "asSupplied": { "read": 23, "readBase": "A" } }, { "kind": "insertion", "refAfter": 7, "length": 7, "bases": "GTGTGTG", "readStart": 13, "readEnd": 19, "asSupplied": { "readStart": 14, "readEnd": 20, "bases": "CACACAC" }, "common": false, "notFixed": { "from": { "ref": 7, "read": 12, "readAsSupplied": 21 }, "to": { "ref": 11, "read": 23, "readAsSupplied": 10 } } }, { "kind": "substitution", "ref": 9, "refBase": "A", "readBase": "G", "read": 21, "common": false, "notFixed": { "from": { "ref": 7, "read": 12, "readAsSupplied": 21 }, "to": { "ref": 11, "read": 23, "readAsSupplied": 10 } }, "asSupplied": { "read": 12, "readBase": "C" } }, { "kind": "substitution", "ref": 10, "refBase": "G", "readBase": "T", "read": 22, "common": false, "notFixed": { "from": { "ref": 7, "read": 12, "readAsSupplied": 21 }, "to": { "ref": 11, "read": 23, "readAsSupplied": 10 } }, "asSupplied": { "read": 11, "readBase": "A" } }, { "kind": "insertion", "refAfter": 12, "length": 3, "bases": "CTA", "readStart": 25, "readEnd": 27, "asSupplied": { "readStart": 6, "readEnd": 8, "bases": "TAG" }, "common": false, "notFixed": { "from": { "ref": 12, "read": 24, "readAsSupplied": 9 }, "to": null } }, { "kind": "substitution", "ref": 15, "refBase": "A", "readBase": "G", "read": 30, "common": false, "notFixed": { "from": { "ref": 12, "read": 24, "readAsSupplied": 9 }, "to": null }, "asSupplied": { "read": 3, "readBase": "C" } }, { "kind": "substitution", "ref": 16, "refBase": "C", "readBase": "T", "read": 31, "common": false, "notFixed": { "from": { "ref": 12, "read": 24, "readAsSupplied": 9 }, "to": null }, "asSupplied": { "read": 2, "readBase": "A" } } ] }, "band": { "diagonalMin": -15, "diagonalMax": -1, "cellsNeeded": 425, "unionBandLimited": false, "scope": "every optimal path", "gridCells": 1419, "searchedBanded": false, "sharedWords": 0, "sharedWordsOverCap": false, "seedGuarantee": { "differencesUpTo": 48, "guaranteed": false } }, "enumeration": "listed", "alignments": [ [ [ 0, 0, 3, 3, 7, 7, 12, 12, 17, 42 ], [ 0, 3, 6, 8, 12, 19, 24, 27, 32, 32 ] ], [ [ 0, 0, 3, 3, 10, 10, 12, 12, 17, 42 ], [ 0, 3, 6, 8, 15, 22, 24, 27, 32, 32 ] ], [ [ 0, 0, 3, 3, 7, 7, 12, 13, 21, 42 ], [ 0, 3, 6, 8, 12, 19, 24, 24, 32, 32 ] ], [ [ 0, 0, 3, 3, 10, 10, 12, 13, 21, 42 ], [ 0, 3, 6, 8, 15, 22, 24, 24, 32, 32 ] ], [ [ 0, 0, 3, 3, 7, 7, 15, 16, 21, 42 ], [ 0, 3, 6, 8, 12, 19, 27, 27, 32, 32 ] ], [ [ 0, 0, 3, 3, 10, 10, 15, 16, 21, 42 ], [ 0, 3, 6, 8, 15, 22, 27, 27, 32, 32 ] ] ], "tuples": [ [ 12, 0, 29, 5, 12, 3, 29, 17 ], [ 13, 0, 30, 7, 10, 3, 29, 21 ] ], "tupleFields": [ "identical", "ambiguousColumns", "columns", "mismatches", "gapColumns", "gapOpens", "readAligned", "referenceCovered" ], "variation": { "readAligned": { "shared": true, "min": 29, "max": 29 }, "referenceCovered": { "shared": false, "min": 17, "max": 21 }, "identity": { "shared": false, "min": { "numerator": 12, "denominator": 29 }, "max": { "numerator": 13, "denominator": 30 } }, "overhangStart": { "shared": true, "min": 3, "max": 3 }, "overhangEnd": { "shared": true, "min": 0, "max": 0 } }, "placements": [ { "refStart": 1, "refEnd": 21, "crossesOrigin": false, "wholeCircle": false, "readStart": 4, "readEnd": 32, "asSupplied": { "readStart": 1, "readEnd": 29 }, "alignments": 6, "band": { "diagonalMin": -15, "diagonalMax": -1, "cellsNeeded": 425, "bandLimited": false } } ] } }, { "mode": "local", "region": null, "strand": "+", "strandUndetermined": false, "plus": { "score": 49, "count": 15, "overCap": false, "state": "aligned", "biopython": { "score": 49, "count": 15 }, "uniquePairs": [ [ 3, 1 ], [ 4, 2 ], [ 5, 3 ], [ 6, 4 ], [ 7, 5 ], [ 8, 6 ], [ 9, 7 ], [ 10, 8 ], [ 11, 9 ], [ 32, 24 ], [ 33, 25 ], [ 34, 26 ], [ 35, 27 ], [ 36, 28 ], [ 37, 29 ], [ 38, 30 ], [ 39, 31 ], [ 40, 32 ] ], "uniquePlacement": true, "placementNotDetermined": false, "noCommonColumn": false, "hull": { "refStart": 3, "refEnd": 40, "crossesOrigin": false, "wholeCircle": false }, "selected": { "coordinates": [ [ 2, 11, 17, 40 ], [ 0, 9, 9, 32 ] ], "gappedReference": "TACGTTAGGCACACACACACACACACACATTGACCAGT", "gappedRead": "TACGTTAGG------CACACACACACACATTGACCAGT", "columns": 38, "identical": 32, "mismatches": 0, "ambiguousColumns": 0, "gapColumns": 6, "gapOpens": 1, "identity": { "numerator": 32, "denominator": 38 }, "readAligned": { "bases": 32, "of": 32 }, "referenceCovered": { "bases": 38, "of": 42 }, "placement": { "refStart": 3, "refEnd": 40, "readStart": 1, "readEnd": 32, "crossesOrigin": false }, "overhang": [], "differences": [ { "kind": "deletion", "refStart": 12, "refEnd": 17, "length": 6, "bases": "CACACA", "readAfter": 9, "common": false, "notFixed": { "from": { "ref": 11, "read": 9 }, "to": { "ref": 32, "read": 24 } } } ] }, "band": { "diagonalMin": 2, "diagonalMax": 8, "cellsNeeded": 297, "unionBandLimited": false, "scope": "every optimal path", "gridCells": 1419, "searchedBanded": false, "sharedWords": 32, "sharedWordsOverCap": false, "seedGuarantee": { "differencesUpTo": 7, "guaranteed": false } }, "enumeration": "listed", "alignments": [ [ [ 2, 11, 17, 40 ], [ 0, 9, 9, 32 ] ], [ [ 2, 12, 18, 40 ], [ 0, 10, 10, 32 ] ], [ [ 2, 13, 19, 40 ], [ 0, 11, 11, 32 ] ], [ [ 2, 14, 20, 40 ], [ 0, 12, 12, 32 ] ], [ [ 2, 15, 21, 40 ], [ 0, 13, 13, 32 ] ], [ [ 2, 16, 22, 40 ], [ 0, 14, 14, 32 ] ], [ [ 2, 17, 23, 40 ], [ 0, 15, 15, 32 ] ], [ [ 2, 18, 24, 40 ], [ 0, 16, 16, 32 ] ], [ [ 2, 19, 25, 40 ], [ 0, 17, 17, 32 ] ], [ [ 2, 20, 26, 40 ], [ 0, 18, 18, 32 ] ], [ [ 2, 21, 27, 40 ], [ 0, 19, 19, 32 ] ], [ [ 2, 22, 28, 40 ], [ 0, 20, 20, 32 ] ], [ [ 2, 23, 29, 40 ], [ 0, 21, 21, 32 ] ], [ [ 2, 24, 30, 40 ], [ 0, 22, 22, 32 ] ], [ [ 2, 25, 31, 40 ], [ 0, 23, 23, 32 ] ] ], "tuples": [ [ 32, 0, 38, 0, 6, 1, 32, 38 ] ], "tupleFields": [ "identical", "ambiguousColumns", "columns", "mismatches", "gapColumns", "gapOpens", "readAligned", "referenceCovered" ], "variation": { "readAligned": { "shared": true, "min": 32, "max": 32 }, "referenceCovered": { "shared": true, "min": 38, "max": 38 }, "identity": { "shared": true, "min": { "numerator": 16, "denominator": 19 }, "max": { "numerator": 16, "denominator": 19 } }, "overhangStart": { "shared": true, "min": 0, "max": 0 }, "overhangEnd": { "shared": true, "min": 0, "max": 0 } }, "placements": [ { "refStart": 3, "refEnd": 40, "crossesOrigin": false, "wholeCircle": false, "readStart": 1, "readEnd": 32, "alignments": 15, "band": { "diagonalMin": 2, "diagonalMax": 8, "cellsNeeded": 297, "bandLimited": false } } ] }, "minus": { "score": 8, "count": 1, "overCap": false, "state": "aligned", "biopython": { "score": 8, "count": 1 }, "uniquePairs": [ [ 4, 28 ], [ 5, 29 ], [ 6, 30 ], [ 7, 31 ] ], "uniquePlacement": true, "placementNotDetermined": false, "noCommonColumn": false, "hull": { "refStart": 4, "refEnd": 7, "crossesOrigin": false, "wholeCircle": false }, "selected": { "coordinates": [ [ 3, 7 ], [ 27, 31 ] ], "gappedReference": "ACGT", "gappedRead": "ACGT", "columns": 4, "identical": 4, "mismatches": 0, "ambiguousColumns": 0, "gapColumns": 0, "gapOpens": 0, "identity": { "numerator": 4, "denominator": 4 }, "readAligned": { "bases": 4, "of": 32 }, "referenceCovered": { "bases": 4, "of": 42 }, "placement": { "refStart": 4, "refEnd": 7, "readStart": 28, "readEnd": 31, "crossesOrigin": false, "asSupplied": { "readStart": 2, "readEnd": 5 } }, "overhang": [], "differences": [] }, "band": { "diagonalMin": -24, "diagonalMax": -24, "cellsNeeded": 27, "unionBandLimited": false, "scope": "every optimal path", "gridCells": 1419, "searchedBanded": false, "sharedWords": 0, "sharedWordsOverCap": false, "seedGuarantee": { "differencesUpTo": 28, "guaranteed": false } }, "enumeration": "listed", "alignments": [ [ [ 3, 7 ], [ 27, 31 ] ] ], "tuples": [ [ 4, 0, 4, 0, 0, 0, 4, 4 ] ], "tupleFields": [ "identical", "ambiguousColumns", "columns", "mismatches", "gapColumns", "gapOpens", "readAligned", "referenceCovered" ], "variation": { "readAligned": { "shared": true, "min": 4, "max": 4 }, "referenceCovered": { "shared": true, "min": 4, "max": 4 }, "identity": { "shared": true, "min": { "numerator": 1, "denominator": 1 }, "max": { "numerator": 1, "denominator": 1 } }, "overhangStart": { "shared": true, "min": 0, "max": 0 }, "overhangEnd": { "shared": true, "min": 0, "max": 0 } }, "placements": [ { "refStart": 4, "refEnd": 7, "crossesOrigin": false, "wholeCircle": false, "readStart": 28, "readEnd": 31, "asSupplied": { "readStart": 2, "readEnd": 5 }, "alignments": 1, "band": { "diagonalMin": -24, "diagonalMax": -24, "cellsNeeded": 27, "bandLimited": false } } ] } } ] } }, { "id": "ties-tandem-indel", "note": "Four GATTAC units in the reference, five in the read: a 6-base insertion inside a tandem repeat.", "input": { "reference": { "residues": "CCGTGATTACGATTACGATTACGATTACGGCA", "topology": "linear" }, "read": { "residues": "CCGTGATTACGATTACGATTACGATTACGATTACGGCA" }, "modes": [ "global", "semiglobal-read", "local" ] }, "expected": { "results": [ { "mode": "global", "region": null, "strand": "+", "strandUndetermined": false, "plus": { "score": 49, "count": 26, "overCap": false, "state": "aligned", "biopython": { "score": 49, "count": 26 }, "uniquePairs": [ [ 1, 1 ], [ 2, 2 ], [ 3, 3 ], [ 4, 4 ], [ 30, 36 ], [ 31, 37 ], [ 32, 38 ] ], "uniquePlacement": true, "placementNotDetermined": false, "noCommonColumn": false, "hull": { "refStart": 1, "refEnd": 32, "crossesOrigin": false, "wholeCircle": false }, "selected": { "coordinates": [ [ 0, 4, 4, 32 ], [ 0, 4, 10, 38 ] ], "gappedReference": "CCGT------GATTACGATTACGATTACGATTACGGCA", "gappedRead": "CCGTGATTACGATTACGATTACGATTACGATTACGGCA", "columns": 38, "identical": 32, "mismatches": 0, "ambiguousColumns": 0, "gapColumns": 6, "gapOpens": 1, "identity": { "numerator": 32, "denominator": 38 }, "readAligned": { "bases": 38, "of": 38 }, "referenceCovered": { "bases": 32, "of": 32 }, "placement": { "refStart": 1, "refEnd": 32, "readStart": 1, "readEnd": 38, "crossesOrigin": false }, "overhang": [], "differences": [ { "kind": "insertion", "refAfter": 4, "length": 6, "bases": "GATTAC", "readStart": 5, "readEnd": 10, "common": false, "notFixed": { "from": { "ref": 4, "read": 4 }, "to": { "ref": 30, "read": 36 } } } ] }, "band": { "diagonalMin": -6, "diagonalMax": 0, "cellsNeeded": 295, "unionBandLimited": false, "scope": "every optimal path", "gridCells": 1287, "searchedBanded": false, "sharedWords": 55, "sharedWordsOverCap": false, "seedGuarantee": { "differencesUpTo": 13, "guaranteed": false } }, "enumeration": "listed", "alignments": [ [ [ 0, 4, 4, 32 ], [ 0, 4, 10, 38 ] ], [ [ 0, 5, 5, 32 ], [ 0, 5, 11, 38 ] ], [ [ 0, 6, 6, 32 ], [ 0, 6, 12, 38 ] ], [ [ 0, 7, 7, 32 ], [ 0, 7, 13, 38 ] ], [ [ 0, 8, 8, 32 ], [ 0, 8, 14, 38 ] ], [ [ 0, 9, 9, 32 ], [ 0, 9, 15, 38 ] ], [ [ 0, 10, 10, 32 ], [ 0, 10, 16, 38 ] ], [ [ 0, 11, 11, 32 ], [ 0, 11, 17, 38 ] ], [ [ 0, 12, 12, 32 ], [ 0, 12, 18, 38 ] ], [ [ 0, 13, 13, 32 ], [ 0, 13, 19, 38 ] ], [ [ 0, 14, 14, 32 ], [ 0, 14, 20, 38 ] ], [ [ 0, 15, 15, 32 ], [ 0, 15, 21, 38 ] ], [ [ 0, 16, 16, 32 ], [ 0, 16, 22, 38 ] ], [ [ 0, 17, 17, 32 ], [ 0, 17, 23, 38 ] ], [ [ 0, 18, 18, 32 ], [ 0, 18, 24, 38 ] ], [ [ 0, 19, 19, 32 ], [ 0, 19, 25, 38 ] ], [ [ 0, 20, 20, 32 ], [ 0, 20, 26, 38 ] ], [ [ 0, 21, 21, 32 ], [ 0, 21, 27, 38 ] ], [ [ 0, 22, 22, 32 ], [ 0, 22, 28, 38 ] ], [ [ 0, 23, 23, 32 ], [ 0, 23, 29, 38 ] ], [ [ 0, 24, 24, 32 ], [ 0, 24, 30, 38 ] ], [ [ 0, 25, 25, 32 ], [ 0, 25, 31, 38 ] ], [ [ 0, 26, 26, 32 ], [ 0, 26, 32, 38 ] ], [ [ 0, 27, 27, 32 ], [ 0, 27, 33, 38 ] ], [ [ 0, 28, 28, 32 ], [ 0, 28, 34, 38 ] ], [ [ 0, 29, 29, 32 ], [ 0, 29, 35, 38 ] ] ], "tuples": [ [ 32, 0, 38, 0, 6, 1, 38, 32 ] ], "tupleFields": [ "identical", "ambiguousColumns", "columns", "mismatches", "gapColumns", "gapOpens", "readAligned", "referenceCovered" ], "variation": { "readAligned": { "shared": true, "min": 38, "max": 38 }, "referenceCovered": { "shared": true, "min": 32, "max": 32 }, "identity": { "shared": true, "min": { "numerator": 16, "denominator": 19 }, "max": { "numerator": 16, "denominator": 19 } }, "overhangStart": { "shared": true, "min": 0, "max": 0 }, "overhangEnd": { "shared": true, "min": 0, "max": 0 } }, "placements": [ { "refStart": 1, "refEnd": 32, "crossesOrigin": false, "wholeCircle": false, "readStart": 1, "readEnd": 38, "alignments": 26, "band": { "diagonalMin": -6, "diagonalMax": 0, "cellsNeeded": 295, "bandLimited": false } } ] }, "minus": { "score": -19, "count": 4, "overCap": false, "state": "aligned", "biopython": { "score": -19, "count": 4 }, "uniquePairs": [ [ 1, 3 ], [ 2, 4 ], [ 3, 5 ], [ 4, 6 ], [ 5, 7 ], [ 6, 8 ], [ 7, 9 ], [ 8, 12 ], [ 9, 13 ], [ 10, 16 ], [ 11, 17 ], [ 16, 22 ], [ 17, 23 ], [ 22, 28 ], [ 23, 29 ], [ 24, 32 ], [ 25, 33 ], [ 26, 34 ], [ 27, 35 ], [ 28, 36 ], [ 29, 37 ], [ 30, 38 ] ], "uniquePlacement": true, "placementNotDetermined": false, "noCommonColumn": false, "hull": { "refStart": 1, "refEnd": 30, "crossesOrigin": false, "wholeCircle": false }, "selected": { "coordinates": [ [ 0, 0, 7, 7, 9, 9, 11, 11, 14, 15, 17, 17, 20, 21, 23, 23, 30, 32 ], [ 0, 2, 9, 11, 13, 15, 17, 18, 21, 21, 23, 24, 27, 27, 29, 31, 38, 38 ] ], "gappedReference": "--CCGTGAT--TA--CG-ATTACG-ATTACG--ATTACGGCA", "gappedRead": "TGCCGTAATCGTAATCGTAAT-CGTAAT-CGTAATCACGG--", "columns": 42, "identical": 24, "mismatches": 4, "ambiguousColumns": 0, "gapColumns": 14, "gapOpens": 9, "identity": { "numerator": 24, "denominator": 42 }, "readAligned": { "bases": 36, "of": 38 }, "referenceCovered": { "bases": 30, "of": 32 }, "placement": { "refStart": 1, "refEnd": 30, "readStart": 3, "readEnd": 38, "crossesOrigin": false, "asSupplied": { "readStart": 1, "readEnd": 36 } }, "overhang": [], "differences": [ { "kind": "insertion", "refAfter": 0, "length": 2, "bases": "TG", "readStart": 1, "readEnd": 2, "asSupplied": { "readStart": 37, "readEnd": 38, "bases": "CA" }, "common": true }, { "kind": "substitution", "ref": 5, "refBase": "G", "readBase": "A", "read": 7, "common": true, "asSupplied": { "read": 32, "readBase": "T" } }, { "kind": "insertion", "refAfter": 7, "length": 2, "bases": "CG", "readStart": 10, "readEnd": 11, "asSupplied": { "readStart": 28, "readEnd": 29, "bases": "CG" }, "common": true }, { "kind": "insertion", "refAfter": 9, "length": 2, "bases": "AT", "readStart": 14, "readEnd": 15, "asSupplied": { "readStart": 24, "readEnd": 25, "bases": "AT" }, "common": true }, { "kind": "insertion", "refAfter": 11, "length": 1, "bases": "T", "readStart": 18, "readEnd": 18, "asSupplied": { "readStart": 21, "readEnd": 21, "bases": "A" }, "common": false, "notFixed": { "from": { "ref": 11, "read": 17, "readAsSupplied": 22 }, "to": { "ref": 16, "read": 22, "readAsSupplied": 17 } } }, { "kind": "substitution", "ref": 13, "refBase": "T", "readBase": "A", "read": 20, "common": false, "notFixed": { "from": { "ref": 11, "read": 17, "readAsSupplied": 22 }, "to": { "ref": 16, "read": 22, "readAsSupplied": 17 } }, "asSupplied": { "read": 19, "readBase": "T" } }, { "kind": "deletion", "refStart": 15, "refEnd": 15, "length": 1, "bases": "A", "readAfter": 21, "asSupplied": { "readBetween": [ 17, 18 ] }, "common": false, "notFixed": { "from": { "ref": 11, "read": 17, "readAsSupplied": 22 }, "to": { "ref": 16, "read": 22, "readAsSupplied": 17 } } }, { "kind": "insertion", "refAfter": 17, "length": 1, "bases": "T", "readStart": 24, "readEnd": 24, "asSupplied": { "readStart": 15, "readEnd": 15, "bases": "A" }, "common": false, "notFixed": { "from": { "ref": 17, "read": 23, "readAsSupplied": 16 }, "to": { "ref": 22, "read": 28, "readAsSupplied": 11 } } }, { "kind": "substitution", "ref": 19, "refBase": "T", "readBase": "A", "read": 26, "common": false, "notFixed": { "from": { "ref": 17, "read": 23, "readAsSupplied": 16 }, "to": { "ref": 22, "read": 28, "readAsSupplied": 11 } }, "asSupplied": { "read": 13, "readBase": "T" } }, { "kind": "deletion", "refStart": 21, "refEnd": 21, "length": 1, "bases": "A", "readAfter": 27, "asSupplied": { "readBetween": [ 11, 12 ] }, "common": false, "notFixed": { "from": { "ref": 17, "read": 23, "readAsSupplied": 16 }, "to": { "ref": 22, "read": 28, "readAsSupplied": 11 } } }, { "kind": "insertion", "refAfter": 23, "length": 2, "bases": "TA", "readStart": 30, "readEnd": 31, "asSupplied": { "readStart": 8, "readEnd": 9, "bases": "TA" }, "common": true }, { "kind": "substitution", "ref": 26, "refBase": "T", "readBase": "C", "read": 34, "common": true, "asSupplied": { "read": 5, "readBase": "G" } }, { "kind": "deletion", "refStart": 31, "refEnd": 32, "length": 2, "bases": "CA", "readAfter": 38, "asSupplied": { "readBetween": [ 0, 1 ] }, "common": true } ] }, "band": { "diagonalMin": -8, "diagonalMax": 0, "cellsNeeded": 356, "unionBandLimited": false, "scope": "every optimal path", "gridCells": 1287, "searchedBanded": false, "sharedWords": 0, "sharedWordsOverCap": false, "seedGuarantee": { "differencesUpTo": 47, "guaranteed": false } }, "enumeration": "listed", "alignments": [ [ [ 0, 0, 7, 7, 9, 9, 11, 11, 14, 15, 17, 17, 20, 21, 23, 23, 30, 32 ], [ 0, 2, 9, 11, 13, 15, 17, 18, 21, 21, 23, 24, 27, 27, 29, 31, 38, 38 ] ], [ [ 0, 0, 7, 7, 9, 9, 11, 12, 15, 15, 17, 17, 20, 21, 23, 23, 30, 32 ], [ 0, 2, 9, 11, 13, 15, 17, 17, 20, 21, 23, 24, 27, 27, 29, 31, 38, 38 ] ], [ [ 0, 0, 7, 7, 9, 9, 11, 11, 14, 15, 17, 18, 21, 21, 23, 23, 30, 32 ], [ 0, 2, 9, 11, 13, 15, 17, 18, 21, 21, 23, 23, 26, 27, 29, 31, 38, 38 ] ], [ [ 0, 0, 7, 7, 9, 9, 11, 12, 15, 15, 17, 18, 21, 21, 23, 23, 30, 32 ], [ 0, 2, 9, 11, 13, 15, 17, 17, 20, 21, 23, 23, 26, 27, 29, 31, 38, 38 ] ] ], "tuples": [ [ 24, 0, 42, 4, 14, 9, 36, 30 ] ], "tupleFields": [ "identical", "ambiguousColumns", "columns", "mismatches", "gapColumns", "gapOpens", "readAligned", "referenceCovered" ], "variation": { "readAligned": { "shared": true, "min": 36, "max": 36 }, "referenceCovered": { "shared": true, "min": 30, "max": 30 }, "identity": { "shared": true, "min": { "numerator": 4, "denominator": 7 }, "max": { "numerator": 4, "denominator": 7 } }, "overhangStart": { "shared": true, "min": 0, "max": 0 }, "overhangEnd": { "shared": true, "min": 0, "max": 0 } }, "placements": [ { "refStart": 1, "refEnd": 30, "crossesOrigin": false, "wholeCircle": false, "readStart": 3, "readEnd": 38, "asSupplied": { "readStart": 1, "readEnd": 36 }, "alignments": 4, "band": { "diagonalMin": -8, "diagonalMax": 0, "cellsNeeded": 356, "bandLimited": false } } ] } }, { "mode": "semiglobal-read", "region": null, "strand": "+", "strandUndetermined": false, "plus": { "score": 49, "count": 26, "overCap": false, "state": "aligned", "biopython": { "score": 49, "count": 26 }, "uniquePairs": [ [ 1, 1 ], [ 2, 2 ], [ 3, 3 ], [ 4, 4 ], [ 30, 36 ], [ 31, 37 ], [ 32, 38 ] ], "uniquePlacement": true, "placementNotDetermined": false, "noCommonColumn": false, "hull": { "refStart": 1, "refEnd": 32, "crossesOrigin": false, "wholeCircle": false }, "selected": { "coordinates": [ [ 0, 4, 4, 32 ], [ 0, 4, 10, 38 ] ], "gappedReference": "CCGT------GATTACGATTACGATTACGATTACGGCA", "gappedRead": "CCGTGATTACGATTACGATTACGATTACGATTACGGCA", "columns": 38, "identical": 32, "mismatches": 0, "ambiguousColumns": 0, "gapColumns": 6, "gapOpens": 1, "identity": { "numerator": 32, "denominator": 38 }, "readAligned": { "bases": 38, "of": 38 }, "referenceCovered": { "bases": 32, "of": 32 }, "placement": { "refStart": 1, "refEnd": 32, "readStart": 1, "readEnd": 38, "crossesOrigin": false }, "overhang": [], "differences": [ { "kind": "insertion", "refAfter": 4, "length": 6, "bases": "GATTAC", "readStart": 5, "readEnd": 10, "common": false, "notFixed": { "from": { "ref": 4, "read": 4 }, "to": { "ref": 30, "read": 36 } } } ] }, "band": { "diagonalMin": -6, "diagonalMax": 0, "cellsNeeded": 295, "unionBandLimited": false, "scope": "every optimal path", "gridCells": 1287, "searchedBanded": false, "sharedWords": 55, "sharedWordsOverCap": false, "seedGuarantee": { "differencesUpTo": 13, "guaranteed": false } }, "enumeration": "listed", "alignments": [ [ [ 0, 4, 4, 32 ], [ 0, 4, 10, 38 ] ], [ [ 0, 5, 5, 32 ], [ 0, 5, 11, 38 ] ], [ [ 0, 6, 6, 32 ], [ 0, 6, 12, 38 ] ], [ [ 0, 7, 7, 32 ], [ 0, 7, 13, 38 ] ], [ [ 0, 8, 8, 32 ], [ 0, 8, 14, 38 ] ], [ [ 0, 9, 9, 32 ], [ 0, 9, 15, 38 ] ], [ [ 0, 10, 10, 32 ], [ 0, 10, 16, 38 ] ], [ [ 0, 11, 11, 32 ], [ 0, 11, 17, 38 ] ], [ [ 0, 12, 12, 32 ], [ 0, 12, 18, 38 ] ], [ [ 0, 13, 13, 32 ], [ 0, 13, 19, 38 ] ], [ [ 0, 14, 14, 32 ], [ 0, 14, 20, 38 ] ], [ [ 0, 15, 15, 32 ], [ 0, 15, 21, 38 ] ], [ [ 0, 16, 16, 32 ], [ 0, 16, 22, 38 ] ], [ [ 0, 17, 17, 32 ], [ 0, 17, 23, 38 ] ], [ [ 0, 18, 18, 32 ], [ 0, 18, 24, 38 ] ], [ [ 0, 19, 19, 32 ], [ 0, 19, 25, 38 ] ], [ [ 0, 20, 20, 32 ], [ 0, 20, 26, 38 ] ], [ [ 0, 21, 21, 32 ], [ 0, 21, 27, 38 ] ], [ [ 0, 22, 22, 32 ], [ 0, 22, 28, 38 ] ], [ [ 0, 23, 23, 32 ], [ 0, 23, 29, 38 ] ], [ [ 0, 24, 24, 32 ], [ 0, 24, 30, 38 ] ], [ [ 0, 25, 25, 32 ], [ 0, 25, 31, 38 ] ], [ [ 0, 26, 26, 32 ], [ 0, 26, 32, 38 ] ], [ [ 0, 27, 27, 32 ], [ 0, 27, 33, 38 ] ], [ [ 0, 28, 28, 32 ], [ 0, 28, 34, 38 ] ], [ [ 0, 29, 29, 32 ], [ 0, 29, 35, 38 ] ] ], "tuples": [ [ 32, 0, 38, 0, 6, 1, 38, 32 ] ], "tupleFields": [ "identical", "ambiguousColumns", "columns", "mismatches", "gapColumns", "gapOpens", "readAligned", "referenceCovered" ], "variation": { "readAligned": { "shared": true, "min": 38, "max": 38 }, "referenceCovered": { "shared": true, "min": 32, "max": 32 }, "identity": { "shared": true, "min": { "numerator": 16, "denominator": 19 }, "max": { "numerator": 16, "denominator": 19 } }, "overhangStart": { "shared": true, "min": 0, "max": 0 }, "overhangEnd": { "shared": true, "min": 0, "max": 0 } }, "placements": [ { "refStart": 1, "refEnd": 32, "crossesOrigin": false, "wholeCircle": false, "readStart": 1, "readEnd": 38, "alignments": 26, "band": { "diagonalMin": -6, "diagonalMax": 0, "cellsNeeded": 295, "bandLimited": false } } ] }, "minus": { "score": -12, "count": 4, "overCap": false, "state": "aligned", "biopython": { "score": -12, "count": 4 }, "uniquePairs": [ [ 1, 3 ], [ 2, 4 ], [ 3, 5 ], [ 4, 6 ], [ 5, 7 ], [ 6, 8 ], [ 7, 9 ], [ 8, 12 ], [ 9, 13 ], [ 10, 16 ], [ 11, 17 ], [ 16, 22 ], [ 17, 23 ], [ 22, 28 ], [ 23, 29 ], [ 24, 32 ], [ 25, 33 ], [ 26, 34 ], [ 27, 35 ], [ 28, 36 ], [ 29, 37 ], [ 30, 38 ] ], "uniquePlacement": true, "placementNotDetermined": false, "noCommonColumn": false, "hull": { "refStart": 1, "refEnd": 30, "crossesOrigin": false, "wholeCircle": false }, "selected": { "coordinates": [ [ 0, 0, 7, 7, 9, 9, 11, 11, 14, 15, 17, 17, 20, 21, 23, 23, 30, 32 ], [ 0, 2, 9, 11, 13, 15, 17, 18, 21, 21, 23, 24, 27, 27, 29, 31, 38, 38 ] ], "gappedReference": "CCGTGAT--TA--CG-ATTACG-ATTACG--ATTACGG", "gappedRead": "CCGTAATCGTAATCGTAAT-CGTAAT-CGTAATCACGG", "columns": 38, "identical": 24, "mismatches": 4, "ambiguousColumns": 0, "gapColumns": 10, "gapOpens": 7, "identity": { "numerator": 24, "denominator": 38 }, "readAligned": { "bases": 36, "of": 38 }, "referenceCovered": { "bases": 30, "of": 32 }, "placement": { "refStart": 1, "refEnd": 30, "readStart": 3, "readEnd": 38, "crossesOrigin": false, "asSupplied": { "readStart": 1, "readEnd": 36 } }, "overhang": [ { "side": "start", "at": "reference-end", "length": 2, "bases": "TG", "readStart": 1, "readEnd": 2, "asSupplied": { "readStart": 37, "readEnd": 38, "bases": "CA" } } ], "differences": [ { "kind": "substitution", "ref": 5, "refBase": "G", "readBase": "A", "read": 7, "common": true, "asSupplied": { "read": 32, "readBase": "T" } }, { "kind": "insertion", "refAfter": 7, "length": 2, "bases": "CG", "readStart": 10, "readEnd": 11, "asSupplied": { "readStart": 28, "readEnd": 29, "bases": "CG" }, "common": true }, { "kind": "insertion", "refAfter": 9, "length": 2, "bases": "AT", "readStart": 14, "readEnd": 15, "asSupplied": { "readStart": 24, "readEnd": 25, "bases": "AT" }, "common": true }, { "kind": "insertion", "refAfter": 11, "length": 1, "bases": "T", "readStart": 18, "readEnd": 18, "asSupplied": { "readStart": 21, "readEnd": 21, "bases": "A" }, "common": false, "notFixed": { "from": { "ref": 11, "read": 17, "readAsSupplied": 22 }, "to": { "ref": 16, "read": 22, "readAsSupplied": 17 } } }, { "kind": "substitution", "ref": 13, "refBase": "T", "readBase": "A", "read": 20, "common": false, "notFixed": { "from": { "ref": 11, "read": 17, "readAsSupplied": 22 }, "to": { "ref": 16, "read": 22, "readAsSupplied": 17 } }, "asSupplied": { "read": 19, "readBase": "T" } }, { "kind": "deletion", "refStart": 15, "refEnd": 15, "length": 1, "bases": "A", "readAfter": 21, "asSupplied": { "readBetween": [ 17, 18 ] }, "common": false, "notFixed": { "from": { "ref": 11, "read": 17, "readAsSupplied": 22 }, "to": { "ref": 16, "read": 22, "readAsSupplied": 17 } } }, { "kind": "insertion", "refAfter": 17, "length": 1, "bases": "T", "readStart": 24, "readEnd": 24, "asSupplied": { "readStart": 15, "readEnd": 15, "bases": "A" }, "common": false, "notFixed": { "from": { "ref": 17, "read": 23, "readAsSupplied": 16 }, "to": { "ref": 22, "read": 28, "readAsSupplied": 11 } } }, { "kind": "substitution", "ref": 19, "refBase": "T", "readBase": "A", "read": 26, "common": false, "notFixed": { "from": { "ref": 17, "read": 23, "readAsSupplied": 16 }, "to": { "ref": 22, "read": 28, "readAsSupplied": 11 } }, "asSupplied": { "read": 13, "readBase": "T" } }, { "kind": "deletion", "refStart": 21, "refEnd": 21, "length": 1, "bases": "A", "readAfter": 27, "asSupplied": { "readBetween": [ 11, 12 ] }, "common": false, "notFixed": { "from": { "ref": 17, "read": 23, "readAsSupplied": 16 }, "to": { "ref": 22, "read": 28, "readAsSupplied": 11 } } }, { "kind": "insertion", "refAfter": 23, "length": 2, "bases": "TA", "readStart": 30, "readEnd": 31, "asSupplied": { "readStart": 8, "readEnd": 9, "bases": "TA" }, "common": true }, { "kind": "substitution", "ref": 26, "refBase": "T", "readBase": "C", "read": 34, "common": true, "asSupplied": { "read": 5, "readBase": "G" } } ] }, "band": { "diagonalMin": -8, "diagonalMax": -1, "cellsNeeded": 324, "unionBandLimited": false, "scope": "every optimal path", "gridCells": 1287, "searchedBanded": false, "sharedWords": 0, "sharedWordsOverCap": false, "seedGuarantee": { "differencesUpTo": 44, "guaranteed": false } }, "enumeration": "listed", "alignments": [ [ [ 0, 0, 7, 7, 9, 9, 11, 11, 14, 15, 17, 17, 20, 21, 23, 23, 30, 32 ], [ 0, 2, 9, 11, 13, 15, 17, 18, 21, 21, 23, 24, 27, 27, 29, 31, 38, 38 ] ], [ [ 0, 0, 7, 7, 9, 9, 11, 12, 15, 15, 17, 17, 20, 21, 23, 23, 30, 32 ], [ 0, 2, 9, 11, 13, 15, 17, 17, 20, 21, 23, 24, 27, 27, 29, 31, 38, 38 ] ], [ [ 0, 0, 7, 7, 9, 9, 11, 11, 14, 15, 17, 18, 21, 21, 23, 23, 30, 32 ], [ 0, 2, 9, 11, 13, 15, 17, 18, 21, 21, 23, 23, 26, 27, 29, 31, 38, 38 ] ], [ [ 0, 0, 7, 7, 9, 9, 11, 12, 15, 15, 17, 18, 21, 21, 23, 23, 30, 32 ], [ 0, 2, 9, 11, 13, 15, 17, 17, 20, 21, 23, 23, 26, 27, 29, 31, 38, 38 ] ] ], "tuples": [ [ 24, 0, 38, 4, 10, 7, 36, 30 ] ], "tupleFields": [ "identical", "ambiguousColumns", "columns", "mismatches", "gapColumns", "gapOpens", "readAligned", "referenceCovered" ], "variation": { "readAligned": { "shared": true, "min": 36, "max": 36 }, "referenceCovered": { "shared": true, "min": 30, "max": 30 }, "identity": { "shared": true, "min": { "numerator": 12, "denominator": 19 }, "max": { "numerator": 12, "denominator": 19 } }, "overhangStart": { "shared": true, "min": 2, "max": 2 }, "overhangEnd": { "shared": true, "min": 0, "max": 0 } }, "placements": [ { "refStart": 1, "refEnd": 30, "crossesOrigin": false, "wholeCircle": false, "readStart": 3, "readEnd": 38, "asSupplied": { "readStart": 1, "readEnd": 36 }, "alignments": 4, "band": { "diagonalMin": -8, "diagonalMax": -1, "cellsNeeded": 324, "bandLimited": false } } ] } }, { "mode": "local", "region": null, "strand": "+", "strandUndetermined": false, "plus": { "score": 58, "count": 1, "overCap": false, "state": "aligned", "biopython": { "score": 58, "count": 1 }, "uniquePairs": [ [ 1, 1 ], [ 2, 2 ], [ 3, 3 ], [ 4, 4 ], [ 5, 5 ], [ 6, 6 ], [ 7, 7 ], [ 8, 8 ], [ 9, 9 ], [ 10, 10 ], [ 11, 11 ], [ 12, 12 ], [ 13, 13 ], [ 14, 14 ], [ 15, 15 ], [ 16, 16 ], [ 17, 17 ], [ 18, 18 ], [ 19, 19 ], [ 20, 20 ], [ 21, 21 ], [ 22, 22 ], [ 23, 23 ], [ 24, 24 ], [ 25, 25 ], [ 26, 26 ], [ 27, 27 ], [ 28, 28 ], [ 29, 29 ] ], "uniquePlacement": true, "placementNotDetermined": false, "noCommonColumn": false, "hull": { "refStart": 1, "refEnd": 29, "crossesOrigin": false, "wholeCircle": false }, "selected": { "coordinates": [ [ 0, 29 ], [ 0, 29 ] ], "gappedReference": "CCGTGATTACGATTACGATTACGATTACG", "gappedRead": "CCGTGATTACGATTACGATTACGATTACG", "columns": 29, "identical": 29, "mismatches": 0, "ambiguousColumns": 0, "gapColumns": 0, "gapOpens": 0, "identity": { "numerator": 29, "denominator": 29 }, "readAligned": { "bases": 29, "of": 38 }, "referenceCovered": { "bases": 29, "of": 32 }, "placement": { "refStart": 1, "refEnd": 29, "readStart": 1, "readEnd": 29, "crossesOrigin": false }, "overhang": [], "differences": [] }, "band": { "diagonalMin": 0, "diagonalMax": 0, "cellsNeeded": 98, "unionBandLimited": false, "scope": "every optimal path", "gridCells": 1287, "searchedBanded": false, "sharedWords": 55, "sharedWordsOverCap": false, "seedGuarantee": { "differencesUpTo": 9, "guaranteed": false } }, "enumeration": "listed", "alignments": [ [ [ 0, 29 ], [ 0, 29 ] ] ], "tuples": [ [ 29, 0, 29, 0, 0, 0, 29, 29 ] ], "tupleFields": [ "identical", "ambiguousColumns", "columns", "mismatches", "gapColumns", "gapOpens", "readAligned", "referenceCovered" ], "variation": { "readAligned": { "shared": true, "min": 29, "max": 29 }, "referenceCovered": { "shared": true, "min": 29, "max": 29 }, "identity": { "shared": true, "min": { "numerator": 1, "denominator": 1 }, "max": { "numerator": 1, "denominator": 1 } }, "overhangStart": { "shared": true, "min": 0, "max": 0 }, "overhangEnd": { "shared": true, "min": 0, "max": 0 } }, "placements": [ { "refStart": 1, "refEnd": 29, "crossesOrigin": false, "wholeCircle": false, "readStart": 1, "readEnd": 29, "alignments": 1, "band": { "diagonalMin": 0, "diagonalMax": 0, "cellsNeeded": 98, "bandLimited": false } } ] }, "minus": { "score": 10, "count": 1, "overCap": false, "state": "aligned", "biopython": { "score": 10, "count": 1 }, "uniquePairs": [ [ 2, 28 ], [ 3, 29 ], [ 4, 30 ], [ 5, 31 ], [ 6, 32 ], [ 7, 33 ], [ 8, 34 ], [ 9, 35 ], [ 10, 36 ], [ 11, 37 ] ], "uniquePlacement": true, "placementNotDetermined": false, "noCommonColumn": false, "hull": { "refStart": 2, "refEnd": 11, "crossesOrigin": false, "wholeCircle": false }, "selected": { "coordinates": [ [ 1, 11 ], [ 27, 37 ] ], "gappedReference": "CGTGATTACG", "gappedRead": "CGTAATCACG", "columns": 10, "identical": 8, "mismatches": 2, "ambiguousColumns": 0, "gapColumns": 0, "gapOpens": 0, "identity": { "numerator": 8, "denominator": 10 }, "readAligned": { "bases": 10, "of": 38 }, "referenceCovered": { "bases": 10, "of": 32 }, "placement": { "refStart": 2, "refEnd": 11, "readStart": 28, "readEnd": 37, "crossesOrigin": false, "asSupplied": { "readStart": 2, "readEnd": 11 } }, "overhang": [], "differences": [ { "kind": "substitution", "ref": 5, "refBase": "G", "readBase": "A", "read": 31, "common": true, "asSupplied": { "read": 8, "readBase": "T" } }, { "kind": "substitution", "ref": 8, "refBase": "T", "readBase": "C", "read": 34, "common": true, "asSupplied": { "read": 5, "readBase": "G" } } ] }, "band": { "diagonalMin": -26, "diagonalMax": -26, "cellsNeeded": 39, "unionBandLimited": false, "scope": "every optimal path", "gridCells": 1287, "searchedBanded": false, "sharedWords": 0, "sharedWordsOverCap": false, "seedGuarantee": { "differencesUpTo": 33, "guaranteed": false } }, "enumeration": "listed", "alignments": [ [ [ 1, 11 ], [ 27, 37 ] ] ], "tuples": [ [ 8, 0, 10, 2, 0, 0, 10, 10 ] ], "tupleFields": [ "identical", "ambiguousColumns", "columns", "mismatches", "gapColumns", "gapOpens", "readAligned", "referenceCovered" ], "variation": { "readAligned": { "shared": true, "min": 10, "max": 10 }, "referenceCovered": { "shared": true, "min": 10, "max": 10 }, "identity": { "shared": true, "min": { "numerator": 4, "denominator": 5 }, "max": { "numerator": 4, "denominator": 5 } }, "overhangStart": { "shared": true, "min": 0, "max": 0 }, "overhangEnd": { "shared": true, "min": 0, "max": 0 } }, "placements": [ { "refStart": 2, "refEnd": 11, "crossesOrigin": false, "wholeCircle": false, "readStart": 28, "readEnd": 37, "asSupplied": { "readStart": 2, "readEnd": 11 }, "alignments": 1, "band": { "diagonalMin": -26, "diagonalMax": -26, "cellsNeeded": 39, "bandLimited": false } } ] } } ] } }, { "id": "ties-over-cap", "note": "Three runs of 11 read as 10: 11 x 11 x 11 = 1,331 co-optimal alignments, over the enumeration cap of 1,000, so none is listed.", "input": { "reference": { "residues": "GCATGCAAAAAAAAAAAGTCAGCTTTTTTTTTTTCAGTCAGGGGGGGGGGGATCGAT", "topology": "linear" }, "read": { "residues": "GCATGCAAAAAAAAAAGTCAGCTTTTTTTTTTCAGTCAGGGGGGGGGGATCGAT" }, "modes": [ "global", "semiglobal-read" ] }, "expected": { "results": [ { "mode": "global", "region": null, "strand": "+", "strandUndetermined": false, "plus": { "score": 93, "count": 1331, "overCap": true, "state": "aligned", "biopython": { "score": 93, "count": 1331 }, "uniquePairs": [ [ 1, 1 ], [ 2, 2 ], [ 3, 3 ], [ 4, 4 ], [ 5, 5 ], [ 6, 6 ], [ 18, 17 ], [ 19, 18 ], [ 20, 19 ], [ 21, 20 ], [ 22, 21 ], [ 23, 22 ], [ 35, 33 ], [ 36, 34 ], [ 37, 35 ], [ 38, 36 ], [ 39, 37 ], [ 40, 38 ], [ 52, 49 ], [ 53, 50 ], [ 54, 51 ], [ 55, 52 ], [ 56, 53 ], [ 57, 54 ] ], "uniquePlacement": true, "placementNotDetermined": false, "noCommonColumn": false, "hull": { "refStart": 1, "refEnd": 57, "crossesOrigin": false, "wholeCircle": false }, "selected": { "coordinates": [ [ 0, 6, 7, 23, 24, 40, 41, 57 ], [ 0, 6, 6, 22, 22, 38, 38, 54 ] ], "gappedReference": "GCATGCAAAAAAAAAAAGTCAGCTTTTTTTTTTTCAGTCAGGGGGGGGGGGATCGAT", "gappedRead": "GCATGC-AAAAAAAAAAGTCAGC-TTTTTTTTTTCAGTCA-GGGGGGGGGGATCGAT", "columns": 57, "identical": 54, "mismatches": 0, "ambiguousColumns": 0, "gapColumns": 3, "gapOpens": 3, "identity": { "numerator": 54, "denominator": 57 }, "readAligned": { "bases": 54, "of": 54 }, "referenceCovered": { "bases": 57, "of": 57 }, "placement": { "refStart": 1, "refEnd": 57, "readStart": 1, "readEnd": 54, "crossesOrigin": false }, "overhang": [], "differences": [ { "kind": "deletion", "refStart": 7, "refEnd": 7, "length": 1, "bases": "A", "readAfter": 6, "common": false, "notFixed": { "from": { "ref": 6, "read": 6 }, "to": { "ref": 18, "read": 17 } } }, { "kind": "deletion", "refStart": 24, "refEnd": 24, "length": 1, "bases": "T", "readAfter": 22, "common": false, "notFixed": { "from": { "ref": 23, "read": 22 }, "to": { "ref": 35, "read": 33 } } }, { "kind": "deletion", "refStart": 41, "refEnd": 41, "length": 1, "bases": "G", "readAfter": 38, "common": false, "notFixed": { "from": { "ref": 40, "read": 38 }, "to": { "ref": 52, "read": 49 } } } ] }, "band": { "diagonalMin": 0, "diagonalMax": 3, "cellsNeeded": 328, "unionBandLimited": false, "scope": "every optimal path", "gridCells": 3190, "searchedBanded": false, "sharedWords": 40, "sharedWordsOverCap": false, "seedGuarantee": { "differencesUpTo": 7, "guaranteed": false } }, "enumeration": "checked", "tuples": [ [ 54, 0, 57, 0, 3, 3, 54, 57 ] ], "tupleFields": [ "identical", "ambiguousColumns", "columns", "mismatches", "gapColumns", "gapOpens", "readAligned", "referenceCovered" ], "variation": { "readAligned": { "shared": true, "min": 54, "max": 54 }, "referenceCovered": { "shared": true, "min": 57, "max": 57 }, "identity": { "shared": true, "min": { "numerator": 18, "denominator": 19 }, "max": { "numerator": 18, "denominator": 19 } }, "overhangStart": { "shared": true, "min": 0, "max": 0 }, "overhangEnd": { "shared": true, "min": 0, "max": 0 } }, "placements": [ { "refStart": 1, "refEnd": 57, "crossesOrigin": false, "wholeCircle": false, "readStart": 1, "readEnd": 54, "alignments": 1331, "band": { "diagonalMin": 0, "diagonalMax": 3, "cellsNeeded": 328, "bandLimited": false } } ] }, "minus": { "score": -44, "count": 96, "overCap": false, "state": "aligned", "biopython": { "score": -44, "count": 96 }, "uniquePairs": [ [ 8, 23 ], [ 9, 24 ], [ 10, 25 ], [ 11, 26 ], [ 12, 27 ], [ 13, 28 ], [ 14, 29 ], [ 15, 30 ], [ 16, 31 ], [ 17, 32 ], [ 18, 33 ], [ 23, 38 ], [ 24, 39 ], [ 25, 40 ], [ 26, 41 ], [ 27, 42 ], [ 28, 43 ], [ 29, 44 ], [ 30, 45 ], [ 31, 46 ], [ 32, 47 ], [ 33, 48 ], [ 54, 54 ] ], "uniquePlacement": true, "placementNotDetermined": false, "noCommonColumn": false, "hull": { "refStart": 1, "refEnd": 54, "crossesOrigin": false, "wholeCircle": false }, "selected": { "coordinates": [ [ 0, 0, 1, 1, 5, 5, 6, 6, 18, 18, 21, 22, 36, 37, 38, 40, 41, 53, 54, 57 ], [ 0, 3, 4, 14, 18, 19, 20, 21, 33, 34, 37, 37, 51, 51, 52, 52, 53, 53, 54, 54 ] ], "gappedReference": "---G----------CATG-C-AAAAAAAAAAAG-TCAGCTTTTTTTTTTTCAGTCAGGGGGGGGGGGATCGAT", "gappedRead": "ATCGATCCCCCCCCCCTGACTGAAAAAAAAAAGCTGA-CTTTTTTTTTTGCA-T--G------------C---", "columns": 73, "identical": 34, "mismatches": 4, "ambiguousColumns": 0, "gapColumns": 35, "gapOpens": 10, "identity": { "numerator": 34, "denominator": 73 }, "readAligned": { "bases": 51, "of": 54 }, "referenceCovered": { "bases": 54, "of": 57 }, "placement": { "refStart": 1, "refEnd": 54, "readStart": 4, "readEnd": 54, "crossesOrigin": false, "asSupplied": { "readStart": 1, "readEnd": 51 } }, "overhang": [], "differences": [ { "kind": "insertion", "refAfter": 0, "length": 3, "bases": "ATC", "readStart": 1, "readEnd": 3, "asSupplied": { "readStart": 52, "readEnd": 54, "bases": "GAT" }, "common": false, "notFixed": { "from": null, "to": { "ref": 8, "read": 23, "readAsSupplied": 32 } } }, { "kind": "insertion", "refAfter": 1, "length": 10, "bases": "ATCCCCCCCC", "readStart": 5, "readEnd": 14, "asSupplied": { "readStart": 41, "readEnd": 50, "bases": "GGGGGGGGAT" }, "common": false, "notFixed": { "from": null, "to": { "ref": 8, "read": 23, "readAsSupplied": 32 } } }, { "kind": "substitution", "ref": 3, "refBase": "A", "readBase": "C", "read": 16, "common": false, "notFixed": { "from": null, "to": { "ref": 8, "read": 23, "readAsSupplied": 32 } }, "asSupplied": { "read": 39, "readBase": "G" } }, { "kind": "insertion", "refAfter": 5, "length": 1, "bases": "A", "readStart": 19, "readEnd": 19, "asSupplied": { "readStart": 36, "readEnd": 36, "bases": "T" }, "common": false, "notFixed": { "from": null, "to": { "ref": 8, "read": 23, "readAsSupplied": 32 } } }, { "kind": "insertion", "refAfter": 6, "length": 1, "bases": "T", "readStart": 21, "readEnd": 21, "asSupplied": { "readStart": 34, "readEnd": 34, "bases": "A" }, "common": false, "notFixed": { "from": null, "to": { "ref": 8, "read": 23, "readAsSupplied": 32 } } }, { "kind": "substitution", "ref": 7, "refBase": "A", "readBase": "G", "read": 22, "common": false, "notFixed": { "from": null, "to": { "ref": 8, "read": 23, "readAsSupplied": 32 } }, "asSupplied": { "read": 33, "readBase": "C" } }, { "kind": "insertion", "refAfter": 18, "length": 1, "bases": "C", "readStart": 34, "readEnd": 34, "asSupplied": { "readStart": 21, "readEnd": 21, "bases": "G" }, "common": false, "notFixed": { "from": { "ref": 18, "read": 33, "readAsSupplied": 22 }, "to": { "ref": 23, "read": 38, "readAsSupplied": 17 } } }, { "kind": "substitution", "ref": 20, "refBase": "C", "readBase": "G", "read": 36, "common": false, "notFixed": { "from": { "ref": 18, "read": 33, "readAsSupplied": 22 }, "to": { "ref": 23, "read": 38, "readAsSupplied": 17 } }, "asSupplied": { "read": 19, "readBase": "C" } }, { "kind": "deletion", "refStart": 22, "refEnd": 22, "length": 1, "bases": "G", "readAfter": 37, "asSupplied": { "readBetween": [ 17, 18 ] }, "common": false, "notFixed": { "from": { "ref": 18, "read": 33, "readAsSupplied": 22 }, "to": { "ref": 23, "read": 38, "readAsSupplied": 17 } } }, { "kind": "substitution", "ref": 34, "refBase": "T", "readBase": "G", "read": 49, "common": false, "notFixed": { "from": { "ref": 33, "read": 48, "readAsSupplied": 7 }, "to": { "ref": 54, "read": 54, "readAsSupplied": 1 } }, "asSupplied": { "read": 6, "readBase": "C" } }, { "kind": "deletion", "refStart": 37, "refEnd": 37, "length": 1, "bases": "G", "readAfter": 51, "asSupplied": { "readBetween": [ 3, 4 ] }, "common": false, "notFixed": { "from": { "ref": 33, "read": 48, "readAsSupplied": 7 }, "to": { "ref": 54, "read": 54, "readAsSupplied": 1 } } }, { "kind": "deletion", "refStart": 39, "refEnd": 40, "length": 2, "bases": "CA", "readAfter": 52, "asSupplied": { "readBetween": [ 2, 3 ] }, "common": false, "notFixed": { "from": { "ref": 33, "read": 48, "readAsSupplied": 7 }, "to": { "ref": 54, "read": 54, "readAsSupplied": 1 } } }, { "kind": "deletion", "refStart": 42, "refEnd": 53, "length": 12, "bases": "GGGGGGGGGGAT", "readAfter": 53, "asSupplied": { "readBetween": [ 1, 2 ] }, "common": false, "notFixed": { "from": { "ref": 33, "read": 48, "readAsSupplied": 7 }, "to": { "ref": 54, "read": 54, "readAsSupplied": 1 } } }, { "kind": "deletion", "refStart": 55, "refEnd": 57, "length": 3, "bases": "GAT", "readAfter": 54, "asSupplied": { "readBetween": [ 0, 1 ] }, "common": true } ] }, "band": { "diagonalMin": -16, "diagonalMax": 3, "cellsNeeded": 1056, "unionBandLimited": false, "scope": "every optimal path", "gridCells": 3190, "searchedBanded": false, "sharedWords": 0, "sharedWordsOverCap": false, "seedGuarantee": { "differencesUpTo": 76, "guaranteed": false } }, "enumeration": "listed", "alignments": [ [ [ 0, 0, 1, 1, 5, 5, 6, 6, 18, 18, 21, 22, 36, 37, 38, 40, 41, 53, 54, 57 ], [ 0, 3, 4, 14, 18, 19, 20, 21, 33, 34, 37, 37, 51, 51, 52, 52, 53, 53, 54, 54 ] ], [ [ 0, 0, 2, 2, 6, 6, 7, 7, 18, 18, 21, 22, 36, 37, 38, 40, 41, 53, 54, 57 ], [ 0, 1, 3, 4, 8, 18, 19, 22, 33, 34, 37, 37, 51, 51, 52, 52, 53, 53, 54, 54 ] ], [ [ 0, 1, 1, 2, 2, 6, 6, 7, 7, 18, 18, 21, 22, 36, 37, 38, 40, 41, 53, 54, 57 ], [ 0, 1, 2, 3, 4, 8, 18, 19, 22, 33, 34, 37, 37, 51, 51, 52, 52, 53, 53, 54, 54 ] ], [ [ 0, 0, 1, 1, 5, 5, 7, 7, 18, 18, 21, 22, 36, 37, 38, 40, 41, 53, 54, 57 ], [ 0, 3, 4, 14, 18, 19, 21, 22, 33, 34, 37, 37, 51, 51, 52, 52, 53, 53, 54, 54 ] ], [ [ 0, 0, 1, 1, 5, 5, 6, 6, 18, 19, 22, 22, 36, 37, 38, 40, 41, 53, 54, 57 ], [ 0, 3, 4, 14, 18, 19, 20, 21, 33, 33, 36, 37, 51, 51, 52, 52, 53, 53, 54, 54 ] ], [ [ 0, 0, 2, 2, 6, 6, 7, 7, 18, 19, 22, 22, 36, 37, 38, 40, 41, 53, 54, 57 ], [ 0, 1, 3, 4, 8, 18, 19, 22, 33, 33, 36, 37, 51, 51, 52, 52, 53, 53, 54, 54 ] ], [ [ 0, 1, 1, 2, 2, 6, 6, 7, 7, 18, 19, 22, 22, 36, 37, 38, 40, 41, 53, 54, 57 ], [ 0, 1, 2, 3, 4, 8, 18, 19, 22, 33, 33, 36, 37, 51, 51, 52, 52, 53, 53, 54, 54 ] ], [ [ 0, 0, 1, 1, 5, 5, 7, 7, 18, 19, 22, 22, 36, 37, 38, 40, 41, 53, 54, 57 ], [ 0, 3, 4, 14, 18, 19, 21, 22, 33, 33, 36, 37, 51, 51, 52, 52, 53, 53, 54, 54 ] ], [ [ 0, 0, 1, 1, 5, 5, 6, 6, 18, 18, 21, 22, 33, 36, 37, 38, 42, 53, 54, 57 ], [ 0, 3, 4, 14, 18, 19, 20, 21, 33, 34, 37, 37, 48, 48, 49, 49, 53, 53, 54, 54 ] ], [ [ 0, 0, 2, 2, 6, 6, 7, 7, 18, 18, 21, 22, 33, 36, 37, 38, 42, 53, 54, 57 ], [ 0, 1, 3, 4, 8, 18, 19, 22, 33, 34, 37, 37, 48, 48, 49, 49, 53, 53, 54, 54 ] ], [ [ 0, 1, 1, 2, 2, 6, 6, 7, 7, 18, 18, 21, 22, 33, 36, 37, 38, 42, 53, 54, 57 ], [ 0, 1, 2, 3, 4, 8, 18, 19, 22, 33, 34, 37, 37, 48, 48, 49, 49, 53, 53, 54, 54 ] ], [ [ 0, 0, 1, 1, 5, 5, 7, 7, 18, 18, 21, 22, 33, 36, 37, 38, 42, 53, 54, 57 ], [ 0, 3, 4, 14, 18, 19, 21, 22, 33, 34, 37, 37, 48, 48, 49, 49, 53, 53, 54, 54 ] ], [ [ 0, 0, 1, 1, 5, 5, 6, 6, 18, 19, 22, 22, 33, 36, 37, 38, 42, 53, 54, 57 ], [ 0, 3, 4, 14, 18, 19, 20, 21, 33, 33, 36, 37, 48, 48, 49, 49, 53, 53, 54, 54 ] ], [ [ 0, 0, 2, 2, 6, 6, 7, 7, 18, 19, 22, 22, 33, 36, 37, 38, 42, 53, 54, 57 ], [ 0, 1, 3, 4, 8, 18, 19, 22, 33, 33, 36, 37, 48, 48, 49, 49, 53, 53, 54, 54 ] ], [ [ 0, 1, 1, 2, 2, 6, 6, 7, 7, 18, 19, 22, 22, 33, 36, 37, 38, 42, 53, 54, 57 ], [ 0, 1, 2, 3, 4, 8, 18, 19, 22, 33, 33, 36, 37, 48, 48, 49, 49, 53, 53, 54, 54 ] ], [ [ 0, 0, 1, 1, 5, 5, 7, 7, 18, 19, 22, 22, 33, 36, 37, 38, 42, 53, 54, 57 ], [ 0, 3, 4, 14, 18, 19, 21, 22, 33, 33, 36, 37, 48, 48, 49, 49, 53, 53, 54, 54 ] ], [ [ 0, 0, 1, 1, 5, 5, 6, 6, 18, 18, 21, 22, 36, 37, 38, 41, 42, 53, 54, 57 ], [ 0, 3, 4, 14, 18, 19, 20, 21, 33, 34, 37, 37, 51, 51, 52, 52, 53, 53, 54, 54 ] ], [ [ 0, 0, 2, 2, 6, 6, 7, 7, 18, 18, 21, 22, 36, 37, 38, 41, 42, 53, 54, 57 ], [ 0, 1, 3, 4, 8, 18, 19, 22, 33, 34, 37, 37, 51, 51, 52, 52, 53, 53, 54, 54 ] ], [ [ 0, 1, 1, 2, 2, 6, 6, 7, 7, 18, 18, 21, 22, 36, 37, 38, 41, 42, 53, 54, 57 ], [ 0, 1, 2, 3, 4, 8, 18, 19, 22, 33, 34, 37, 37, 51, 51, 52, 52, 53, 53, 54, 54 ] ], [ [ 0, 0, 1, 1, 5, 5, 7, 7, 18, 18, 21, 22, 36, 37, 38, 41, 42, 53, 54, 57 ], [ 0, 3, 4, 14, 18, 19, 21, 22, 33, 34, 37, 37, 51, 51, 52, 52, 53, 53, 54, 54 ] ], [ [ 0, 0, 1, 1, 5, 5, 6, 6, 18, 19, 22, 22, 36, 37, 38, 41, 42, 53, 54, 57 ], [ 0, 3, 4, 14, 18, 19, 20, 21, 33, 33, 36, 37, 51, 51, 52, 52, 53, 53, 54, 54 ] ], [ [ 0, 0, 2, 2, 6, 6, 7, 7, 18, 19, 22, 22, 36, 37, 38, 41, 42, 53, 54, 57 ], [ 0, 1, 3, 4, 8, 18, 19, 22, 33, 33, 36, 37, 51, 51, 52, 52, 53, 53, 54, 54 ] ], [ [ 0, 1, 1, 2, 2, 6, 6, 7, 7, 18, 19, 22, 22, 36, 37, 38, 41, 42, 53, 54, 57 ], [ 0, 1, 2, 3, 4, 8, 18, 19, 22, 33, 33, 36, 37, 51, 51, 52, 52, 53, 53, 54, 54 ] ], [ [ 0, 0, 1, 1, 5, 5, 7, 7, 18, 19, 22, 22, 36, 37, 38, 41, 42, 53, 54, 57 ], [ 0, 3, 4, 14, 18, 19, 21, 22, 33, 33, 36, 37, 51, 51, 52, 52, 53, 53, 54, 54 ] ], [ [ 0, 0, 1, 1, 5, 5, 6, 6, 18, 18, 21, 22, 36, 37, 38, 42, 43, 53, 54, 57 ], [ 0, 3, 4, 14, 18, 19, 20, 21, 33, 34, 37, 37, 51, 51, 52, 52, 53, 53, 54, 54 ] ], [ [ 0, 0, 2, 2, 6, 6, 7, 7, 18, 18, 21, 22, 36, 37, 38, 42, 43, 53, 54, 57 ], [ 0, 1, 3, 4, 8, 18, 19, 22, 33, 34, 37, 37, 51, 51, 52, 52, 53, 53, 54, 54 ] ], [ [ 0, 1, 1, 2, 2, 6, 6, 7, 7, 18, 18, 21, 22, 36, 37, 38, 42, 43, 53, 54, 57 ], [ 0, 1, 2, 3, 4, 8, 18, 19, 22, 33, 34, 37, 37, 51, 51, 52, 52, 53, 53, 54, 54 ] ], [ [ 0, 0, 1, 1, 5, 5, 7, 7, 18, 18, 21, 22, 36, 37, 38, 42, 43, 53, 54, 57 ], [ 0, 3, 4, 14, 18, 19, 21, 22, 33, 34, 37, 37, 51, 51, 52, 52, 53, 53, 54, 54 ] ], [ [ 0, 0, 1, 1, 5, 5, 6, 6, 18, 19, 22, 22, 36, 37, 38, 42, 43, 53, 54, 57 ], [ 0, 3, 4, 14, 18, 19, 20, 21, 33, 33, 36, 37, 51, 51, 52, 52, 53, 53, 54, 54 ] ], [ [ 0, 0, 2, 2, 6, 6, 7, 7, 18, 19, 22, 22, 36, 37, 38, 42, 43, 53, 54, 57 ], [ 0, 1, 3, 4, 8, 18, 19, 22, 33, 33, 36, 37, 51, 51, 52, 52, 53, 53, 54, 54 ] ], [ [ 0, 1, 1, 2, 2, 6, 6, 7, 7, 18, 19, 22, 22, 36, 37, 38, 42, 43, 53, 54, 57 ], [ 0, 1, 2, 3, 4, 8, 18, 19, 22, 33, 33, 36, 37, 51, 51, 52, 52, 53, 53, 54, 54 ] ], [ [ 0, 0, 1, 1, 5, 5, 7, 7, 18, 19, 22, 22, 36, 37, 38, 42, 43, 53, 54, 57 ], [ 0, 3, 4, 14, 18, 19, 21, 22, 33, 33, 36, 37, 51, 51, 52, 52, 53, 53, 54, 54 ] ], [ [ 0, 0, 1, 1, 5, 5, 6, 6, 18, 18, 21, 22, 36, 37, 38, 43, 44, 53, 54, 57 ], [ 0, 3, 4, 14, 18, 19, 20, 21, 33, 34, 37, 37, 51, 51, 52, 52, 53, 53, 54, 54 ] ], [ [ 0, 0, 2, 2, 6, 6, 7, 7, 18, 18, 21, 22, 36, 37, 38, 43, 44, 53, 54, 57 ], [ 0, 1, 3, 4, 8, 18, 19, 22, 33, 34, 37, 37, 51, 51, 52, 52, 53, 53, 54, 54 ] ], [ [ 0, 1, 1, 2, 2, 6, 6, 7, 7, 18, 18, 21, 22, 36, 37, 38, 43, 44, 53, 54, 57 ], [ 0, 1, 2, 3, 4, 8, 18, 19, 22, 33, 34, 37, 37, 51, 51, 52, 52, 53, 53, 54, 54 ] ], [ [ 0, 0, 1, 1, 5, 5, 7, 7, 18, 18, 21, 22, 36, 37, 38, 43, 44, 53, 54, 57 ], [ 0, 3, 4, 14, 18, 19, 21, 22, 33, 34, 37, 37, 51, 51, 52, 52, 53, 53, 54, 54 ] ], [ [ 0, 0, 1, 1, 5, 5, 6, 6, 18, 19, 22, 22, 36, 37, 38, 43, 44, 53, 54, 57 ], [ 0, 3, 4, 14, 18, 19, 20, 21, 33, 33, 36, 37, 51, 51, 52, 52, 53, 53, 54, 54 ] ], [ [ 0, 0, 2, 2, 6, 6, 7, 7, 18, 19, 22, 22, 36, 37, 38, 43, 44, 53, 54, 57 ], [ 0, 1, 3, 4, 8, 18, 19, 22, 33, 33, 36, 37, 51, 51, 52, 52, 53, 53, 54, 54 ] ], [ [ 0, 1, 1, 2, 2, 6, 6, 7, 7, 18, 19, 22, 22, 36, 37, 38, 43, 44, 53, 54, 57 ], [ 0, 1, 2, 3, 4, 8, 18, 19, 22, 33, 33, 36, 37, 51, 51, 52, 52, 53, 53, 54, 54 ] ], [ [ 0, 0, 1, 1, 5, 5, 7, 7, 18, 19, 22, 22, 36, 37, 38, 43, 44, 53, 54, 57 ], [ 0, 3, 4, 14, 18, 19, 21, 22, 33, 33, 36, 37, 51, 51, 52, 52, 53, 53, 54, 54 ] ], [ [ 0, 0, 1, 1, 5, 5, 6, 6, 18, 18, 21, 22, 36, 37, 38, 44, 45, 53, 54, 57 ], [ 0, 3, 4, 14, 18, 19, 20, 21, 33, 34, 37, 37, 51, 51, 52, 52, 53, 53, 54, 54 ] ], [ [ 0, 0, 2, 2, 6, 6, 7, 7, 18, 18, 21, 22, 36, 37, 38, 44, 45, 53, 54, 57 ], [ 0, 1, 3, 4, 8, 18, 19, 22, 33, 34, 37, 37, 51, 51, 52, 52, 53, 53, 54, 54 ] ], [ [ 0, 1, 1, 2, 2, 6, 6, 7, 7, 18, 18, 21, 22, 36, 37, 38, 44, 45, 53, 54, 57 ], [ 0, 1, 2, 3, 4, 8, 18, 19, 22, 33, 34, 37, 37, 51, 51, 52, 52, 53, 53, 54, 54 ] ], [ [ 0, 0, 1, 1, 5, 5, 7, 7, 18, 18, 21, 22, 36, 37, 38, 44, 45, 53, 54, 57 ], [ 0, 3, 4, 14, 18, 19, 21, 22, 33, 34, 37, 37, 51, 51, 52, 52, 53, 53, 54, 54 ] ], [ [ 0, 0, 1, 1, 5, 5, 6, 6, 18, 19, 22, 22, 36, 37, 38, 44, 45, 53, 54, 57 ], [ 0, 3, 4, 14, 18, 19, 20, 21, 33, 33, 36, 37, 51, 51, 52, 52, 53, 53, 54, 54 ] ], [ [ 0, 0, 2, 2, 6, 6, 7, 7, 18, 19, 22, 22, 36, 37, 38, 44, 45, 53, 54, 57 ], [ 0, 1, 3, 4, 8, 18, 19, 22, 33, 33, 36, 37, 51, 51, 52, 52, 53, 53, 54, 54 ] ], [ [ 0, 1, 1, 2, 2, 6, 6, 7, 7, 18, 19, 22, 22, 36, 37, 38, 44, 45, 53, 54, 57 ], [ 0, 1, 2, 3, 4, 8, 18, 19, 22, 33, 33, 36, 37, 51, 51, 52, 52, 53, 53, 54, 54 ] ], [ [ 0, 0, 1, 1, 5, 5, 7, 7, 18, 19, 22, 22, 36, 37, 38, 44, 45, 53, 54, 57 ], [ 0, 3, 4, 14, 18, 19, 21, 22, 33, 33, 36, 37, 51, 51, 52, 52, 53, 53, 54, 54 ] ], [ [ 0, 0, 1, 1, 5, 5, 6, 6, 18, 18, 21, 22, 36, 37, 38, 45, 46, 53, 54, 57 ], [ 0, 3, 4, 14, 18, 19, 20, 21, 33, 34, 37, 37, 51, 51, 52, 52, 53, 53, 54, 54 ] ], [ [ 0, 0, 2, 2, 6, 6, 7, 7, 18, 18, 21, 22, 36, 37, 38, 45, 46, 53, 54, 57 ], [ 0, 1, 3, 4, 8, 18, 19, 22, 33, 34, 37, 37, 51, 51, 52, 52, 53, 53, 54, 54 ] ], [ [ 0, 1, 1, 2, 2, 6, 6, 7, 7, 18, 18, 21, 22, 36, 37, 38, 45, 46, 53, 54, 57 ], [ 0, 1, 2, 3, 4, 8, 18, 19, 22, 33, 34, 37, 37, 51, 51, 52, 52, 53, 53, 54, 54 ] ], [ [ 0, 0, 1, 1, 5, 5, 7, 7, 18, 18, 21, 22, 36, 37, 38, 45, 46, 53, 54, 57 ], [ 0, 3, 4, 14, 18, 19, 21, 22, 33, 34, 37, 37, 51, 51, 52, 52, 53, 53, 54, 54 ] ], [ [ 0, 0, 1, 1, 5, 5, 6, 6, 18, 19, 22, 22, 36, 37, 38, 45, 46, 53, 54, 57 ], [ 0, 3, 4, 14, 18, 19, 20, 21, 33, 33, 36, 37, 51, 51, 52, 52, 53, 53, 54, 54 ] ], [ [ 0, 0, 2, 2, 6, 6, 7, 7, 18, 19, 22, 22, 36, 37, 38, 45, 46, 53, 54, 57 ], [ 0, 1, 3, 4, 8, 18, 19, 22, 33, 33, 36, 37, 51, 51, 52, 52, 53, 53, 54, 54 ] ], [ [ 0, 1, 1, 2, 2, 6, 6, 7, 7, 18, 19, 22, 22, 36, 37, 38, 45, 46, 53, 54, 57 ], [ 0, 1, 2, 3, 4, 8, 18, 19, 22, 33, 33, 36, 37, 51, 51, 52, 52, 53, 53, 54, 54 ] ], [ [ 0, 0, 1, 1, 5, 5, 7, 7, 18, 19, 22, 22, 36, 37, 38, 45, 46, 53, 54, 57 ], [ 0, 3, 4, 14, 18, 19, 21, 22, 33, 33, 36, 37, 51, 51, 52, 52, 53, 53, 54, 54 ] ], [ [ 0, 0, 1, 1, 5, 5, 6, 6, 18, 18, 21, 22, 36, 37, 38, 46, 47, 53, 54, 57 ], [ 0, 3, 4, 14, 18, 19, 20, 21, 33, 34, 37, 37, 51, 51, 52, 52, 53, 53, 54, 54 ] ], [ [ 0, 0, 2, 2, 6, 6, 7, 7, 18, 18, 21, 22, 36, 37, 38, 46, 47, 53, 54, 57 ], [ 0, 1, 3, 4, 8, 18, 19, 22, 33, 34, 37, 37, 51, 51, 52, 52, 53, 53, 54, 54 ] ], [ [ 0, 1, 1, 2, 2, 6, 6, 7, 7, 18, 18, 21, 22, 36, 37, 38, 46, 47, 53, 54, 57 ], [ 0, 1, 2, 3, 4, 8, 18, 19, 22, 33, 34, 37, 37, 51, 51, 52, 52, 53, 53, 54, 54 ] ], [ [ 0, 0, 1, 1, 5, 5, 7, 7, 18, 18, 21, 22, 36, 37, 38, 46, 47, 53, 54, 57 ], [ 0, 3, 4, 14, 18, 19, 21, 22, 33, 34, 37, 37, 51, 51, 52, 52, 53, 53, 54, 54 ] ], [ [ 0, 0, 1, 1, 5, 5, 6, 6, 18, 19, 22, 22, 36, 37, 38, 46, 47, 53, 54, 57 ], [ 0, 3, 4, 14, 18, 19, 20, 21, 33, 33, 36, 37, 51, 51, 52, 52, 53, 53, 54, 54 ] ], [ [ 0, 0, 2, 2, 6, 6, 7, 7, 18, 19, 22, 22, 36, 37, 38, 46, 47, 53, 54, 57 ], [ 0, 1, 3, 4, 8, 18, 19, 22, 33, 33, 36, 37, 51, 51, 52, 52, 53, 53, 54, 54 ] ], [ [ 0, 1, 1, 2, 2, 6, 6, 7, 7, 18, 19, 22, 22, 36, 37, 38, 46, 47, 53, 54, 57 ], [ 0, 1, 2, 3, 4, 8, 18, 19, 22, 33, 33, 36, 37, 51, 51, 52, 52, 53, 53, 54, 54 ] ], [ [ 0, 0, 1, 1, 5, 5, 7, 7, 18, 19, 22, 22, 36, 37, 38, 46, 47, 53, 54, 57 ], [ 0, 3, 4, 14, 18, 19, 21, 22, 33, 33, 36, 37, 51, 51, 52, 52, 53, 53, 54, 54 ] ], [ [ 0, 0, 1, 1, 5, 5, 6, 6, 18, 18, 21, 22, 36, 37, 38, 47, 48, 53, 54, 57 ], [ 0, 3, 4, 14, 18, 19, 20, 21, 33, 34, 37, 37, 51, 51, 52, 52, 53, 53, 54, 54 ] ], [ [ 0, 0, 2, 2, 6, 6, 7, 7, 18, 18, 21, 22, 36, 37, 38, 47, 48, 53, 54, 57 ], [ 0, 1, 3, 4, 8, 18, 19, 22, 33, 34, 37, 37, 51, 51, 52, 52, 53, 53, 54, 54 ] ], [ [ 0, 1, 1, 2, 2, 6, 6, 7, 7, 18, 18, 21, 22, 36, 37, 38, 47, 48, 53, 54, 57 ], [ 0, 1, 2, 3, 4, 8, 18, 19, 22, 33, 34, 37, 37, 51, 51, 52, 52, 53, 53, 54, 54 ] ], [ [ 0, 0, 1, 1, 5, 5, 7, 7, 18, 18, 21, 22, 36, 37, 38, 47, 48, 53, 54, 57 ], [ 0, 3, 4, 14, 18, 19, 21, 22, 33, 34, 37, 37, 51, 51, 52, 52, 53, 53, 54, 54 ] ], [ [ 0, 0, 1, 1, 5, 5, 6, 6, 18, 19, 22, 22, 36, 37, 38, 47, 48, 53, 54, 57 ], [ 0, 3, 4, 14, 18, 19, 20, 21, 33, 33, 36, 37, 51, 51, 52, 52, 53, 53, 54, 54 ] ], [ [ 0, 0, 2, 2, 6, 6, 7, 7, 18, 19, 22, 22, 36, 37, 38, 47, 48, 53, 54, 57 ], [ 0, 1, 3, 4, 8, 18, 19, 22, 33, 33, 36, 37, 51, 51, 52, 52, 53, 53, 54, 54 ] ], [ [ 0, 1, 1, 2, 2, 6, 6, 7, 7, 18, 19, 22, 22, 36, 37, 38, 47, 48, 53, 54, 57 ], [ 0, 1, 2, 3, 4, 8, 18, 19, 22, 33, 33, 36, 37, 51, 51, 52, 52, 53, 53, 54, 54 ] ], [ [ 0, 0, 1, 1, 5, 5, 7, 7, 18, 19, 22, 22, 36, 37, 38, 47, 48, 53, 54, 57 ], [ 0, 3, 4, 14, 18, 19, 21, 22, 33, 33, 36, 37, 51, 51, 52, 52, 53, 53, 54, 54 ] ], [ [ 0, 0, 1, 1, 5, 5, 6, 6, 18, 18, 21, 22, 36, 37, 38, 48, 49, 53, 54, 57 ], [ 0, 3, 4, 14, 18, 19, 20, 21, 33, 34, 37, 37, 51, 51, 52, 52, 53, 53, 54, 54 ] ], [ [ 0, 0, 2, 2, 6, 6, 7, 7, 18, 18, 21, 22, 36, 37, 38, 48, 49, 53, 54, 57 ], [ 0, 1, 3, 4, 8, 18, 19, 22, 33, 34, 37, 37, 51, 51, 52, 52, 53, 53, 54, 54 ] ], [ [ 0, 1, 1, 2, 2, 6, 6, 7, 7, 18, 18, 21, 22, 36, 37, 38, 48, 49, 53, 54, 57 ], [ 0, 1, 2, 3, 4, 8, 18, 19, 22, 33, 34, 37, 37, 51, 51, 52, 52, 53, 53, 54, 54 ] ], [ [ 0, 0, 1, 1, 5, 5, 7, 7, 18, 18, 21, 22, 36, 37, 38, 48, 49, 53, 54, 57 ], [ 0, 3, 4, 14, 18, 19, 21, 22, 33, 34, 37, 37, 51, 51, 52, 52, 53, 53, 54, 54 ] ], [ [ 0, 0, 1, 1, 5, 5, 6, 6, 18, 19, 22, 22, 36, 37, 38, 48, 49, 53, 54, 57 ], [ 0, 3, 4, 14, 18, 19, 20, 21, 33, 33, 36, 37, 51, 51, 52, 52, 53, 53, 54, 54 ] ], [ [ 0, 0, 2, 2, 6, 6, 7, 7, 18, 19, 22, 22, 36, 37, 38, 48, 49, 53, 54, 57 ], [ 0, 1, 3, 4, 8, 18, 19, 22, 33, 33, 36, 37, 51, 51, 52, 52, 53, 53, 54, 54 ] ], [ [ 0, 1, 1, 2, 2, 6, 6, 7, 7, 18, 19, 22, 22, 36, 37, 38, 48, 49, 53, 54, 57 ], [ 0, 1, 2, 3, 4, 8, 18, 19, 22, 33, 33, 36, 37, 51, 51, 52, 52, 53, 53, 54, 54 ] ], [ [ 0, 0, 1, 1, 5, 5, 7, 7, 18, 19, 22, 22, 36, 37, 38, 48, 49, 53, 54, 57 ], [ 0, 3, 4, 14, 18, 19, 21, 22, 33, 33, 36, 37, 51, 51, 52, 52, 53, 53, 54, 54 ] ], [ [ 0, 0, 1, 1, 5, 5, 6, 6, 18, 18, 21, 22, 36, 37, 38, 49, 50, 53, 54, 57 ], [ 0, 3, 4, 14, 18, 19, 20, 21, 33, 34, 37, 37, 51, 51, 52, 52, 53, 53, 54, 54 ] ], [ [ 0, 0, 2, 2, 6, 6, 7, 7, 18, 18, 21, 22, 36, 37, 38, 49, 50, 53, 54, 57 ], [ 0, 1, 3, 4, 8, 18, 19, 22, 33, 34, 37, 37, 51, 51, 52, 52, 53, 53, 54, 54 ] ], [ [ 0, 1, 1, 2, 2, 6, 6, 7, 7, 18, 18, 21, 22, 36, 37, 38, 49, 50, 53, 54, 57 ], [ 0, 1, 2, 3, 4, 8, 18, 19, 22, 33, 34, 37, 37, 51, 51, 52, 52, 53, 53, 54, 54 ] ], [ [ 0, 0, 1, 1, 5, 5, 7, 7, 18, 18, 21, 22, 36, 37, 38, 49, 50, 53, 54, 57 ], [ 0, 3, 4, 14, 18, 19, 21, 22, 33, 34, 37, 37, 51, 51, 52, 52, 53, 53, 54, 54 ] ], [ [ 0, 0, 1, 1, 5, 5, 6, 6, 18, 19, 22, 22, 36, 37, 38, 49, 50, 53, 54, 57 ], [ 0, 3, 4, 14, 18, 19, 20, 21, 33, 33, 36, 37, 51, 51, 52, 52, 53, 53, 54, 54 ] ], [ [ 0, 0, 2, 2, 6, 6, 7, 7, 18, 19, 22, 22, 36, 37, 38, 49, 50, 53, 54, 57 ], [ 0, 1, 3, 4, 8, 18, 19, 22, 33, 33, 36, 37, 51, 51, 52, 52, 53, 53, 54, 54 ] ], [ [ 0, 1, 1, 2, 2, 6, 6, 7, 7, 18, 19, 22, 22, 36, 37, 38, 49, 50, 53, 54, 57 ], [ 0, 1, 2, 3, 4, 8, 18, 19, 22, 33, 33, 36, 37, 51, 51, 52, 52, 53, 53, 54, 54 ] ], [ [ 0, 0, 1, 1, 5, 5, 7, 7, 18, 19, 22, 22, 36, 37, 38, 49, 50, 53, 54, 57 ], [ 0, 3, 4, 14, 18, 19, 21, 22, 33, 33, 36, 37, 51, 51, 52, 52, 53, 53, 54, 54 ] ], [ [ 0, 0, 1, 1, 5, 5, 6, 6, 18, 18, 21, 22, 36, 37, 38, 50, 51, 53, 54, 57 ], [ 0, 3, 4, 14, 18, 19, 20, 21, 33, 34, 37, 37, 51, 51, 52, 52, 53, 53, 54, 54 ] ], [ [ 0, 0, 2, 2, 6, 6, 7, 7, 18, 18, 21, 22, 36, 37, 38, 50, 51, 53, 54, 57 ], [ 0, 1, 3, 4, 8, 18, 19, 22, 33, 34, 37, 37, 51, 51, 52, 52, 53, 53, 54, 54 ] ], [ [ 0, 1, 1, 2, 2, 6, 6, 7, 7, 18, 18, 21, 22, 36, 37, 38, 50, 51, 53, 54, 57 ], [ 0, 1, 2, 3, 4, 8, 18, 19, 22, 33, 34, 37, 37, 51, 51, 52, 52, 53, 53, 54, 54 ] ], [ [ 0, 0, 1, 1, 5, 5, 7, 7, 18, 18, 21, 22, 36, 37, 38, 50, 51, 53, 54, 57 ], [ 0, 3, 4, 14, 18, 19, 21, 22, 33, 34, 37, 37, 51, 51, 52, 52, 53, 53, 54, 54 ] ], [ [ 0, 0, 1, 1, 5, 5, 6, 6, 18, 19, 22, 22, 36, 37, 38, 50, 51, 53, 54, 57 ], [ 0, 3, 4, 14, 18, 19, 20, 21, 33, 33, 36, 37, 51, 51, 52, 52, 53, 53, 54, 54 ] ], [ [ 0, 0, 2, 2, 6, 6, 7, 7, 18, 19, 22, 22, 36, 37, 38, 50, 51, 53, 54, 57 ], [ 0, 1, 3, 4, 8, 18, 19, 22, 33, 33, 36, 37, 51, 51, 52, 52, 53, 53, 54, 54 ] ], [ [ 0, 1, 1, 2, 2, 6, 6, 7, 7, 18, 19, 22, 22, 36, 37, 38, 50, 51, 53, 54, 57 ], [ 0, 1, 2, 3, 4, 8, 18, 19, 22, 33, 33, 36, 37, 51, 51, 52, 52, 53, 53, 54, 54 ] ], [ [ 0, 0, 1, 1, 5, 5, 7, 7, 18, 19, 22, 22, 36, 37, 38, 50, 51, 53, 54, 57 ], [ 0, 3, 4, 14, 18, 19, 21, 22, 33, 33, 36, 37, 51, 51, 52, 52, 53, 53, 54, 54 ] ] ], "tuples": [ [ 34, 0, 73, 4, 35, 10, 51, 54 ], [ 34, 0, 73, 4, 35, 10, 53, 54 ], [ 34, 0, 73, 4, 35, 10, 54, 54 ] ], "tupleFields": [ "identical", "ambiguousColumns", "columns", "mismatches", "gapColumns", "gapOpens", "readAligned", "referenceCovered" ], "variation": { "readAligned": { "shared": false, "min": 51, "max": 54 }, "referenceCovered": { "shared": true, "min": 54, "max": 54 }, "identity": { "shared": true, "min": { "numerator": 34, "denominator": 73 }, "max": { "numerator": 34, "denominator": 73 } }, "overhangStart": { "shared": true, "min": 0, "max": 0 }, "overhangEnd": { "shared": true, "min": 0, "max": 0 } }, "placements": [ { "refStart": 1, "refEnd": 54, "crossesOrigin": false, "wholeCircle": false, "readStart": 1, "readEnd": 54, "asSupplied": { "readStart": 1, "readEnd": 54 }, "alignments": 96, "band": { "diagonalMin": -16, "diagonalMax": 3, "cellsNeeded": 1056, "bandLimited": false } } ] } }, { "mode": "semiglobal-read", "region": null, "strand": "+", "strandUndetermined": false, "plus": { "score": 93, "count": 1331, "overCap": true, "state": "aligned", "biopython": { "score": 93, "count": 1331 }, "uniquePairs": [ [ 1, 1 ], [ 2, 2 ], [ 3, 3 ], [ 4, 4 ], [ 5, 5 ], [ 6, 6 ], [ 18, 17 ], [ 19, 18 ], [ 20, 19 ], [ 21, 20 ], [ 22, 21 ], [ 23, 22 ], [ 35, 33 ], [ 36, 34 ], [ 37, 35 ], [ 38, 36 ], [ 39, 37 ], [ 40, 38 ], [ 52, 49 ], [ 53, 50 ], [ 54, 51 ], [ 55, 52 ], [ 56, 53 ], [ 57, 54 ] ], "uniquePlacement": true, "placementNotDetermined": false, "noCommonColumn": false, "hull": { "refStart": 1, "refEnd": 57, "crossesOrigin": false, "wholeCircle": false }, "selected": { "coordinates": [ [ 0, 6, 7, 23, 24, 40, 41, 57 ], [ 0, 6, 6, 22, 22, 38, 38, 54 ] ], "gappedReference": "GCATGCAAAAAAAAAAAGTCAGCTTTTTTTTTTTCAGTCAGGGGGGGGGGGATCGAT", "gappedRead": "GCATGC-AAAAAAAAAAGTCAGC-TTTTTTTTTTCAGTCA-GGGGGGGGGGATCGAT", "columns": 57, "identical": 54, "mismatches": 0, "ambiguousColumns": 0, "gapColumns": 3, "gapOpens": 3, "identity": { "numerator": 54, "denominator": 57 }, "readAligned": { "bases": 54, "of": 54 }, "referenceCovered": { "bases": 57, "of": 57 }, "placement": { "refStart": 1, "refEnd": 57, "readStart": 1, "readEnd": 54, "crossesOrigin": false }, "overhang": [], "differences": [ { "kind": "deletion", "refStart": 7, "refEnd": 7, "length": 1, "bases": "A", "readAfter": 6, "common": false, "notFixed": { "from": { "ref": 6, "read": 6 }, "to": { "ref": 18, "read": 17 } } }, { "kind": "deletion", "refStart": 24, "refEnd": 24, "length": 1, "bases": "T", "readAfter": 22, "common": false, "notFixed": { "from": { "ref": 23, "read": 22 }, "to": { "ref": 35, "read": 33 } } }, { "kind": "deletion", "refStart": 41, "refEnd": 41, "length": 1, "bases": "G", "readAfter": 38, "common": false, "notFixed": { "from": { "ref": 40, "read": 38 }, "to": { "ref": 52, "read": 49 } } } ] }, "band": { "diagonalMin": 0, "diagonalMax": 3, "cellsNeeded": 328, "unionBandLimited": false, "scope": "every optimal path", "gridCells": 3190, "searchedBanded": false, "sharedWords": 40, "sharedWordsOverCap": false, "seedGuarantee": { "differencesUpTo": 7, "guaranteed": false } }, "enumeration": "checked", "tuples": [ [ 54, 0, 57, 0, 3, 3, 54, 57 ] ], "tupleFields": [ "identical", "ambiguousColumns", "columns", "mismatches", "gapColumns", "gapOpens", "readAligned", "referenceCovered" ], "variation": { "readAligned": { "shared": true, "min": 54, "max": 54 }, "referenceCovered": { "shared": true, "min": 57, "max": 57 }, "identity": { "shared": true, "min": { "numerator": 18, "denominator": 19 }, "max": { "numerator": 18, "denominator": 19 } }, "overhangStart": { "shared": true, "min": 0, "max": 0 }, "overhangEnd": { "shared": true, "min": 0, "max": 0 } }, "placements": [ { "refStart": 1, "refEnd": 57, "crossesOrigin": false, "wholeCircle": false, "readStart": 1, "readEnd": 54, "alignments": 1331, "band": { "diagonalMin": 0, "diagonalMax": 3, "cellsNeeded": 328, "bandLimited": false } } ] }, "minus": { "score": -4, "count": 20, "overCap": false, "state": "aligned", "biopython": { "score": -4, "count": 20 }, "uniquePairs": [ [ 3, 1 ], [ 4, 2 ], [ 5, 4 ], [ 7, 19 ], [ 8, 23 ], [ 9, 24 ], [ 10, 25 ], [ 11, 26 ], [ 12, 27 ], [ 13, 28 ], [ 14, 29 ], [ 15, 30 ], [ 16, 31 ], [ 17, 32 ], [ 18, 33 ], [ 23, 38 ], [ 24, 39 ], [ 25, 40 ], [ 26, 41 ], [ 27, 42 ], [ 28, 43 ], [ 29, 44 ], [ 30, 45 ], [ 31, 46 ], [ 32, 47 ], [ 33, 48 ], [ 34, 49 ], [ 35, 50 ], [ 36, 51 ], [ 37, 52 ], [ 38, 53 ], [ 39, 54 ] ], "uniquePlacement": true, "placementNotDetermined": false, "noCommonColumn": false, "hull": { "refStart": 3, "refEnd": 39, "crossesOrigin": false, "wholeCircle": false }, "selected": { "coordinates": [ [ 0, 2, 4, 4, 5, 5, 6, 6, 7, 7, 18, 18, 21, 22, 39, 57 ], [ 0, 0, 2, 3, 4, 6, 7, 18, 19, 22, 33, 34, 37, 37, 54, 54 ] ], "gappedReference": "AT-G--C-----------A---AAAAAAAAAAG-TCAGCTTTTTTTTTTTCAGTC", "gappedRead": "ATCGATCCCCCCCCCCTGACTGAAAAAAAAAAGCTGA-CTTTTTTTTTTGCATGC", "columns": 55, "identical": 32, "mismatches": 4, "ambiguousColumns": 0, "gapColumns": 19, "gapOpens": 6, "identity": { "numerator": 32, "denominator": 55 }, "readAligned": { "bases": 54, "of": 54 }, "referenceCovered": { "bases": 37, "of": 57 }, "placement": { "refStart": 3, "refEnd": 39, "readStart": 1, "readEnd": 54, "crossesOrigin": false, "asSupplied": { "readStart": 1, "readEnd": 54 } }, "overhang": [], "differences": [ { "kind": "insertion", "refAfter": 4, "length": 1, "bases": "C", "readStart": 3, "readEnd": 3, "asSupplied": { "readStart": 52, "readEnd": 52, "bases": "G" }, "common": true }, { "kind": "insertion", "refAfter": 5, "length": 2, "bases": "AT", "readStart": 5, "readEnd": 6, "asSupplied": { "readStart": 49, "readEnd": 50, "bases": "AT" }, "common": false, "notFixed": { "from": { "ref": 5, "read": 4, "readAsSupplied": 51 }, "to": { "ref": 7, "read": 19, "readAsSupplied": 36 } } }, { "kind": "insertion", "refAfter": 6, "length": 11, "bases": "CCCCCCCCCTG", "readStart": 8, "readEnd": 18, "asSupplied": { "readStart": 37, "readEnd": 47, "bases": "CAGGGGGGGGG" }, "common": false, "notFixed": { "from": { "ref": 5, "read": 4, "readAsSupplied": 51 }, "to": { "ref": 7, "read": 19, "readAsSupplied": 36 } } }, { "kind": "insertion", "refAfter": 7, "length": 3, "bases": "CTG", "readStart": 20, "readEnd": 22, "asSupplied": { "readStart": 33, "readEnd": 35, "bases": "CAG" }, "common": true }, { "kind": "insertion", "refAfter": 18, "length": 1, "bases": "C", "readStart": 34, "readEnd": 34, "asSupplied": { "readStart": 21, "readEnd": 21, "bases": "G" }, "common": false, "notFixed": { "from": { "ref": 18, "read": 33, "readAsSupplied": 22 }, "to": { "ref": 23, "read": 38, "readAsSupplied": 17 } } }, { "kind": "substitution", "ref": 20, "refBase": "C", "readBase": "G", "read": 36, "common": false, "notFixed": { "from": { "ref": 18, "read": 33, "readAsSupplied": 22 }, "to": { "ref": 23, "read": 38, "readAsSupplied": 17 } }, "asSupplied": { "read": 19, "readBase": "C" } }, { "kind": "deletion", "refStart": 22, "refEnd": 22, "length": 1, "bases": "G", "readAfter": 37, "asSupplied": { "readBetween": [ 17, 18 ] }, "common": false, "notFixed": { "from": { "ref": 18, "read": 33, "readAsSupplied": 22 }, "to": { "ref": 23, "read": 38, "readAsSupplied": 17 } } }, { "kind": "substitution", "ref": 34, "refBase": "T", "readBase": "G", "read": 49, "common": true, "asSupplied": { "read": 6, "readBase": "C" } }, { "kind": "substitution", "ref": 37, "refBase": "G", "readBase": "T", "read": 52, "common": true, "asSupplied": { "read": 3, "readBase": "A" } }, { "kind": "substitution", "ref": 38, "refBase": "T", "readBase": "G", "read": 53, "common": true, "asSupplied": { "read": 2, "readBase": "C" } } ] }, "band": { "diagonalMin": -16, "diagonalMax": 2, "cellsNeeded": 1002, "unionBandLimited": false, "scope": "every optimal path", "gridCells": 3190, "searchedBanded": false, "sharedWords": 0, "sharedWordsOverCap": false, "seedGuarantee": { "differencesUpTo": 56, "guaranteed": false } }, "enumeration": "listed", "alignments": [ [ [ 0, 2, 4, 4, 5, 5, 6, 6, 7, 7, 18, 18, 21, 22, 39, 57 ], [ 0, 0, 2, 3, 4, 6, 7, 18, 19, 22, 33, 34, 37, 37, 54, 54 ] ], [ [ 0, 2, 4, 4, 5, 5, 6, 6, 7, 7, 18, 18, 21, 22, 39, 57 ], [ 0, 0, 2, 3, 4, 7, 8, 18, 19, 22, 33, 34, 37, 37, 54, 54 ] ], [ [ 0, 2, 4, 4, 5, 5, 6, 6, 7, 7, 18, 18, 21, 22, 39, 57 ], [ 0, 0, 2, 3, 4, 8, 9, 18, 19, 22, 33, 34, 37, 37, 54, 54 ] ], [ [ 0, 2, 4, 4, 5, 5, 6, 6, 7, 7, 18, 18, 21, 22, 39, 57 ], [ 0, 0, 2, 3, 4, 9, 10, 18, 19, 22, 33, 34, 37, 37, 54, 54 ] ], [ [ 0, 2, 4, 4, 5, 5, 6, 6, 7, 7, 18, 18, 21, 22, 39, 57 ], [ 0, 0, 2, 3, 4, 10, 11, 18, 19, 22, 33, 34, 37, 37, 54, 54 ] ], [ [ 0, 2, 4, 4, 5, 5, 6, 6, 7, 7, 18, 18, 21, 22, 39, 57 ], [ 0, 0, 2, 3, 4, 11, 12, 18, 19, 22, 33, 34, 37, 37, 54, 54 ] ], [ [ 0, 2, 4, 4, 5, 5, 6, 6, 7, 7, 18, 18, 21, 22, 39, 57 ], [ 0, 0, 2, 3, 4, 12, 13, 18, 19, 22, 33, 34, 37, 37, 54, 54 ] ], [ [ 0, 2, 4, 4, 5, 5, 6, 6, 7, 7, 18, 18, 21, 22, 39, 57 ], [ 0, 0, 2, 3, 4, 13, 14, 18, 19, 22, 33, 34, 37, 37, 54, 54 ] ], [ [ 0, 2, 4, 4, 5, 5, 6, 6, 7, 7, 18, 18, 21, 22, 39, 57 ], [ 0, 0, 2, 3, 4, 14, 15, 18, 19, 22, 33, 34, 37, 37, 54, 54 ] ], [ [ 0, 2, 4, 4, 5, 5, 6, 6, 7, 7, 18, 18, 21, 22, 39, 57 ], [ 0, 0, 2, 3, 4, 15, 16, 18, 19, 22, 33, 34, 37, 37, 54, 54 ] ], [ [ 0, 2, 4, 4, 5, 5, 6, 6, 7, 7, 18, 19, 22, 22, 39, 57 ], [ 0, 0, 2, 3, 4, 6, 7, 18, 19, 22, 33, 33, 36, 37, 54, 54 ] ], [ [ 0, 2, 4, 4, 5, 5, 6, 6, 7, 7, 18, 19, 22, 22, 39, 57 ], [ 0, 0, 2, 3, 4, 7, 8, 18, 19, 22, 33, 33, 36, 37, 54, 54 ] ], [ [ 0, 2, 4, 4, 5, 5, 6, 6, 7, 7, 18, 19, 22, 22, 39, 57 ], [ 0, 0, 2, 3, 4, 8, 9, 18, 19, 22, 33, 33, 36, 37, 54, 54 ] ], [ [ 0, 2, 4, 4, 5, 5, 6, 6, 7, 7, 18, 19, 22, 22, 39, 57 ], [ 0, 0, 2, 3, 4, 9, 10, 18, 19, 22, 33, 33, 36, 37, 54, 54 ] ], [ [ 0, 2, 4, 4, 5, 5, 6, 6, 7, 7, 18, 19, 22, 22, 39, 57 ], [ 0, 0, 2, 3, 4, 10, 11, 18, 19, 22, 33, 33, 36, 37, 54, 54 ] ], [ [ 0, 2, 4, 4, 5, 5, 6, 6, 7, 7, 18, 19, 22, 22, 39, 57 ], [ 0, 0, 2, 3, 4, 11, 12, 18, 19, 22, 33, 33, 36, 37, 54, 54 ] ], [ [ 0, 2, 4, 4, 5, 5, 6, 6, 7, 7, 18, 19, 22, 22, 39, 57 ], [ 0, 0, 2, 3, 4, 12, 13, 18, 19, 22, 33, 33, 36, 37, 54, 54 ] ], [ [ 0, 2, 4, 4, 5, 5, 6, 6, 7, 7, 18, 19, 22, 22, 39, 57 ], [ 0, 0, 2, 3, 4, 13, 14, 18, 19, 22, 33, 33, 36, 37, 54, 54 ] ], [ [ 0, 2, 4, 4, 5, 5, 6, 6, 7, 7, 18, 19, 22, 22, 39, 57 ], [ 0, 0, 2, 3, 4, 14, 15, 18, 19, 22, 33, 33, 36, 37, 54, 54 ] ], [ [ 0, 2, 4, 4, 5, 5, 6, 6, 7, 7, 18, 19, 22, 22, 39, 57 ], [ 0, 0, 2, 3, 4, 15, 16, 18, 19, 22, 33, 33, 36, 37, 54, 54 ] ] ], "tuples": [ [ 32, 0, 55, 4, 19, 6, 54, 37 ] ], "tupleFields": [ "identical", "ambiguousColumns", "columns", "mismatches", "gapColumns", "gapOpens", "readAligned", "referenceCovered" ], "variation": { "readAligned": { "shared": true, "min": 54, "max": 54 }, "referenceCovered": { "shared": true, "min": 37, "max": 37 }, "identity": { "shared": true, "min": { "numerator": 32, "denominator": 55 }, "max": { "numerator": 32, "denominator": 55 } }, "overhangStart": { "shared": true, "min": 0, "max": 0 }, "overhangEnd": { "shared": true, "min": 0, "max": 0 } }, "placements": [ { "refStart": 3, "refEnd": 39, "crossesOrigin": false, "wholeCircle": false, "readStart": 1, "readEnd": 54, "asSupplied": { "readStart": 1, "readEnd": 54 }, "alignments": 20, "band": { "diagonalMin": -16, "diagonalMax": 2, "cellsNeeded": 1002, "bandLimited": false } } ] } } ] } }, { "id": "tie-order-gap-in-read", "note": "Global: in a gap in the read, extending the gap and opening it from a pair tie; the tie order extends first (found by a search over short random pairs with the script's own programme).", "input": { "reference": { "residues": "GGTAATTT", "topology": "linear" }, "read": { "residues": "TGAC" }, "modes": [ "global" ] }, "expected": { "results": [ { "mode": "global", "region": null, "strand": "-", "strandUndetermined": false, "plus": { "score": -16, "count": 6, "overCap": false, "state": "aligned", "biopython": { "score": -16, "count": 6 }, "uniquePairs": [], "uniquePlacement": false, "placementNotDetermined": false, "noCommonColumn": true, "hull": { "refStart": 1, "refEnd": 8, "crossesOrigin": false, "wholeCircle": false }, "selected": { "coordinates": [ [ 0, 2, 3, 4, 7, 8 ], [ 0, 2, 2, 3, 3, 4 ] ], "gappedReference": "GGTAATTT", "gappedRead": "TG-A---C", "columns": 8, "identical": 2, "mismatches": 2, "ambiguousColumns": 0, "gapColumns": 4, "gapOpens": 2, "identity": { "numerator": 2, "denominator": 8 }, "readAligned": { "bases": 4, "of": 4 }, "referenceCovered": { "bases": 8, "of": 8 }, "placement": { "refStart": 1, "refEnd": 8, "readStart": 1, "readEnd": 4, "crossesOrigin": false }, "overhang": [], "differences": [ { "kind": "substitution", "ref": 1, "refBase": "G", "readBase": "T", "read": 1, "common": false, "notFixed": { "from": null, "to": null } }, { "kind": "deletion", "refStart": 3, "refEnd": 3, "length": 1, "bases": "T", "readAfter": 2, "common": false, "notFixed": { "from": null, "to": null } }, { "kind": "deletion", "refStart": 5, "refEnd": 7, "length": 3, "bases": "ATT", "readAfter": 3, "common": false, "notFixed": { "from": null, "to": null } }, { "kind": "substitution", "ref": 8, "refBase": "T", "readBase": "C", "read": 4, "common": false, "notFixed": { "from": null, "to": null } } ] }, "band": { "diagonalMin": 0, "diagonalMax": 4, "cellsNeeded": 33, "unionBandLimited": false, "scope": "every optimal path", "gridCells": 45, "searchedBanded": false, "sharedWords": 0, "sharedWordsOverCap": false, "seedGuarantee": { "differencesUpTo": 12, "guaranteed": false } }, "enumeration": "listed", "alignments": [ [ [ 0, 2, 3, 4, 7, 8 ], [ 0, 2, 2, 3, 3, 4 ] ], [ [ 0, 2, 5, 7, 8 ], [ 0, 0, 3, 3, 4 ] ], [ [ 0, 2, 4, 5, 7, 8 ], [ 0, 2, 2, 3, 3, 4 ] ], [ [ 0, 2, 3, 5, 8 ], [ 0, 2, 2, 4, 4 ] ], [ [ 0, 2, 6, 8 ], [ 0, 0, 4, 4 ] ], [ [ 0, 2, 4, 6, 8 ], [ 0, 2, 2, 4, 4 ] ] ], "tuples": [ [ 2, 0, 8, 2, 4, 2, 4, 4 ], [ 2, 0, 8, 2, 4, 2, 4, 5 ], [ 2, 0, 8, 2, 4, 2, 4, 6 ], [ 2, 0, 8, 2, 4, 2, 4, 8 ] ], "tupleFields": [ "identical", "ambiguousColumns", "columns", "mismatches", "gapColumns", "gapOpens", "readAligned", "referenceCovered" ], "variation": { "readAligned": { "shared": true, "min": 4, "max": 4 }, "referenceCovered": { "shared": false, "min": 4, "max": 8 }, "identity": { "shared": true, "min": { "numerator": 1, "denominator": 4 }, "max": { "numerator": 1, "denominator": 4 } }, "overhangStart": { "shared": true, "min": 0, "max": 0 }, "overhangEnd": { "shared": true, "min": 0, "max": 0 } }, "placements": [ { "refStart": 1, "refEnd": 8, "crossesOrigin": false, "wholeCircle": false, "readStart": 1, "readEnd": 4, "alignments": 6, "band": { "diagonalMin": 0, "diagonalMax": 4, "cellsNeeded": 33, "bandLimited": false } } ] }, "minus": { "score": -11, "count": 2, "overCap": false, "state": "aligned", "biopython": { "score": -11, "count": 2 }, "uniquePairs": [ [ 3, 2 ], [ 4, 3 ], [ 5, 4 ] ], "uniquePlacement": true, "placementNotDetermined": false, "noCommonColumn": false, "hull": { "refStart": 1, "refEnd": 5, "crossesOrigin": false, "wholeCircle": false }, "selected": { "coordinates": [ [ 0, 1, 5, 8 ], [ 0, 0, 4, 4 ] ], "gappedReference": "GGTAATTT", "gappedRead": "-GTCA---", "columns": 8, "identical": 3, "mismatches": 1, "ambiguousColumns": 0, "gapColumns": 4, "gapOpens": 2, "identity": { "numerator": 3, "denominator": 8 }, "readAligned": { "bases": 4, "of": 4 }, "referenceCovered": { "bases": 4, "of": 8 }, "placement": { "refStart": 2, "refEnd": 5, "readStart": 1, "readEnd": 4, "crossesOrigin": false, "asSupplied": { "readStart": 1, "readEnd": 4 } }, "overhang": [], "differences": [ { "kind": "deletion", "refStart": 1, "refEnd": 1, "length": 1, "bases": "G", "readAfter": 0, "asSupplied": { "readBetween": [ 4, 5 ] }, "common": false, "notFixed": { "from": null, "to": { "ref": 3, "read": 2, "readAsSupplied": 3 } } }, { "kind": "substitution", "ref": 4, "refBase": "A", "readBase": "C", "read": 3, "common": true, "asSupplied": { "read": 2, "readBase": "G" } }, { "kind": "deletion", "refStart": 6, "refEnd": 8, "length": 3, "bases": "TTT", "readAfter": 4, "asSupplied": { "readBetween": [ 0, 1 ] }, "common": true } ] }, "band": { "diagonalMin": 0, "diagonalMax": 4, "cellsNeeded": 33, "unionBandLimited": false, "scope": "every optimal path", "gridCells": 45, "searchedBanded": false, "sharedWords": 0, "sharedWordsOverCap": false, "seedGuarantee": { "differencesUpTo": 9, "guaranteed": false } }, "enumeration": "listed", "alignments": [ [ [ 0, 1, 5, 8 ], [ 0, 0, 4, 4 ] ], [ [ 0, 1, 2, 5, 8 ], [ 0, 1, 1, 4, 4 ] ] ], "tuples": [ [ 3, 0, 8, 1, 4, 2, 4, 4 ], [ 3, 0, 8, 1, 4, 2, 4, 5 ] ], "tupleFields": [ "identical", "ambiguousColumns", "columns", "mismatches", "gapColumns", "gapOpens", "readAligned", "referenceCovered" ], "variation": { "readAligned": { "shared": true, "min": 4, "max": 4 }, "referenceCovered": { "shared": false, "min": 4, "max": 5 }, "identity": { "shared": true, "min": { "numerator": 3, "denominator": 8 }, "max": { "numerator": 3, "denominator": 8 } }, "overhangStart": { "shared": true, "min": 0, "max": 0 }, "overhangEnd": { "shared": true, "min": 0, "max": 0 } }, "placements": [ { "refStart": 1, "refEnd": 5, "crossesOrigin": false, "wholeCircle": false, "readStart": 1, "readEnd": 4, "asSupplied": { "readStart": 1, "readEnd": 4 }, "alignments": 2, "band": { "diagonalMin": 0, "diagonalMax": 4, "cellsNeeded": 33, "bandLimited": false } } ] } } ] } }, { "id": "tie-order-gap-in-reference", "note": "Global: in a gap in the reference, extending and opening from a pair tie; the tie order extends first.", "input": { "reference": { "residues": "GCA", "topology": "linear" }, "read": { "residues": "GGCACGA" }, "modes": [ "global" ] }, "expected": { "results": [ { "mode": "global", "region": null, "strand": "+", "strandUndetermined": false, "plus": { "score": -8, "count": 5, "overCap": false, "state": "aligned", "biopython": { "score": -8, "count": 5 }, "uniquePairs": [], "uniquePlacement": false, "placementNotDetermined": false, "noCommonColumn": true, "hull": { "refStart": 1, "refEnd": 3, "crossesOrigin": false, "wholeCircle": false }, "selected": { "coordinates": [ [ 0, 0, 2, 2, 3 ], [ 0, 1, 3, 6, 7 ] ], "gappedReference": "-GC---A", "gappedRead": "GGCACGA", "columns": 7, "identical": 3, "mismatches": 0, "ambiguousColumns": 0, "gapColumns": 4, "gapOpens": 2, "identity": { "numerator": 3, "denominator": 7 }, "readAligned": { "bases": 6, "of": 7 }, "referenceCovered": { "bases": 3, "of": 3 }, "placement": { "refStart": 1, "refEnd": 3, "readStart": 2, "readEnd": 7, "crossesOrigin": false }, "overhang": [], "differences": [ { "kind": "insertion", "refAfter": 0, "length": 1, "bases": "G", "readStart": 1, "readEnd": 1, "common": false, "notFixed": { "from": null, "to": null } }, { "kind": "insertion", "refAfter": 2, "length": 3, "bases": "ACG", "readStart": 4, "readEnd": 6, "common": false, "notFixed": { "from": null, "to": null } } ] }, "band": { "diagonalMin": -4, "diagonalMax": 0, "cellsNeeded": 26, "unionBandLimited": false, "scope": "every optimal path", "gridCells": 32, "searchedBanded": false, "sharedWords": 0, "sharedWordsOverCap": false, "seedGuarantee": { "differencesUpTo": 11, "guaranteed": false } }, "enumeration": "listed", "alignments": [ [ [ 0, 0, 2, 2, 3 ], [ 0, 1, 3, 6, 7 ] ], [ [ 0, 1, 1, 2, 2, 3 ], [ 0, 1, 2, 3, 6, 7 ] ], [ [ 0, 1, 1, 2, 2, 3 ], [ 0, 1, 4, 5, 6, 7 ] ], [ [ 0, 0, 3, 3 ], [ 0, 1, 4, 7 ] ], [ [ 0, 1, 1, 3, 3 ], [ 0, 1, 2, 4, 7 ] ] ], "tuples": [ [ 3, 0, 7, 0, 4, 2, 3, 3 ], [ 3, 0, 7, 0, 4, 2, 4, 3 ], [ 3, 0, 7, 0, 4, 2, 6, 3 ], [ 3, 0, 7, 0, 4, 2, 7, 3 ] ], "tupleFields": [ "identical", "ambiguousColumns", "columns", "mismatches", "gapColumns", "gapOpens", "readAligned", "referenceCovered" ], "variation": { "readAligned": { "shared": false, "min": 3, "max": 7 }, "referenceCovered": { "shared": true, "min": 3, "max": 3 }, "identity": { "shared": true, "min": { "numerator": 3, "denominator": 7 }, "max": { "numerator": 3, "denominator": 7 } }, "overhangStart": { "shared": true, "min": 0, "max": 0 }, "overhangEnd": { "shared": true, "min": 0, "max": 0 } }, "placements": [ { "refStart": 1, "refEnd": 3, "crossesOrigin": false, "wholeCircle": false, "readStart": 1, "readEnd": 7, "alignments": 5, "band": { "diagonalMin": -4, "diagonalMax": 0, "cellsNeeded": 26, "bandLimited": false } } ] }, "minus": { "score": -10, "count": 1, "overCap": false, "state": "aligned", "biopython": { "score": -10, "count": 1 }, "uniquePairs": [ [ 1, 5 ], [ 2, 6 ], [ 3, 7 ] ], "uniquePlacement": true, "placementNotDetermined": false, "noCommonColumn": false, "hull": { "refStart": 1, "refEnd": 3, "crossesOrigin": false, "wholeCircle": false }, "selected": { "coordinates": [ [ 0, 0, 3 ], [ 0, 4, 7 ] ], "gappedReference": "----GCA", "gappedRead": "TCGTGCC", "columns": 7, "identical": 2, "mismatches": 1, "ambiguousColumns": 0, "gapColumns": 4, "gapOpens": 1, "identity": { "numerator": 2, "denominator": 7 }, "readAligned": { "bases": 3, "of": 7 }, "referenceCovered": { "bases": 3, "of": 3 }, "placement": { "refStart": 1, "refEnd": 3, "readStart": 5, "readEnd": 7, "crossesOrigin": false, "asSupplied": { "readStart": 1, "readEnd": 3 } }, "overhang": [], "differences": [ { "kind": "insertion", "refAfter": 0, "length": 4, "bases": "TCGT", "readStart": 1, "readEnd": 4, "asSupplied": { "readStart": 4, "readEnd": 7, "bases": "ACGA" }, "common": true }, { "kind": "substitution", "ref": 3, "refBase": "A", "readBase": "C", "read": 7, "common": true, "asSupplied": { "read": 1, "readBase": "G" } } ] }, "band": { "diagonalMin": -4, "diagonalMax": 0, "cellsNeeded": 26, "unionBandLimited": false, "scope": "every optimal path", "gridCells": 32, "searchedBanded": false, "sharedWords": 0, "sharedWordsOverCap": false, "seedGuarantee": { "differencesUpTo": 12, "guaranteed": false } }, "enumeration": "listed", "alignments": [ [ [ 0, 0, 3 ], [ 0, 4, 7 ] ] ], "tuples": [ [ 2, 0, 7, 1, 4, 1, 3, 3 ] ], "tupleFields": [ "identical", "ambiguousColumns", "columns", "mismatches", "gapColumns", "gapOpens", "readAligned", "referenceCovered" ], "variation": { "readAligned": { "shared": true, "min": 3, "max": 3 }, "referenceCovered": { "shared": true, "min": 3, "max": 3 }, "identity": { "shared": true, "min": { "numerator": 2, "denominator": 7 }, "max": { "numerator": 2, "denominator": 7 } }, "overhangStart": { "shared": true, "min": 0, "max": 0 }, "overhangEnd": { "shared": true, "min": 0, "max": 0 } }, "placements": [ { "refStart": 1, "refEnd": 3, "crossesOrigin": false, "wholeCircle": false, "readStart": 5, "readEnd": 7, "asSupplied": { "readStart": 1, "readEnd": 3 }, "alignments": 1, "band": { "diagonalMin": -4, "diagonalMax": 0, "cellsNeeded": 26, "bandLimited": false } } ] } } ] } }, { "id": "tie-order-pair-then-gaps", "note": "Global: before a pair, a gap in the read and a gap in the reference tie; the tie order takes the gap in the read.", "input": { "reference": { "residues": "ATTGAT", "topology": "linear" }, "read": { "residues": "GAAT" }, "modes": [ "global" ] }, "expected": { "results": [ { "mode": "global", "region": null, "strand": "-", "strandUndetermined": false, "plus": { "score": -8, "count": 3, "overCap": false, "state": "aligned", "biopython": { "score": -8, "count": 3 }, "uniquePairs": [ [ 6, 4 ] ], "uniquePlacement": true, "placementNotDetermined": false, "noCommonColumn": false, "hull": { "refStart": 1, "refEnd": 6, "crossesOrigin": false, "wholeCircle": false }, "selected": { "coordinates": [ [ 0, 0, 1, 4, 6 ], [ 0, 1, 2, 2, 4 ] ], "gappedReference": "-ATTGAT", "gappedRead": "GA---AT", "columns": 7, "identical": 3, "mismatches": 0, "ambiguousColumns": 0, "gapColumns": 4, "gapOpens": 2, "identity": { "numerator": 3, "denominator": 7 }, "readAligned": { "bases": 3, "of": 4 }, "referenceCovered": { "bases": 6, "of": 6 }, "placement": { "refStart": 1, "refEnd": 6, "readStart": 2, "readEnd": 4, "crossesOrigin": false }, "overhang": [], "differences": [ { "kind": "insertion", "refAfter": 0, "length": 1, "bases": "G", "readStart": 1, "readEnd": 1, "common": false, "notFixed": { "from": null, "to": { "ref": 6, "read": 4 } } }, { "kind": "deletion", "refStart": 2, "refEnd": 4, "length": 3, "bases": "TTG", "readAfter": 2, "common": false, "notFixed": { "from": null, "to": { "ref": 6, "read": 4 } } } ] }, "band": { "diagonalMin": -1, "diagonalMax": 3, "cellsNeeded": 29, "unionBandLimited": false, "scope": "every optimal path", "gridCells": 35, "searchedBanded": false, "sharedWords": 0, "sharedWordsOverCap": false, "seedGuarantee": { "differencesUpTo": 8, "guaranteed": false } }, "enumeration": "listed", "alignments": [ [ [ 0, 0, 1, 4, 6 ], [ 0, 1, 2, 2, 4 ] ], [ [ 0, 3, 4, 4, 6 ], [ 0, 0, 1, 2, 4 ] ], [ [ 0, 3, 5, 5, 6 ], [ 0, 0, 2, 3, 4 ] ] ], "tuples": [ [ 3, 0, 7, 0, 4, 2, 3, 6 ], [ 3, 0, 7, 0, 4, 2, 4, 3 ] ], "tupleFields": [ "identical", "ambiguousColumns", "columns", "mismatches", "gapColumns", "gapOpens", "readAligned", "referenceCovered" ], "variation": { "readAligned": { "shared": false, "min": 3, "max": 4 }, "referenceCovered": { "shared": false, "min": 3, "max": 6 }, "identity": { "shared": true, "min": { "numerator": 3, "denominator": 7 }, "max": { "numerator": 3, "denominator": 7 } }, "overhangStart": { "shared": true, "min": 0, "max": 0 }, "overhangEnd": { "shared": true, "min": 0, "max": 0 } }, "placements": [ { "refStart": 1, "refEnd": 6, "crossesOrigin": false, "wholeCircle": false, "readStart": 1, "readEnd": 4, "alignments": 3, "band": { "diagonalMin": -1, "diagonalMax": 3, "cellsNeeded": 29, "bandLimited": false } } ] }, "minus": { "score": -4, "count": 2, "overCap": false, "state": "aligned", "biopython": { "score": -4, "count": 2 }, "uniquePairs": [ [ 1, 1 ], [ 2, 2 ], [ 3, 3 ] ], "uniquePlacement": true, "placementNotDetermined": false, "noCommonColumn": false, "hull": { "refStart": 1, "refEnd": 6, "crossesOrigin": false, "wholeCircle": false }, "selected": { "coordinates": [ [ 0, 3, 5, 6 ], [ 0, 3, 3, 4 ] ], "gappedReference": "ATTGAT", "gappedRead": "ATT--C", "columns": 6, "identical": 3, "mismatches": 1, "ambiguousColumns": 0, "gapColumns": 2, "gapOpens": 1, "identity": { "numerator": 3, "denominator": 6 }, "readAligned": { "bases": 4, "of": 4 }, "referenceCovered": { "bases": 6, "of": 6 }, "placement": { "refStart": 1, "refEnd": 6, "readStart": 1, "readEnd": 4, "crossesOrigin": false, "asSupplied": { "readStart": 1, "readEnd": 4 } }, "overhang": [], "differences": [ { "kind": "deletion", "refStart": 4, "refEnd": 5, "length": 2, "bases": "GA", "readAfter": 3, "asSupplied": { "readBetween": [ 1, 2 ] }, "common": false, "notFixed": { "from": { "ref": 3, "read": 3, "readAsSupplied": 2 }, "to": null } }, { "kind": "substitution", "ref": 6, "refBase": "T", "readBase": "C", "read": 4, "common": false, "notFixed": { "from": { "ref": 3, "read": 3, "readAsSupplied": 2 }, "to": null }, "asSupplied": { "read": 1, "readBase": "G" } } ] }, "band": { "diagonalMin": 0, "diagonalMax": 2, "cellsNeeded": 23, "unionBandLimited": false, "scope": "every optimal path", "gridCells": 35, "searchedBanded": false, "sharedWords": 0, "sharedWordsOverCap": false, "seedGuarantee": { "differencesUpTo": 6, "guaranteed": false } }, "enumeration": "listed", "alignments": [ [ [ 0, 3, 5, 6 ], [ 0, 3, 3, 4 ] ], [ [ 0, 4, 6 ], [ 0, 4, 4 ] ] ], "tuples": [ [ 3, 0, 6, 1, 2, 1, 4, 4 ], [ 3, 0, 6, 1, 2, 1, 4, 6 ] ], "tupleFields": [ "identical", "ambiguousColumns", "columns", "mismatches", "gapColumns", "gapOpens", "readAligned", "referenceCovered" ], "variation": { "readAligned": { "shared": true, "min": 4, "max": 4 }, "referenceCovered": { "shared": false, "min": 4, "max": 6 }, "identity": { "shared": true, "min": { "numerator": 1, "denominator": 2 }, "max": { "numerator": 1, "denominator": 2 } }, "overhangStart": { "shared": true, "min": 0, "max": 0 }, "overhangEnd": { "shared": true, "min": 0, "max": 0 } }, "placements": [ { "refStart": 1, "refEnd": 6, "crossesOrigin": false, "wholeCircle": false, "readStart": 1, "readEnd": 4, "asSupplied": { "readStart": 1, "readEnd": 4 }, "alignments": 2, "band": { "diagonalMin": 0, "diagonalMax": 2, "cellsNeeded": 23, "bandLimited": false } } ] } } ] } }, { "id": "ambiguity-both-sides", "note": "N and Y in the reference (J01636.1 1-60, bases 20 and 41), R and N in the read (11-50, read bases 15 and 30): ambiguity columns score 0 and leave the identity's denominator.", "input": { "reference": { "residues": "GACACCATCGAATGGCGCANAACCTTTCGCGGTATGGCATYATAGCGCCCGGAAGAGAGT", "topology": "linear", "source": "J01636.1 1-60, base 20 to N, base 41 to Y" }, "read": { "residues": "AATGGCGCAAAACCRTTCGCGGTATGGCANGATAGCGCCC", "source": "J01636.1 11-50, read base 15 to R, read base 30 to N" }, "modes": [ "semiglobal-read", "local" ] }, "expected": { "results": [ { "mode": "semiglobal-read", "region": null, "strand": "+", "strandUndetermined": false, "plus": { "score": 72, "count": 1, "overCap": false, "state": "aligned", "biopython": { "score": 72, "count": 1 }, "uniquePairs": [ [ 11, 1 ], [ 12, 2 ], [ 13, 3 ], [ 14, 4 ], [ 15, 5 ], [ 16, 6 ], [ 17, 7 ], [ 18, 8 ], [ 19, 9 ], [ 20, 10 ], [ 21, 11 ], [ 22, 12 ], [ 23, 13 ], [ 24, 14 ], [ 25, 15 ], [ 26, 16 ], [ 27, 17 ], [ 28, 18 ], [ 29, 19 ], [ 30, 20 ], [ 31, 21 ], [ 32, 22 ], [ 33, 23 ], [ 34, 24 ], [ 35, 25 ], [ 36, 26 ], [ 37, 27 ], [ 38, 28 ], [ 39, 29 ], [ 40, 30 ], [ 41, 31 ], [ 42, 32 ], [ 43, 33 ], [ 44, 34 ], [ 45, 35 ], [ 46, 36 ], [ 47, 37 ], [ 48, 38 ], [ 49, 39 ], [ 50, 40 ] ], "uniquePlacement": true, "placementNotDetermined": false, "noCommonColumn": false, "hull": { "refStart": 11, "refEnd": 50, "crossesOrigin": false, "wholeCircle": false }, "selected": { "coordinates": [ [ 0, 10, 50, 60 ], [ 0, 0, 40, 40 ] ], "gappedReference": "AATGGCGCANAACCTTTCGCGGTATGGCATYATAGCGCCC", "gappedRead": "AATGGCGCAAAACCRTTCGCGGTATGGCANGATAGCGCCC", "columns": 40, "identical": 36, "mismatches": 0, "ambiguousColumns": 4, "gapColumns": 0, "gapOpens": 0, "identity": { "numerator": 36, "denominator": 36 }, "readAligned": { "bases": 40, "of": 40 }, "referenceCovered": { "bases": 40, "of": 60 }, "placement": { "refStart": 11, "refEnd": 50, "readStart": 1, "readEnd": 40, "crossesOrigin": false }, "overhang": [], "differences": [ { "kind": "ambiguous", "ref": 20, "refBase": "N", "readBase": "A", "read": 10, "lettersCanAgree": true, "common": true }, { "kind": "ambiguous", "ref": 25, "refBase": "T", "readBase": "R", "read": 15, "lettersCanAgree": false, "common": true }, { "kind": "ambiguous", "ref": 40, "refBase": "T", "readBase": "N", "read": 30, "lettersCanAgree": true, "common": true }, { "kind": "ambiguous", "ref": 41, "refBase": "Y", "readBase": "G", "read": 31, "lettersCanAgree": false, "common": true } ] }, "band": { "diagonalMin": 10, "diagonalMax": 10, "cellsNeeded": 123, "unionBandLimited": false, "scope": "every optimal path", "gridCells": 2501, "searchedBanded": false, "sharedWords": 3, "sharedWordsOverCap": false, "seedGuarantee": { "differencesUpTo": 4, "guaranteed": false } }, "enumeration": "listed", "alignments": [ [ [ 0, 10, 50, 60 ], [ 0, 0, 40, 40 ] ] ], "tuples": [ [ 36, 4, 40, 0, 0, 0, 40, 40 ] ], "tupleFields": [ "identical", "ambiguousColumns", "columns", "mismatches", "gapColumns", "gapOpens", "readAligned", "referenceCovered" ], "variation": { "readAligned": { "shared": true, "min": 40, "max": 40 }, "referenceCovered": { "shared": true, "min": 40, "max": 40 }, "identity": { "shared": true, "min": { "numerator": 1, "denominator": 1 }, "max": { "numerator": 1, "denominator": 1 } }, "overhangStart": { "shared": true, "min": 0, "max": 0 }, "overhangEnd": { "shared": true, "min": 0, "max": 0 } }, "placements": [ { "refStart": 11, "refEnd": 50, "crossesOrigin": false, "wholeCircle": false, "readStart": 1, "readEnd": 40, "alignments": 1, "band": { "diagonalMin": 10, "diagonalMax": 10, "cellsNeeded": 123, "bandLimited": false } } ] }, "minus": { "score": -13, "count": 6, "overCap": false, "state": "aligned", "biopython": { "score": -13, "count": 6 }, "uniquePairs": [ [ 3, 4 ], [ 4, 5 ], [ 5, 6 ], [ 6, 7 ], [ 7, 8 ], [ 8, 9 ], [ 9, 10 ], [ 10, 11 ], [ 12, 16 ], [ 13, 17 ], [ 14, 18 ], [ 15, 19 ], [ 16, 20 ], [ 17, 21 ], [ 18, 22 ], [ 19, 23 ], [ 20, 24 ], [ 21, 25 ], [ 22, 26 ], [ 23, 27 ], [ 24, 28 ], [ 25, 29 ], [ 26, 30 ], [ 27, 31 ], [ 28, 32 ], [ 29, 33 ], [ 30, 34 ], [ 31, 35 ], [ 32, 36 ], [ 33, 37 ], [ 34, 38 ], [ 35, 39 ], [ 36, 40 ] ], "uniquePlacement": true, "placementNotDetermined": false, "noCommonColumn": false, "hull": { "refStart": 1, "refEnd": 36, "crossesOrigin": false, "wholeCircle": false }, "selected": { "coordinates": [ [ 0, 0, 10, 10, 36, 60 ], [ 0, 1, 11, 14, 40, 40 ] ], "gappedReference": "GACACCATCG---AATGGCGCANAACCTTTCGCGGTATG", "gappedRead": "GGCGCTATCNTGCCATACCGCGAAYGGTTTTGCGCCATT", "columns": 39, "identical": 20, "mismatches": 13, "ambiguousColumns": 3, "gapColumns": 3, "gapOpens": 1, "identity": { "numerator": 20, "denominator": 36 }, "readAligned": { "bases": 39, "of": 40 }, "referenceCovered": { "bases": 36, "of": 60 }, "placement": { "refStart": 1, "refEnd": 36, "readStart": 2, "readEnd": 40, "crossesOrigin": false, "asSupplied": { "readStart": 1, "readEnd": 39 } }, "overhang": [ { "side": "start", "at": "reference-end", "length": 1, "bases": "G", "readStart": 1, "readEnd": 1, "asSupplied": { "readStart": 40, "readEnd": 40, "bases": "C" } } ], "differences": [ { "kind": "substitution", "ref": 2, "refBase": "A", "readBase": "G", "read": 3, "common": false, "notFixed": { "from": null, "to": { "ref": 3, "read": 4, "readAsSupplied": 37 } }, "asSupplied": { "read": 38, "readBase": "C" } }, { "kind": "substitution", "ref": 4, "refBase": "A", "readBase": "G", "read": 5, "common": true, "asSupplied": { "read": 36, "readBase": "C" } }, { "kind": "substitution", "ref": 6, "refBase": "C", "readBase": "T", "read": 7, "common": true, "asSupplied": { "read": 34, "readBase": "A" } }, { "kind": "ambiguous", "ref": 10, "refBase": "G", "readBase": "N", "read": 11, "lettersCanAgree": true, "common": true, "asSupplied": { "read": 30, "readBase": "N" } }, { "kind": "insertion", "refAfter": 10, "length": 3, "bases": "TGC", "readStart": 12, "readEnd": 14, "asSupplied": { "readStart": 27, "readEnd": 29, "bases": "GCA" }, "common": false, "notFixed": { "from": { "ref": 10, "read": 11, "readAsSupplied": 30 }, "to": { "ref": 12, "read": 16, "readAsSupplied": 25 } } }, { "kind": "substitution", "ref": 11, "refBase": "A", "readBase": "C", "read": 15, "common": false, "notFixed": { "from": { "ref": 10, "read": 11, "readAsSupplied": 30 }, "to": { "ref": 12, "read": 16, "readAsSupplied": 25 } }, "asSupplied": { "read": 26, "readBase": "G" } }, { "kind": "substitution", "ref": 14, "refBase": "G", "readBase": "A", "read": 18, "common": true, "asSupplied": { "read": 23, "readBase": "T" } }, { "kind": "substitution", "ref": 15, "refBase": "G", "readBase": "C", "read": 19, "common": true, "asSupplied": { "read": 22, "readBase": "G" } }, { "kind": "substitution", "ref": 19, "refBase": "A", "readBase": "G", "read": 23, "common": true, "asSupplied": { "read": 18, "readBase": "C" } }, { "kind": "ambiguous", "ref": 20, "refBase": "N", "readBase": "A", "read": 24, "lettersCanAgree": true, "common": true, "asSupplied": { "read": 17, "readBase": "T" } }, { "kind": "ambiguous", "ref": 22, "refBase": "A", "readBase": "Y", "read": 26, "lettersCanAgree": false, "common": true, "asSupplied": { "read": 15, "readBase": "R" } }, { "kind": "substitution", "ref": 23, "refBase": "C", "readBase": "G", "read": 27, "common": true, "asSupplied": { "read": 14, "readBase": "C" } }, { "kind": "substitution", "ref": 24, "refBase": "C", "readBase": "G", "read": 28, "common": true, "asSupplied": { "read": 13, "readBase": "C" } }, { "kind": "substitution", "ref": 28, "refBase": "C", "readBase": "T", "read": 32, "common": true, "asSupplied": { "read": 9, "readBase": "A" } }, { "kind": "substitution", "ref": 32, "refBase": "G", "readBase": "C", "read": 36, "common": true, "asSupplied": { "read": 5, "readBase": "G" } }, { "kind": "substitution", "ref": 33, "refBase": "T", "readBase": "C", "read": 37, "common": true, "asSupplied": { "read": 4, "readBase": "G" } }, { "kind": "substitution", "ref": 36, "refBase": "G", "readBase": "T", "read": 40, "common": true, "asSupplied": { "read": 1, "readBase": "A" } } ] }, "band": { "diagonalMin": -4, "diagonalMax": 0, "cellsNeeded": 272, "unionBandLimited": false, "scope": "every optimal path", "gridCells": 2501, "searchedBanded": false, "sharedWords": 0, "sharedWordsOverCap": false, "seedGuarantee": { "differencesUpTo": 46, "guaranteed": false } }, "enumeration": "listed", "alignments": [ [ [ 0, 0, 10, 10, 36, 60 ], [ 0, 1, 11, 14, 40, 40 ] ], [ [ 0, 1, 1, 10, 10, 36, 60 ], [ 0, 1, 2, 11, 14, 40, 40 ] ], [ [ 0, 2, 2, 10, 10, 36, 60 ], [ 0, 2, 3, 11, 14, 40, 40 ] ], [ [ 0, 0, 11, 11, 36, 60 ], [ 0, 1, 12, 15, 40, 40 ] ], [ [ 0, 1, 1, 11, 11, 36, 60 ], [ 0, 1, 2, 12, 15, 40, 40 ] ], [ [ 0, 2, 2, 11, 11, 36, 60 ], [ 0, 2, 3, 12, 15, 40, 40 ] ] ], "tuples": [ [ 20, 3, 39, 13, 3, 1, 39, 36 ], [ 20, 3, 40, 13, 4, 2, 40, 36 ] ], "tupleFields": [ "identical", "ambiguousColumns", "columns", "mismatches", "gapColumns", "gapOpens", "readAligned", "referenceCovered" ], "variation": { "readAligned": { "shared": false, "min": 39, "max": 40 }, "referenceCovered": { "shared": true, "min": 36, "max": 36 }, "identity": { "shared": false, "min": { "numerator": 20, "denominator": 37 }, "max": { "numerator": 5, "denominator": 9 } }, "overhangStart": { "shared": false, "min": 0, "max": 1 }, "overhangEnd": { "shared": true, "min": 0, "max": 0 } }, "placements": [ { "refStart": 1, "refEnd": 36, "crossesOrigin": false, "wholeCircle": false, "readStart": 1, "readEnd": 40, "asSupplied": { "readStart": 1, "readEnd": 40 }, "alignments": 6, "band": { "diagonalMin": -4, "diagonalMax": 0, "cellsNeeded": 272, "bandLimited": false } } ] } }, { "mode": "local", "region": null, "strand": "+", "strandUndetermined": false, "plus": { "score": 72, "count": 1, "overCap": false, "state": "aligned", "biopython": { "score": 72, "count": 1 }, "uniquePairs": [ [ 11, 1 ], [ 12, 2 ], [ 13, 3 ], [ 14, 4 ], [ 15, 5 ], [ 16, 6 ], [ 17, 7 ], [ 18, 8 ], [ 19, 9 ], [ 20, 10 ], [ 21, 11 ], [ 22, 12 ], [ 23, 13 ], [ 24, 14 ], [ 25, 15 ], [ 26, 16 ], [ 27, 17 ], [ 28, 18 ], [ 29, 19 ], [ 30, 20 ], [ 31, 21 ], [ 32, 22 ], [ 33, 23 ], [ 34, 24 ], [ 35, 25 ], [ 36, 26 ], [ 37, 27 ], [ 38, 28 ], [ 39, 29 ], [ 40, 30 ], [ 41, 31 ], [ 42, 32 ], [ 43, 33 ], [ 44, 34 ], [ 45, 35 ], [ 46, 36 ], [ 47, 37 ], [ 48, 38 ], [ 49, 39 ], [ 50, 40 ] ], "uniquePlacement": true, "placementNotDetermined": false, "noCommonColumn": false, "hull": { "refStart": 11, "refEnd": 50, "crossesOrigin": false, "wholeCircle": false }, "selected": { "coordinates": [ [ 10, 50 ], [ 0, 40 ] ], "gappedReference": "AATGGCGCANAACCTTTCGCGGTATGGCATYATAGCGCCC", "gappedRead": "AATGGCGCAAAACCRTTCGCGGTATGGCANGATAGCGCCC", "columns": 40, "identical": 36, "mismatches": 0, "ambiguousColumns": 4, "gapColumns": 0, "gapOpens": 0, "identity": { "numerator": 36, "denominator": 36 }, "readAligned": { "bases": 40, "of": 40 }, "referenceCovered": { "bases": 40, "of": 60 }, "placement": { "refStart": 11, "refEnd": 50, "readStart": 1, "readEnd": 40, "crossesOrigin": false }, "overhang": [], "differences": [ { "kind": "ambiguous", "ref": 20, "refBase": "N", "readBase": "A", "read": 10, "lettersCanAgree": true, "common": true }, { "kind": "ambiguous", "ref": 25, "refBase": "T", "readBase": "R", "read": 15, "lettersCanAgree": false, "common": true }, { "kind": "ambiguous", "ref": 40, "refBase": "T", "readBase": "N", "read": 30, "lettersCanAgree": true, "common": true }, { "kind": "ambiguous", "ref": 41, "refBase": "Y", "readBase": "G", "read": 31, "lettersCanAgree": false, "common": true } ] }, "band": { "diagonalMin": 10, "diagonalMax": 10, "cellsNeeded": 123, "unionBandLimited": false, "scope": "every optimal path", "gridCells": 2501, "searchedBanded": false, "sharedWords": 3, "sharedWordsOverCap": false, "seedGuarantee": { "differencesUpTo": 4, "guaranteed": false } }, "enumeration": "listed", "alignments": [ [ [ 10, 50 ], [ 0, 40 ] ] ], "tuples": [ [ 36, 4, 40, 0, 0, 0, 40, 40 ] ], "tupleFields": [ "identical", "ambiguousColumns", "columns", "mismatches", "gapColumns", "gapOpens", "readAligned", "referenceCovered" ], "variation": { "readAligned": { "shared": true, "min": 40, "max": 40 }, "referenceCovered": { "shared": true, "min": 40, "max": 40 }, "identity": { "shared": true, "min": { "numerator": 1, "denominator": 1 }, "max": { "numerator": 1, "denominator": 1 } }, "overhangStart": { "shared": true, "min": 0, "max": 0 }, "overhangEnd": { "shared": true, "min": 0, "max": 0 } }, "placements": [ { "refStart": 11, "refEnd": 50, "crossesOrigin": false, "wholeCircle": false, "readStart": 1, "readEnd": 40, "alignments": 1, "band": { "diagonalMin": 10, "diagonalMax": 10, "cellsNeeded": 123, "bandLimited": false } } ] }, "minus": { "score": 12, "count": 1, "overCap": false, "state": "aligned", "biopython": { "score": 12, "count": 1 }, "uniquePairs": [ [ 9, 22 ], [ 10, 23 ], [ 11, 24 ], [ 12, 25 ], [ 13, 26 ], [ 14, 27 ], [ 15, 28 ] ], "uniquePlacement": true, "placementNotDetermined": false, "noCommonColumn": false, "hull": { "refStart": 9, "refEnd": 15, "crossesOrigin": false, "wholeCircle": false }, "selected": { "coordinates": [ [ 8, 15 ], [ 21, 28 ] ], "gappedReference": "CGAATGG", "gappedRead": "CGAAYGG", "columns": 7, "identical": 6, "mismatches": 0, "ambiguousColumns": 1, "gapColumns": 0, "gapOpens": 0, "identity": { "numerator": 6, "denominator": 6 }, "readAligned": { "bases": 7, "of": 40 }, "referenceCovered": { "bases": 7, "of": 60 }, "placement": { "refStart": 9, "refEnd": 15, "readStart": 22, "readEnd": 28, "crossesOrigin": false, "asSupplied": { "readStart": 13, "readEnd": 19 } }, "overhang": [], "differences": [ { "kind": "ambiguous", "ref": 13, "refBase": "T", "readBase": "Y", "read": 26, "lettersCanAgree": true, "common": true, "asSupplied": { "read": 15, "readBase": "R" } } ] }, "band": { "diagonalMin": -13, "diagonalMax": -13, "cellsNeeded": 84, "unionBandLimited": false, "scope": "every optimal path", "gridCells": 2501, "searchedBanded": false, "sharedWords": 0, "sharedWordsOverCap": false, "seedGuarantee": { "differencesUpTo": 34, "guaranteed": false } }, "enumeration": "listed", "alignments": [ [ [ 8, 15 ], [ 21, 28 ] ] ], "tuples": [ [ 6, 1, 7, 0, 0, 0, 7, 7 ] ], "tupleFields": [ "identical", "ambiguousColumns", "columns", "mismatches", "gapColumns", "gapOpens", "readAligned", "referenceCovered" ], "variation": { "readAligned": { "shared": true, "min": 7, "max": 7 }, "referenceCovered": { "shared": true, "min": 7, "max": 7 }, "identity": { "shared": true, "min": { "numerator": 1, "denominator": 1 }, "max": { "numerator": 1, "denominator": 1 } }, "overhangStart": { "shared": true, "min": 0, "max": 0 }, "overhangEnd": { "shared": true, "min": 0, "max": 0 } }, "placements": [ { "refStart": 9, "refEnd": 15, "crossesOrigin": false, "wholeCircle": false, "readStart": 22, "readEnd": 28, "asSupplied": { "readStart": 13, "readEnd": 19 }, "alignments": 1, "band": { "diagonalMin": -13, "diagonalMax": -13, "cellsNeeded": 84, "bandLimited": false } } ] } } ] } }, { "id": "reverse-strand", "note": "The reverse complement of J01636.1 201-280 with one substitution, placed on 101-400: the minus strand scores higher.", "input": { "reference": { "residues": "ATGTCGCAGAGTATGCCGGTGTCTCTTATCAGACCGTTTCCCGCGTGGTGAACCAGGCCAGCCACGTTTCTGCGAAAACGCGGGAAAAAGTGGAAGCGGCGATGGCGGAGCTGAATTACATTCCCAACCGCGTGGCACAACAACTGGCGGGCAAACAGTCGTTGCTGATTGGCGTTGCCACCTCCAGTCTGGCCCTGCACGCGCCGTCGCAAATTGTCGCGGCGATTAAATCTCGCGCCGATCAACTGGGTGCCAGCGTGGTGGTGTCGATGGTAGAACGAAGCGGCGTCGAAGCCTGTA", "topology": "linear", "source": "J01636.1 101-400" }, "read": { "residues": "TGGCAACGCCAATCAGCAACGACTGTTTGCCCGCCAGTTCTTGTGCCACGCGGTTGGGAATGTAATTCAGCTCCGCCATC", "source": "reverse complement of J01636.1 201-280 with base 241 changed" }, "modes": [ "semiglobal-read", "local" ] }, "expected": { "results": [ { "mode": "semiglobal-read", "region": null, "strand": "-", "strandUndetermined": false, "plus": { "score": -22, "count": 2048, "overCap": true, "state": "aligned", "biopython": { "score": -22, "count": 2048 }, "uniquePairs": [ [ 165, 20 ], [ 167, 21 ], [ 168, 22 ], [ 169, 23 ], [ 170, 24 ], [ 171, 25 ], [ 175, 27 ], [ 176, 28 ], [ 177, 29 ], [ 178, 30 ], [ 182, 32 ], [ 183, 33 ], [ 184, 34 ], [ 185, 35 ], [ 186, 36 ], [ 187, 37 ], [ 189, 40 ], [ 190, 41 ], [ 191, 42 ], [ 192, 43 ], [ 196, 44 ], [ 197, 45 ], [ 199, 48 ], [ 200, 49 ], [ 201, 50 ], [ 202, 51 ], [ 203, 52 ], [ 206, 53 ], [ 207, 54 ], [ 208, 55 ], [ 209, 56 ], [ 210, 57 ], [ 211, 58 ], [ 212, 59 ], [ 213, 60 ], [ 216, 62 ], [ 217, 63 ], [ 225, 65 ], [ 226, 66 ], [ 227, 67 ], [ 232, 71 ], [ 233, 72 ], [ 234, 73 ], [ 236, 74 ], [ 237, 75 ], [ 238, 76 ], [ 239, 77 ], [ 241, 78 ], [ 242, 79 ], [ 243, 80 ] ], "uniquePlacement": true, "placementNotDetermined": false, "noCommonColumn": false, "hull": { "refStart": 145, "refEnd": 243, "crossesOrigin": false, "wholeCircle": false }, "selected": { "coordinates": [ [ 0, 148, 154, 154, 160, 160, 165, 166, 171, 173, 178, 180, 187, 187, 192, 195, 197, 197, 203, 205, 213, 214, 217, 223, 227, 228, 234, 235, 239, 240, 243, 300 ], [ 0, 0, 6, 8, 14, 15, 20, 20, 25, 25, 30, 30, 37, 38, 43, 43, 45, 46, 52, 52, 60, 60, 63, 63, 67, 67, 73, 73, 77, 77, 80, 80 ] ], "gappedReference": "GGGCAA--ACAGTC-GTTGCTGATTGGCGTTGCCACCTCCAG-TCTGGCCCTG-CACGCGCCGTCGCAAATTGTCGCGGCGATTAAATCTCGCGCCGATC", "gappedRead": "TGGCAACGCCAATCAGCAAC-GACTG--TTTGC--CCGCCAGTTCTTG---TGCCACGCG--GTTGGGAA-TGT------AATT-CAGCTC-CGCC-ATC", "columns": 100, "identical": 59, "mismatches": 16, "ambiguousColumns": 0, "gapColumns": 25, "gapOpens": 14, "identity": { "numerator": 59, "denominator": 100 }, "readAligned": { "bases": 80, "of": 80 }, "referenceCovered": { "bases": 95, "of": 300 }, "placement": { "refStart": 149, "refEnd": 243, "readStart": 1, "readEnd": 80, "crossesOrigin": false }, "overhang": [], "differences": [ { "kind": "substitution", "ref": 149, "refBase": "G", "readBase": "T", "read": 1, "common": false, "notFixed": { "from": null, "to": { "ref": 165, "read": 20 } } }, { "kind": "insertion", "refAfter": 154, "length": 2, "bases": "CG", "readStart": 7, "readEnd": 8, "common": false, "notFixed": { "from": null, "to": { "ref": 165, "read": 20 } } }, { "kind": "substitution", "ref": 155, "refBase": "A", "readBase": "C", "read": 9, "common": false, "notFixed": { "from": null, "to": { "ref": 165, "read": 20 } } }, { "kind": "substitution", "ref": 158, "refBase": "G", "readBase": "A", "read": 12, "common": false, "notFixed": { "from": null, "to": { "ref": 165, "read": 20 } } }, { "kind": "insertion", "refAfter": 160, "length": 1, "bases": "A", "readStart": 15, "readEnd": 15, "common": false, "notFixed": { "from": null, "to": { "ref": 165, "read": 20 } } }, { "kind": "substitution", "ref": 162, "refBase": "T", "readBase": "C", "read": 17, "common": false, "notFixed": { "from": null, "to": { "ref": 165, "read": 20 } } }, { "kind": "substitution", "ref": 163, "refBase": "T", "readBase": "A", "read": 18, "common": false, "notFixed": { "from": null, "to": { "ref": 165, "read": 20 } } }, { "kind": "substitution", "ref": 164, "refBase": "G", "readBase": "A", "read": 19, "common": false, "notFixed": { "from": null, "to": { "ref": 165, "read": 20 } } }, { "kind": "deletion", "refStart": 166, "refEnd": 166, "length": 1, "bases": "T", "readAfter": 20, "common": true }, { "kind": "substitution", "ref": 169, "refBase": "T", "readBase": "C", "read": 23, "common": true }, { "kind": "deletion", "refStart": 172, "refEnd": 173, "length": 2, "bases": "GC", "readAfter": 25, "common": false, "notFixed": { "from": { "ref": 171, "read": 25 }, "to": { "ref": 175, "read": 27 } } }, { "kind": "substitution", "ref": 174, "refBase": "G", "readBase": "T", "read": 26, "common": false, "notFixed": { "from": { "ref": 171, "read": 25 }, "to": { "ref": 175, "read": 27 } } }, { "kind": "deletion", "refStart": 179, "refEnd": 180, "length": 2, "bases": "CA", "readAfter": 30, "common": false, "notFixed": { "from": { "ref": 178, "read": 30 }, "to": { "ref": 182, "read": 32 } } }, { "kind": "substitution", "ref": 183, "refBase": "T", "readBase": "G", "read": 33, "common": true }, { "kind": "insertion", "refAfter": 187, "length": 1, "bases": "T", "readStart": 38, "readEnd": 38, "common": false, "notFixed": { "from": { "ref": 187, "read": 37 }, "to": { "ref": 189, "read": 40 } } }, { "kind": "substitution", "ref": 191, "refBase": "G", "readBase": "T", "read": 42, "common": true }, { "kind": "deletion", "refStart": 193, "refEnd": 195, "length": 3, "bases": "CCC", "readAfter": 43, "common": true }, { "kind": "insertion", "refAfter": 197, "length": 1, "bases": "C", "readStart": 46, "readEnd": 46, "common": false, "notFixed": { "from": { "ref": 197, "read": 45 }, "to": { "ref": 199, "read": 48 } } }, { "kind": "deletion", "refStart": 204, "refEnd": 205, "length": 2, "bases": "CC", "readAfter": 52, "common": true }, { "kind": "substitution", "ref": 208, "refBase": "C", "readBase": "T", "read": 55, "common": true }, { "kind": "substitution", "ref": 210, "refBase": "C", "readBase": "G", "read": 57, "common": true }, { "kind": "substitution", "ref": 211, "refBase": "A", "readBase": "G", "read": 58, "common": true }, { "kind": "deletion", "refStart": 214, "refEnd": 214, "length": 1, "bases": "T", "readAfter": 60, "common": false, "notFixed": { "from": { "ref": 213, "read": 60 }, "to": { "ref": 216, "read": 62 } } }, { "kind": "deletion", "refStart": 218, "refEnd": 223, "length": 6, "bases": "CGCGGC", "readAfter": 63, "common": false, "notFixed": { "from": { "ref": 217, "read": 63 }, "to": { "ref": 225, "read": 65 } } }, { "kind": "substitution", "ref": 224, "refBase": "G", "readBase": "A", "read": 64, "common": false, "notFixed": { "from": { "ref": 217, "read": 63 }, "to": { "ref": 225, "read": 65 } } }, { "kind": "deletion", "refStart": 228, "refEnd": 228, "length": 1, "bases": "A", "readAfter": 67, "common": false, "notFixed": { "from": { "ref": 227, "read": 67 }, "to": { "ref": 232, "read": 71 } } }, { "kind": "substitution", "ref": 229, "refBase": "A", "readBase": "C", "read": 68, "common": false, "notFixed": { "from": { "ref": 227, "read": 67 }, "to": { "ref": 232, "read": 71 } } }, { "kind": "substitution", "ref": 231, "refBase": "T", "readBase": "G", "read": 70, "common": false, "notFixed": { "from": { "ref": 227, "read": 67 }, "to": { "ref": 232, "read": 71 } } }, { "kind": "deletion", "refStart": 235, "refEnd": 235, "length": 1, "bases": "G", "readAfter": 73, "common": true }, { "kind": "deletion", "refStart": 240, "refEnd": 240, "length": 1, "bases": "G", "readAfter": 77, "common": true } ] }, "band": { "diagonalMin": 142, "diagonalMax": 163, "cellsNeeded": 1944, "unionBandLimited": false, "scope": "every optimal path", "gridCells": 24381, "searchedBanded": true, "sharedWords": 0, "sharedWordsOverCap": false, "seedGuarantee": { "differencesUpTo": 91, "guaranteed": false } }, "enumeration": "checked", "tuples": [ [ 59, 0, 100, 16, 25, 14, 80, 95 ], [ 61, 0, 103, 15, 27, 15, 80, 99 ] ], "tupleFields": [ "identical", "ambiguousColumns", "columns", "mismatches", "gapColumns", "gapOpens", "readAligned", "referenceCovered" ], "variation": { "readAligned": { "shared": true, "min": 80, "max": 80 }, "referenceCovered": { "shared": false, "min": 95, "max": 99 }, "identity": { "shared": false, "min": { "numerator": 59, "denominator": 100 }, "max": { "numerator": 61, "denominator": 103 } }, "overhangStart": { "shared": true, "min": 0, "max": 0 }, "overhangEnd": { "shared": true, "min": 0, "max": 0 } }, "placements": [ { "refStart": 145, "refEnd": 243, "crossesOrigin": false, "wholeCircle": false, "readStart": 1, "readEnd": 80, "alignments": 2048, "band": { "diagonalMin": 142, "diagonalMax": 163, "cellsNeeded": 1944, "bandLimited": false } } ] }, "minus": { "score": 155, "count": 1, "overCap": false, "state": "aligned", "biopython": { "score": 155, "count": 1 }, "uniquePairs": [ [ 101, 1 ], [ 102, 2 ], [ 103, 3 ], [ 104, 4 ], [ 105, 5 ], [ 106, 6 ], [ 107, 7 ], [ 108, 8 ], [ 109, 9 ], [ 110, 10 ], [ 111, 11 ], [ 112, 12 ], [ 113, 13 ], [ 114, 14 ], [ 115, 15 ], [ 116, 16 ], [ 117, 17 ], [ 118, 18 ], [ 119, 19 ], [ 120, 20 ], [ 121, 21 ], [ 122, 22 ], [ 123, 23 ], [ 124, 24 ], [ 125, 25 ], [ 126, 26 ], [ 127, 27 ], [ 128, 28 ], [ 129, 29 ], [ 130, 30 ], [ 131, 31 ], [ 132, 32 ], [ 133, 33 ], [ 134, 34 ], [ 135, 35 ], [ 136, 36 ], [ 137, 37 ], [ 138, 38 ], [ 139, 39 ], [ 140, 40 ], [ 141, 41 ], [ 142, 42 ], [ 143, 43 ], [ 144, 44 ], [ 145, 45 ], [ 146, 46 ], [ 147, 47 ], [ 148, 48 ], [ 149, 49 ], [ 150, 50 ], [ 151, 51 ], [ 152, 52 ], [ 153, 53 ], [ 154, 54 ], [ 155, 55 ], [ 156, 56 ], [ 157, 57 ], [ 158, 58 ], [ 159, 59 ], [ 160, 60 ], [ 161, 61 ], [ 162, 62 ], [ 163, 63 ], [ 164, 64 ], [ 165, 65 ], [ 166, 66 ], [ 167, 67 ], [ 168, 68 ], [ 169, 69 ], [ 170, 70 ], [ 171, 71 ], [ 172, 72 ], [ 173, 73 ], [ 174, 74 ], [ 175, 75 ], [ 176, 76 ], [ 177, 77 ], [ 178, 78 ], [ 179, 79 ], [ 180, 80 ] ], "uniquePlacement": true, "placementNotDetermined": false, "noCommonColumn": false, "hull": { "refStart": 101, "refEnd": 180, "crossesOrigin": false, "wholeCircle": false }, "selected": { "coordinates": [ [ 0, 100, 180, 300 ], [ 0, 0, 80, 80 ] ], "gappedReference": "GATGGCGGAGCTGAATTACATTCCCAACCGCGTGGCACAACAACTGGCGGGCAAACAGTCGTTGCTGATTGGCGTTGCCA", "gappedRead": "GATGGCGGAGCTGAATTACATTCCCAACCGCGTGGCACAAGAACTGGCGGGCAAACAGTCGTTGCTGATTGGCGTTGCCA", "columns": 80, "identical": 79, "mismatches": 1, "ambiguousColumns": 0, "gapColumns": 0, "gapOpens": 0, "identity": { "numerator": 79, "denominator": 80 }, "readAligned": { "bases": 80, "of": 80 }, "referenceCovered": { "bases": 80, "of": 300 }, "placement": { "refStart": 101, "refEnd": 180, "readStart": 1, "readEnd": 80, "crossesOrigin": false, "asSupplied": { "readStart": 1, "readEnd": 80 } }, "overhang": [], "differences": [ { "kind": "substitution", "ref": 141, "refBase": "C", "readBase": "G", "read": 41, "common": true, "asSupplied": { "read": 40, "readBase": "C" } } ] }, "band": { "diagonalMin": 100, "diagonalMax": 100, "cellsNeeded": 243, "unionBandLimited": false, "scope": "every optimal path", "gridCells": 24381, "searchedBanded": true, "sharedWords": 57, "sharedWordsOverCap": false, "seedGuarantee": { "differencesUpTo": 2, "guaranteed": true } }, "enumeration": "listed", "alignments": [ [ [ 0, 100, 180, 300 ], [ 0, 0, 80, 80 ] ] ], "tuples": [ [ 79, 0, 80, 1, 0, 0, 80, 80 ] ], "tupleFields": [ "identical", "ambiguousColumns", "columns", "mismatches", "gapColumns", "gapOpens", "readAligned", "referenceCovered" ], "variation": { "readAligned": { "shared": true, "min": 80, "max": 80 }, "referenceCovered": { "shared": true, "min": 80, "max": 80 }, "identity": { "shared": true, "min": { "numerator": 79, "denominator": 80 }, "max": { "numerator": 79, "denominator": 80 } }, "overhangStart": { "shared": true, "min": 0, "max": 0 }, "overhangEnd": { "shared": true, "min": 0, "max": 0 } }, "placements": [ { "refStart": 101, "refEnd": 180, "crossesOrigin": false, "wholeCircle": false, "readStart": 1, "readEnd": 80, "asSupplied": { "readStart": 1, "readEnd": 80 }, "alignments": 1, "band": { "diagonalMin": 100, "diagonalMax": 100, "cellsNeeded": 243, "bandLimited": false } } ] } }, { "mode": "local", "region": null, "strand": "-", "strandUndetermined": false, "plus": { "score": 16, "count": 1, "overCap": false, "state": "aligned", "biopython": { "score": 16, "count": 1 }, "uniquePairs": [ [ 32, 21 ], [ 33, 22 ], [ 34, 23 ], [ 35, 24 ], [ 36, 25 ], [ 37, 26 ], [ 38, 27 ], [ 39, 28 ], [ 40, 30 ], [ 41, 31 ], [ 42, 32 ], [ 43, 33 ], [ 44, 34 ] ], "uniquePlacement": true, "placementNotDetermined": false, "noCommonColumn": false, "hull": { "refStart": 32, "refEnd": 44, "crossesOrigin": false, "wholeCircle": false }, "selected": { "coordinates": [ [ 31, 39, 39, 44 ], [ 20, 28, 29, 34 ] ], "gappedReference": "GACCGTTT-CCCGC", "gappedRead": "GACTGTTTGCCCGC", "columns": 14, "identical": 12, "mismatches": 1, "ambiguousColumns": 0, "gapColumns": 1, "gapOpens": 1, "identity": { "numerator": 12, "denominator": 14 }, "readAligned": { "bases": 14, "of": 80 }, "referenceCovered": { "bases": 13, "of": 300 }, "placement": { "refStart": 32, "refEnd": 44, "readStart": 21, "readEnd": 34, "crossesOrigin": false }, "overhang": [], "differences": [ { "kind": "substitution", "ref": 35, "refBase": "C", "readBase": "T", "read": 24, "common": true }, { "kind": "insertion", "refAfter": 39, "length": 1, "bases": "G", "readStart": 29, "readEnd": 29, "common": true } ] }, "band": { "diagonalMin": 10, "diagonalMax": 11, "cellsNeeded": 324, "unionBandLimited": false, "scope": "every optimal path", "gridCells": 24381, "searchedBanded": true, "sharedWords": 0, "sharedWordsOverCap": false, "seedGuarantee": { "differencesUpTo": 72, "guaranteed": false } }, "enumeration": "listed", "alignments": [ [ [ 31, 39, 39, 44 ], [ 20, 28, 29, 34 ] ] ], "tuples": [ [ 12, 0, 14, 1, 1, 1, 14, 13 ] ], "tupleFields": [ "identical", "ambiguousColumns", "columns", "mismatches", "gapColumns", "gapOpens", "readAligned", "referenceCovered" ], "variation": { "readAligned": { "shared": true, "min": 14, "max": 14 }, "referenceCovered": { "shared": true, "min": 13, "max": 13 }, "identity": { "shared": true, "min": { "numerator": 6, "denominator": 7 }, "max": { "numerator": 6, "denominator": 7 } }, "overhangStart": { "shared": true, "min": 0, "max": 0 }, "overhangEnd": { "shared": true, "min": 0, "max": 0 } }, "placements": [ { "refStart": 32, "refEnd": 44, "crossesOrigin": false, "wholeCircle": false, "readStart": 21, "readEnd": 34, "alignments": 1, "band": { "diagonalMin": 10, "diagonalMax": 11, "cellsNeeded": 324, "bandLimited": false } } ] }, "minus": { "score": 155, "count": 1, "overCap": false, "state": "aligned", "biopython": { "score": 155, "count": 1 }, "uniquePairs": [ [ 101, 1 ], [ 102, 2 ], [ 103, 3 ], [ 104, 4 ], [ 105, 5 ], [ 106, 6 ], [ 107, 7 ], [ 108, 8 ], [ 109, 9 ], [ 110, 10 ], [ 111, 11 ], [ 112, 12 ], [ 113, 13 ], [ 114, 14 ], [ 115, 15 ], [ 116, 16 ], [ 117, 17 ], [ 118, 18 ], [ 119, 19 ], [ 120, 20 ], [ 121, 21 ], [ 122, 22 ], [ 123, 23 ], [ 124, 24 ], [ 125, 25 ], [ 126, 26 ], [ 127, 27 ], [ 128, 28 ], [ 129, 29 ], [ 130, 30 ], [ 131, 31 ], [ 132, 32 ], [ 133, 33 ], [ 134, 34 ], [ 135, 35 ], [ 136, 36 ], [ 137, 37 ], [ 138, 38 ], [ 139, 39 ], [ 140, 40 ], [ 141, 41 ], [ 142, 42 ], [ 143, 43 ], [ 144, 44 ], [ 145, 45 ], [ 146, 46 ], [ 147, 47 ], [ 148, 48 ], [ 149, 49 ], [ 150, 50 ], [ 151, 51 ], [ 152, 52 ], [ 153, 53 ], [ 154, 54 ], [ 155, 55 ], [ 156, 56 ], [ 157, 57 ], [ 158, 58 ], [ 159, 59 ], [ 160, 60 ], [ 161, 61 ], [ 162, 62 ], [ 163, 63 ], [ 164, 64 ], [ 165, 65 ], [ 166, 66 ], [ 167, 67 ], [ 168, 68 ], [ 169, 69 ], [ 170, 70 ], [ 171, 71 ], [ 172, 72 ], [ 173, 73 ], [ 174, 74 ], [ 175, 75 ], [ 176, 76 ], [ 177, 77 ], [ 178, 78 ], [ 179, 79 ], [ 180, 80 ] ], "uniquePlacement": true, "placementNotDetermined": false, "noCommonColumn": false, "hull": { "refStart": 101, "refEnd": 180, "crossesOrigin": false, "wholeCircle": false }, "selected": { "coordinates": [ [ 100, 180 ], [ 0, 80 ] ], "gappedReference": "GATGGCGGAGCTGAATTACATTCCCAACCGCGTGGCACAACAACTGGCGGGCAAACAGTCGTTGCTGATTGGCGTTGCCA", "gappedRead": "GATGGCGGAGCTGAATTACATTCCCAACCGCGTGGCACAAGAACTGGCGGGCAAACAGTCGTTGCTGATTGGCGTTGCCA", "columns": 80, "identical": 79, "mismatches": 1, "ambiguousColumns": 0, "gapColumns": 0, "gapOpens": 0, "identity": { "numerator": 79, "denominator": 80 }, "readAligned": { "bases": 80, "of": 80 }, "referenceCovered": { "bases": 80, "of": 300 }, "placement": { "refStart": 101, "refEnd": 180, "readStart": 1, "readEnd": 80, "crossesOrigin": false, "asSupplied": { "readStart": 1, "readEnd": 80 } }, "overhang": [], "differences": [ { "kind": "substitution", "ref": 141, "refBase": "C", "readBase": "G", "read": 41, "common": true, "asSupplied": { "read": 40, "readBase": "C" } } ] }, "band": { "diagonalMin": 100, "diagonalMax": 100, "cellsNeeded": 243, "unionBandLimited": false, "scope": "every optimal path", "gridCells": 24381, "searchedBanded": true, "sharedWords": 57, "sharedWordsOverCap": false, "seedGuarantee": { "differencesUpTo": 2, "guaranteed": true } }, "enumeration": "listed", "alignments": [ [ [ 100, 180 ], [ 0, 80 ] ] ], "tuples": [ [ 79, 0, 80, 1, 0, 0, 80, 80 ] ], "tupleFields": [ "identical", "ambiguousColumns", "columns", "mismatches", "gapColumns", "gapOpens", "readAligned", "referenceCovered" ], "variation": { "readAligned": { "shared": true, "min": 80, "max": 80 }, "referenceCovered": { "shared": true, "min": 80, "max": 80 }, "identity": { "shared": true, "min": { "numerator": 79, "denominator": 80 }, "max": { "numerator": 79, "denominator": 80 } }, "overhangStart": { "shared": true, "min": 0, "max": 0 }, "overhangEnd": { "shared": true, "min": 0, "max": 0 } }, "placements": [ { "refStart": 101, "refEnd": 180, "crossesOrigin": false, "wholeCircle": false, "readStart": 1, "readEnd": 80, "asSupplied": { "readStart": 1, "readEnd": 80 }, "alignments": 1, "band": { "diagonalMin": 100, "diagonalMax": 100, "cellsNeeded": 243, "bandLimited": false } } ] } } ] } }, { "id": "palindromic-read", "note": "A read that is its own reverse complement scores the same on both strands: an ambiguous placement, never resolved.", "input": { "reference": { "residues": "CGTAAAGCTTGCAAGCTTGTCA", "topology": "linear" }, "read": { "residues": "AAGCTTGCAAGCTT" }, "modes": [ "semiglobal-read" ] }, "expected": { "results": [ { "mode": "semiglobal-read", "region": null, "strand": "ambiguous", "strandUndetermined": true, "plus": { "score": 28, "count": 1, "overCap": false, "state": "aligned", "biopython": { "score": 28, "count": 1 }, "uniquePairs": [ [ 5, 1 ], [ 6, 2 ], [ 7, 3 ], [ 8, 4 ], [ 9, 5 ], [ 10, 6 ], [ 11, 7 ], [ 12, 8 ], [ 13, 9 ], [ 14, 10 ], [ 15, 11 ], [ 16, 12 ], [ 17, 13 ], [ 18, 14 ] ], "uniquePlacement": true, "placementNotDetermined": false, "noCommonColumn": false, "hull": { "refStart": 5, "refEnd": 18, "crossesOrigin": false, "wholeCircle": false }, "selected": { "coordinates": [ [ 0, 4, 18, 22 ], [ 0, 0, 14, 14 ] ], "gappedReference": "AAGCTTGCAAGCTT", "gappedRead": "AAGCTTGCAAGCTT", "columns": 14, "identical": 14, "mismatches": 0, "ambiguousColumns": 0, "gapColumns": 0, "gapOpens": 0, "identity": { "numerator": 14, "denominator": 14 }, "readAligned": { "bases": 14, "of": 14 }, "referenceCovered": { "bases": 14, "of": 22 }, "placement": { "refStart": 5, "refEnd": 18, "readStart": 1, "readEnd": 14, "crossesOrigin": false }, "overhang": [], "differences": [] }, "band": { "diagonalMin": 4, "diagonalMax": 4, "cellsNeeded": 45, "unionBandLimited": false, "scope": "every optimal path", "gridCells": 345, "searchedBanded": false, "sharedWords": 3, "sharedWordsOverCap": false, "seedGuarantee": { "differencesUpTo": 0, "guaranteed": true } }, "enumeration": "listed", "alignments": [ [ [ 0, 4, 18, 22 ], [ 0, 0, 14, 14 ] ] ], "tuples": [ [ 14, 0, 14, 0, 0, 0, 14, 14 ] ], "tupleFields": [ "identical", "ambiguousColumns", "columns", "mismatches", "gapColumns", "gapOpens", "readAligned", "referenceCovered" ], "variation": { "readAligned": { "shared": true, "min": 14, "max": 14 }, "referenceCovered": { "shared": true, "min": 14, "max": 14 }, "identity": { "shared": true, "min": { "numerator": 1, "denominator": 1 }, "max": { "numerator": 1, "denominator": 1 } }, "overhangStart": { "shared": true, "min": 0, "max": 0 }, "overhangEnd": { "shared": true, "min": 0, "max": 0 } }, "placements": [ { "refStart": 5, "refEnd": 18, "crossesOrigin": false, "wholeCircle": false, "readStart": 1, "readEnd": 14, "alignments": 1, "band": { "diagonalMin": 4, "diagonalMax": 4, "cellsNeeded": 45, "bandLimited": false } } ] }, "minus": { "score": 28, "count": 1, "overCap": false, "state": "aligned", "biopython": { "score": 28, "count": 1 }, "uniquePairs": [ [ 5, 1 ], [ 6, 2 ], [ 7, 3 ], [ 8, 4 ], [ 9, 5 ], [ 10, 6 ], [ 11, 7 ], [ 12, 8 ], [ 13, 9 ], [ 14, 10 ], [ 15, 11 ], [ 16, 12 ], [ 17, 13 ], [ 18, 14 ] ], "uniquePlacement": true, "placementNotDetermined": false, "noCommonColumn": false, "hull": { "refStart": 5, "refEnd": 18, "crossesOrigin": false, "wholeCircle": false }, "selected": { "coordinates": [ [ 0, 4, 18, 22 ], [ 0, 0, 14, 14 ] ], "gappedReference": "AAGCTTGCAAGCTT", "gappedRead": "AAGCTTGCAAGCTT", "columns": 14, "identical": 14, "mismatches": 0, "ambiguousColumns": 0, "gapColumns": 0, "gapOpens": 0, "identity": { "numerator": 14, "denominator": 14 }, "readAligned": { "bases": 14, "of": 14 }, "referenceCovered": { "bases": 14, "of": 22 }, "placement": { "refStart": 5, "refEnd": 18, "readStart": 1, "readEnd": 14, "crossesOrigin": false, "asSupplied": { "readStart": 1, "readEnd": 14 } }, "overhang": [], "differences": [] }, "band": { "diagonalMin": 4, "diagonalMax": 4, "cellsNeeded": 45, "unionBandLimited": false, "scope": "every optimal path", "gridCells": 345, "searchedBanded": false, "sharedWords": 3, "sharedWordsOverCap": false, "seedGuarantee": { "differencesUpTo": 0, "guaranteed": true } }, "enumeration": "listed", "alignments": [ [ [ 0, 4, 18, 22 ], [ 0, 0, 14, 14 ] ] ], "tuples": [ [ 14, 0, 14, 0, 0, 0, 14, 14 ] ], "tupleFields": [ "identical", "ambiguousColumns", "columns", "mismatches", "gapColumns", "gapOpens", "readAligned", "referenceCovered" ], "variation": { "readAligned": { "shared": true, "min": 14, "max": 14 }, "referenceCovered": { "shared": true, "min": 14, "max": 14 }, "identity": { "shared": true, "min": { "numerator": 1, "denominator": 1 }, "max": { "numerator": 1, "denominator": 1 } }, "overhangStart": { "shared": true, "min": 0, "max": 0 }, "overhangEnd": { "shared": true, "min": 0, "max": 0 } }, "placements": [ { "refStart": 5, "refEnd": 18, "crossesOrigin": false, "wholeCircle": false, "readStart": 1, "readEnd": 14, "asSupplied": { "readStart": 1, "readEnd": 14 }, "alignments": 1, "band": { "diagonalMin": 4, "diagonalMax": 4, "cellsNeeded": 45, "bandLimited": false } } ] } } ] } }, { "id": "repeat-two-placements", "note": "A 20-base read (J01636.1 501-520) present twice in the reference: two co-optimal placements, listed, never collapsed.", "input": { "reference": { "residues": "GCGCCGTCGCAAATTGTCGCGGCGATTAAATCTCGCGCCGTAATGTTCCGGCGTTATTTCGTCGCATTGGGTCACCAGCAAATCGCGCTGTTAGCGGGCCTAATGTTCCGGCGTTATTTCATCAAATTCAGCCGATAGCGGAACGGGAAGGCGACTGGAG", "topology": "linear", "source": "J01636.1 301-340, 501-520, 601-640, 501-520, 701-740" }, "read": { "residues": "TAATGTTCCGGCGTTATTTC", "source": "J01636.1 501-520" }, "modes": [ "semiglobal-read", "local" ] }, "expected": { "results": [ { "mode": "semiglobal-read", "region": null, "strand": "+", "strandUndetermined": false, "plus": { "score": 40, "count": 2, "overCap": false, "state": "aligned", "biopython": { "score": 40, "count": 2 }, "uniquePairs": [], "uniquePlacement": false, "placementNotDetermined": false, "noCommonColumn": false, "hull": { "refStart": 41, "refEnd": 120, "crossesOrigin": false, "wholeCircle": false }, "selected": { "coordinates": [ [ 0, 40, 60, 160 ], [ 0, 0, 20, 20 ] ], "gappedReference": "TAATGTTCCGGCGTTATTTC", "gappedRead": "TAATGTTCCGGCGTTATTTC", "columns": 20, "identical": 20, "mismatches": 0, "ambiguousColumns": 0, "gapColumns": 0, "gapOpens": 0, "identity": { "numerator": 20, "denominator": 20 }, "readAligned": { "bases": 20, "of": 20 }, "referenceCovered": { "bases": 20, "of": 160 }, "placement": { "refStart": 41, "refEnd": 60, "readStart": 1, "readEnd": 20, "crossesOrigin": false }, "overhang": [], "differences": [] }, "band": { "diagonalMin": 40, "diagonalMax": 100, "cellsNeeded": 1323, "unionBandLimited": false, "scope": "every optimal path", "gridCells": 3381, "searchedBanded": false, "sharedWords": 18, "sharedWordsOverCap": false, "seedGuarantee": { "differencesUpTo": 0, "guaranteed": true } }, "enumeration": "listed", "alignments": [ [ [ 0, 40, 60, 160 ], [ 0, 0, 20, 20 ] ], [ [ 0, 100, 120, 160 ], [ 0, 0, 20, 20 ] ] ], "tuples": [ [ 20, 0, 20, 0, 0, 0, 20, 20 ] ], "tupleFields": [ "identical", "ambiguousColumns", "columns", "mismatches", "gapColumns", "gapOpens", "readAligned", "referenceCovered" ], "variation": { "readAligned": { "shared": true, "min": 20, "max": 20 }, "referenceCovered": { "shared": true, "min": 20, "max": 20 }, "identity": { "shared": true, "min": { "numerator": 1, "denominator": 1 }, "max": { "numerator": 1, "denominator": 1 } }, "overhangStart": { "shared": true, "min": 0, "max": 0 }, "overhangEnd": { "shared": true, "min": 0, "max": 0 } }, "placements": [ { "refStart": 41, "refEnd": 60, "crossesOrigin": false, "wholeCircle": false, "readStart": 1, "readEnd": 20, "alignments": 1, "band": { "diagonalMin": 40, "diagonalMax": 40, "cellsNeeded": 63, "bandLimited": false } }, { "refStart": 101, "refEnd": 120, "crossesOrigin": false, "wholeCircle": false, "readStart": 1, "readEnd": 20, "alignments": 1, "band": { "diagonalMin": 100, "diagonalMax": 100, "cellsNeeded": 63, "bandLimited": false } } ] }, "minus": { "score": -2, "count": 7, "overCap": false, "state": "aligned", "biopython": { "score": -2, "count": 7 }, "uniquePairs": [ [ 27, 1 ], [ 28, 2 ], [ 29, 3 ], [ 30, 4 ], [ 39, 11 ], [ 40, 12 ], [ 41, 13 ], [ 42, 14 ], [ 43, 15 ], [ 44, 16 ], [ 45, 17 ], [ 46, 18 ], [ 47, 19 ], [ 48, 20 ] ], "uniquePlacement": true, "placementNotDetermined": false, "noCommonColumn": false, "hull": { "refStart": 27, "refEnd": 48, "crossesOrigin": false, "wholeCircle": false }, "selected": { "coordinates": [ [ 0, 26, 30, 32, 48, 160 ], [ 0, 0, 4, 4, 20, 20 ] ], "gappedReference": "TAAATCTCGCGCCGTAATGTTC", "gappedRead": "GAAA--TAACGCCGGAACATTA", "columns": 22, "identical": 13, "mismatches": 7, "ambiguousColumns": 0, "gapColumns": 2, "gapOpens": 1, "identity": { "numerator": 13, "denominator": 22 }, "readAligned": { "bases": 20, "of": 20 }, "referenceCovered": { "bases": 22, "of": 160 }, "placement": { "refStart": 27, "refEnd": 48, "readStart": 1, "readEnd": 20, "crossesOrigin": false, "asSupplied": { "readStart": 1, "readEnd": 20 } }, "overhang": [], "differences": [ { "kind": "substitution", "ref": 27, "refBase": "T", "readBase": "G", "read": 1, "common": true, "asSupplied": { "read": 20, "readBase": "C" } }, { "kind": "deletion", "refStart": 31, "refEnd": 32, "length": 2, "bases": "TC", "readAfter": 4, "asSupplied": { "readBetween": [ 16, 17 ] }, "common": false, "notFixed": { "from": { "ref": 30, "read": 4, "readAsSupplied": 17 }, "to": { "ref": 39, "read": 11, "readAsSupplied": 10 } } }, { "kind": "substitution", "ref": 34, "refBase": "C", "readBase": "A", "read": 6, "common": false, "notFixed": { "from": { "ref": 30, "read": 4, "readAsSupplied": 17 }, "to": { "ref": 39, "read": 11, "readAsSupplied": 10 } }, "asSupplied": { "read": 15, "readBase": "T" } }, { "kind": "substitution", "ref": 35, "refBase": "G", "readBase": "A", "read": 7, "common": false, "notFixed": { "from": { "ref": 30, "read": 4, "readAsSupplied": 17 }, "to": { "ref": 39, "read": 11, "readAsSupplied": 10 } }, "asSupplied": { "read": 14, "readBase": "T" } }, { "kind": "substitution", "ref": 41, "refBase": "T", "readBase": "G", "read": 13, "common": true, "asSupplied": { "read": 8, "readBase": "C" } }, { "kind": "substitution", "ref": 44, "refBase": "T", "readBase": "C", "read": 16, "common": true, "asSupplied": { "read": 5, "readBase": "G" } }, { "kind": "substitution", "ref": 45, "refBase": "G", "readBase": "A", "read": 17, "common": true, "asSupplied": { "read": 4, "readBase": "T" } }, { "kind": "substitution", "ref": 48, "refBase": "C", "readBase": "A", "read": 20, "common": true, "asSupplied": { "read": 1, "readBase": "T" } } ] }, "band": { "diagonalMin": 26, "diagonalMax": 28, "cellsNeeded": 105, "unionBandLimited": false, "scope": "every optimal path", "gridCells": 3381, "searchedBanded": false, "sharedWords": 0, "sharedWordsOverCap": false, "seedGuarantee": { "differencesUpTo": 21, "guaranteed": false } }, "enumeration": "listed", "alignments": [ [ [ 0, 26, 30, 32, 48, 160 ], [ 0, 0, 4, 4, 20, 20 ] ], [ [ 0, 26, 31, 33, 48, 160 ], [ 0, 0, 5, 5, 20, 20 ] ], [ [ 0, 26, 32, 34, 48, 160 ], [ 0, 0, 6, 6, 20, 20 ] ], [ [ 0, 26, 33, 35, 48, 160 ], [ 0, 0, 7, 7, 20, 20 ] ], [ [ 0, 26, 34, 36, 48, 160 ], [ 0, 0, 8, 8, 20, 20 ] ], [ [ 0, 26, 35, 37, 48, 160 ], [ 0, 0, 9, 9, 20, 20 ] ], [ [ 0, 26, 36, 38, 48, 160 ], [ 0, 0, 10, 10, 20, 20 ] ] ], "tuples": [ [ 13, 0, 22, 7, 2, 1, 20, 22 ] ], "tupleFields": [ "identical", "ambiguousColumns", "columns", "mismatches", "gapColumns", "gapOpens", "readAligned", "referenceCovered" ], "variation": { "readAligned": { "shared": true, "min": 20, "max": 20 }, "referenceCovered": { "shared": true, "min": 22, "max": 22 }, "identity": { "shared": true, "min": { "numerator": 13, "denominator": 22 }, "max": { "numerator": 13, "denominator": 22 } }, "overhangStart": { "shared": true, "min": 0, "max": 0 }, "overhangEnd": { "shared": true, "min": 0, "max": 0 } }, "placements": [ { "refStart": 27, "refEnd": 48, "crossesOrigin": false, "wholeCircle": false, "readStart": 1, "readEnd": 20, "asSupplied": { "readStart": 1, "readEnd": 20 }, "alignments": 7, "band": { "diagonalMin": 26, "diagonalMax": 28, "cellsNeeded": 105, "bandLimited": false } } ] } }, { "mode": "local", "region": null, "strand": "+", "strandUndetermined": false, "plus": { "score": 40, "count": 2, "overCap": false, "state": "aligned", "biopython": { "score": 40, "count": 2 }, "uniquePairs": [], "uniquePlacement": false, "placementNotDetermined": false, "noCommonColumn": false, "hull": { "refStart": 41, "refEnd": 120, "crossesOrigin": false, "wholeCircle": false }, "selected": { "coordinates": [ [ 40, 60 ], [ 0, 20 ] ], "gappedReference": "TAATGTTCCGGCGTTATTTC", "gappedRead": "TAATGTTCCGGCGTTATTTC", "columns": 20, "identical": 20, "mismatches": 0, "ambiguousColumns": 0, "gapColumns": 0, "gapOpens": 0, "identity": { "numerator": 20, "denominator": 20 }, "readAligned": { "bases": 20, "of": 20 }, "referenceCovered": { "bases": 20, "of": 160 }, "placement": { "refStart": 41, "refEnd": 60, "readStart": 1, "readEnd": 20, "crossesOrigin": false }, "overhang": [], "differences": [] }, "band": { "diagonalMin": 40, "diagonalMax": 100, "cellsNeeded": 1323, "unionBandLimited": false, "scope": "every optimal path", "gridCells": 3381, "searchedBanded": false, "sharedWords": 18, "sharedWordsOverCap": false, "seedGuarantee": { "differencesUpTo": 0, "guaranteed": true } }, "enumeration": "listed", "alignments": [ [ [ 40, 60 ], [ 0, 20 ] ], [ [ 100, 120 ], [ 0, 20 ] ] ], "tuples": [ [ 20, 0, 20, 0, 0, 0, 20, 20 ] ], "tupleFields": [ "identical", "ambiguousColumns", "columns", "mismatches", "gapColumns", "gapOpens", "readAligned", "referenceCovered" ], "variation": { "readAligned": { "shared": true, "min": 20, "max": 20 }, "referenceCovered": { "shared": true, "min": 20, "max": 20 }, "identity": { "shared": true, "min": { "numerator": 1, "denominator": 1 }, "max": { "numerator": 1, "denominator": 1 } }, "overhangStart": { "shared": true, "min": 0, "max": 0 }, "overhangEnd": { "shared": true, "min": 0, "max": 0 } }, "placements": [ { "refStart": 41, "refEnd": 60, "crossesOrigin": false, "wholeCircle": false, "readStart": 1, "readEnd": 20, "alignments": 1, "band": { "diagonalMin": 40, "diagonalMax": 40, "cellsNeeded": 63, "bandLimited": false } }, { "refStart": 101, "refEnd": 120, "crossesOrigin": false, "wholeCircle": false, "readStart": 1, "readEnd": 20, "alignments": 1, "band": { "diagonalMin": 100, "diagonalMax": 100, "cellsNeeded": 63, "bandLimited": false } } ] }, "minus": { "score": 12, "count": 1, "overCap": false, "state": "aligned", "biopython": { "score": 12, "count": 1 }, "uniquePairs": [ [ 139, 11 ], [ 140, 12 ], [ 141, 13 ], [ 142, 14 ], [ 143, 15 ], [ 144, 16 ] ], "uniquePlacement": true, "placementNotDetermined": false, "noCommonColumn": false, "hull": { "refStart": 139, "refEnd": 144, "crossesOrigin": false, "wholeCircle": false }, "selected": { "coordinates": [ [ 138, 144 ], [ 10, 16 ] ], "gappedReference": "CGGAAC", "gappedRead": "CGGAAC", "columns": 6, "identical": 6, "mismatches": 0, "ambiguousColumns": 0, "gapColumns": 0, "gapOpens": 0, "identity": { "numerator": 6, "denominator": 6 }, "readAligned": { "bases": 6, "of": 20 }, "referenceCovered": { "bases": 6, "of": 160 }, "placement": { "refStart": 139, "refEnd": 144, "readStart": 11, "readEnd": 16, "crossesOrigin": false, "asSupplied": { "readStart": 5, "readEnd": 10 } }, "overhang": [], "differences": [] }, "band": { "diagonalMin": 128, "diagonalMax": 128, "cellsNeeded": 63, "unionBandLimited": false, "scope": "every optimal path", "gridCells": 3381, "searchedBanded": false, "sharedWords": 0, "sharedWordsOverCap": false, "seedGuarantee": { "differencesUpTo": 14, "guaranteed": false } }, "enumeration": "listed", "alignments": [ [ [ 138, 144 ], [ 10, 16 ] ] ], "tuples": [ [ 6, 0, 6, 0, 0, 0, 6, 6 ] ], "tupleFields": [ "identical", "ambiguousColumns", "columns", "mismatches", "gapColumns", "gapOpens", "readAligned", "referenceCovered" ], "variation": { "readAligned": { "shared": true, "min": 6, "max": 6 }, "referenceCovered": { "shared": true, "min": 6, "max": 6 }, "identity": { "shared": true, "min": { "numerator": 1, "denominator": 1 }, "max": { "numerator": 1, "denominator": 1 } }, "overhangStart": { "shared": true, "min": 0, "max": 0 }, "overhangEnd": { "shared": true, "min": 0, "max": 0 } }, "placements": [ { "refStart": 139, "refEnd": 144, "crossesOrigin": false, "wholeCircle": false, "readStart": 11, "readEnd": 16, "asSupplied": { "readStart": 5, "readEnd": 10 }, "alignments": 1, "band": { "diagonalMin": 128, "diagonalMax": 128, "cellsNeeded": 63, "bandLimited": false } } ] } } ] } }, { "id": "circular-origin", "note": "A circular reference (J01636.1 801-880 closed into a circle) and a read across its origin (its bases 71-80 then 1-14, base 12 of the read changed).", "input": { "reference": { "residues": "GATGCTGGTTGCCAACGATCAGATGGCGCTGGGCGCAATGCGCGCCATTACCGAGTCCGGGCTGCGCGTTGGTGCGGATA", "topology": "circular", "source": "J01636.1 801-880, circular" }, "read": { "residues": "GGTGCGGATAGCTGCTGGTTGCCA", "source": "reference bases 71-80 and 1-14, read base 12 changed" }, "modes": [ "semiglobal-read", "local" ] }, "expected": { "results": [ { "mode": "semiglobal-read", "region": null, "strand": "+", "strandUndetermined": false, "plus": { "score": 43, "count": 1, "overCap": false, "state": "aligned", "biopython": { "score": 43, "count": 1, "tailScore": 4, "tailCountSubtracted": 0, "certifiedText": { "extension": 24, "textLength": 127, "reruns": 0, "differencesUpTo": 2 } }, "uniquePairs": [ [ 71, 1 ], [ 72, 2 ], [ 73, 3 ], [ 74, 4 ], [ 75, 5 ], [ 76, 6 ], [ 77, 7 ], [ 78, 8 ], [ 79, 9 ], [ 80, 10 ], [ 1, 11 ], [ 2, 12 ], [ 3, 13 ], [ 4, 14 ], [ 5, 15 ], [ 6, 16 ], [ 7, 17 ], [ 8, 18 ], [ 9, 19 ], [ 10, 20 ], [ 11, 21 ], [ 12, 22 ], [ 13, 23 ], [ 14, 24 ] ], "uniquePlacement": true, "placementNotDetermined": false, "noCommonColumn": false, "hull": { "refStart": 71, "refEnd": 14, "crossesOrigin": true, "wholeCircle": false }, "selected": { "coordinates": [ [ 0, 70, 94 ], [ 0, 0, 24 ] ], "gappedReference": "GGTGCGGATAGATGCTGGTTGCCA", "gappedRead": "GGTGCGGATAGCTGCTGGTTGCCA", "columns": 24, "identical": 23, "mismatches": 1, "ambiguousColumns": 0, "gapColumns": 0, "gapOpens": 0, "identity": { "numerator": 23, "denominator": 24 }, "readAligned": { "bases": 24, "of": 24 }, "referenceCovered": { "bases": 24, "of": 80 }, "placement": { "refStart": 71, "refEnd": 14, "readStart": 1, "readEnd": 24, "crossesOrigin": true }, "overhang": [], "differences": [ { "kind": "substitution", "ref": 2, "refBase": "A", "readBase": "C", "read": 12, "common": true } ] }, "band": { "diagonalMin": 70, "diagonalMax": 70, "cellsNeeded": 75, "unionBandLimited": false, "scope": "every optimal path", "gridCells": 3200, "searchedBanded": false, "sharedWords": 1, "sharedWordsOverCap": false, "seedGuarantee": { "differencesUpTo": 2, "guaranteed": false } }, "enumeration": "listed", "alignments": [ [ [ 0, 70, 94 ], [ 0, 0, 24 ] ] ], "tuples": [ [ 23, 0, 24, 1, 0, 0, 24, 24 ] ], "tupleFields": [ "identical", "ambiguousColumns", "columns", "mismatches", "gapColumns", "gapOpens", "readAligned", "referenceCovered" ], "variation": { "readAligned": { "shared": true, "min": 24, "max": 24 }, "referenceCovered": { "shared": true, "min": 24, "max": 24 }, "identity": { "shared": true, "min": { "numerator": 23, "denominator": 24 }, "max": { "numerator": 23, "denominator": 24 } }, "overhangStart": { "shared": true, "min": 0, "max": 0 }, "overhangEnd": { "shared": true, "min": 0, "max": 0 } }, "placements": [ { "refStart": 71, "refEnd": 14, "crossesOrigin": true, "wholeCircle": false, "readStart": 1, "readEnd": 24, "alignments": 1, "band": { "diagonalMin": 70, "diagonalMax": 70, "cellsNeeded": 75, "bandLimited": false } } ] }, "minus": { "score": 1, "count": 3, "overCap": false, "state": "aligned", "biopython": { "score": 1, "count": 6, "tailScore": 1, "tailCountSubtracted": 3, "certifiedText": { "extension": 24, "textLength": 127, "reruns": 0, "differencesUpTo": 23 } }, "uniquePairs": [ [ 24, 1 ], [ 25, 2 ], [ 26, 3 ], [ 27, 4 ], [ 35, 13 ], [ 36, 14 ], [ 37, 15 ], [ 38, 16 ], [ 39, 17 ], [ 40, 18 ], [ 41, 19 ], [ 42, 20 ], [ 43, 21 ], [ 44, 22 ], [ 45, 23 ], [ 46, 24 ] ], "uniquePlacement": true, "placementNotDetermined": false, "noCommonColumn": false, "hull": { "refStart": 24, "refEnd": 46, "crossesOrigin": false, "wholeCircle": false }, "selected": { "coordinates": [ [ 0, 23, 27, 27, 46 ], [ 0, 0, 4, 5, 24 ] ], "gappedReference": "TGGC-GCTGGGCGCAATGCGCGCC", "gappedRead": "TGGCAACCAGCAGCTATCCGCACC", "columns": 24, "identical": 15, "mismatches": 8, "ambiguousColumns": 0, "gapColumns": 1, "gapOpens": 1, "identity": { "numerator": 15, "denominator": 24 }, "readAligned": { "bases": 24, "of": 24 }, "referenceCovered": { "bases": 23, "of": 80 }, "placement": { "refStart": 24, "refEnd": 46, "readStart": 1, "readEnd": 24, "crossesOrigin": false, "asSupplied": { "readStart": 1, "readEnd": 24 } }, "overhang": [], "differences": [ { "kind": "insertion", "refAfter": 27, "length": 1, "bases": "A", "readStart": 5, "readEnd": 5, "asSupplied": { "readStart": 20, "readEnd": 20, "bases": "T" }, "common": false, "notFixed": { "from": { "ref": 27, "read": 4, "readAsSupplied": 21 }, "to": { "ref": 35, "read": 13, "readAsSupplied": 12 } } }, { "kind": "substitution", "ref": 28, "refBase": "G", "readBase": "A", "read": 6, "common": false, "notFixed": { "from": { "ref": 27, "read": 4, "readAsSupplied": 21 }, "to": { "ref": 35, "read": 13, "readAsSupplied": 12 } }, "asSupplied": { "read": 19, "readBase": "T" } }, { "kind": "substitution", "ref": 30, "refBase": "T", "readBase": "C", "read": 8, "common": false, "notFixed": { "from": { "ref": 27, "read": 4, "readAsSupplied": 21 }, "to": { "ref": 35, "read": 13, "readAsSupplied": 12 } }, "asSupplied": { "read": 17, "readBase": "G" } }, { "kind": "substitution", "ref": 31, "refBase": "G", "readBase": "A", "read": 9, "common": false, "notFixed": { "from": { "ref": 27, "read": 4, "readAsSupplied": 21 }, "to": { "ref": 35, "read": 13, "readAsSupplied": 12 } }, "asSupplied": { "read": 16, "readBase": "T" } }, { "kind": "substitution", "ref": 33, "refBase": "G", "readBase": "C", "read": 11, "common": false, "notFixed": { "from": { "ref": 27, "read": 4, "readAsSupplied": 21 }, "to": { "ref": 35, "read": 13, "readAsSupplied": 12 } }, "asSupplied": { "read": 14, "readBase": "G" } }, { "kind": "substitution", "ref": 34, "refBase": "C", "readBase": "A", "read": 12, "common": false, "notFixed": { "from": { "ref": 27, "read": 4, "readAsSupplied": 21 }, "to": { "ref": 35, "read": 13, "readAsSupplied": 12 } }, "asSupplied": { "read": 13, "readBase": "T" } }, { "kind": "substitution", "ref": 37, "refBase": "A", "readBase": "T", "read": 15, "common": true, "asSupplied": { "read": 10, "readBase": "A" } }, { "kind": "substitution", "ref": 40, "refBase": "G", "readBase": "C", "read": 18, "common": true, "asSupplied": { "read": 7, "readBase": "G" } }, { "kind": "substitution", "ref": 44, "refBase": "G", "readBase": "A", "read": 22, "common": true, "asSupplied": { "read": 3, "readBase": "T" } } ] }, "band": { "diagonalMin": 22, "diagonalMax": 23, "cellsNeeded": 100, "unionBandLimited": false, "scope": "every optimal path", "gridCells": 3200, "searchedBanded": false, "sharedWords": 0, "sharedWordsOverCap": false, "seedGuarantee": { "differencesUpTo": 23, "guaranteed": false } }, "enumeration": "listed", "alignments": [ [ [ 0, 23, 27, 27, 46 ], [ 0, 0, 4, 5, 24 ] ], [ [ 0, 23, 28, 28, 46 ], [ 0, 0, 5, 6, 24 ] ], [ [ 0, 23, 34, 34, 46 ], [ 0, 0, 11, 12, 24 ] ] ], "tuples": [ [ 15, 0, 24, 8, 1, 1, 24, 23 ] ], "tupleFields": [ "identical", "ambiguousColumns", "columns", "mismatches", "gapColumns", "gapOpens", "readAligned", "referenceCovered" ], "variation": { "readAligned": { "shared": true, "min": 24, "max": 24 }, "referenceCovered": { "shared": true, "min": 23, "max": 23 }, "identity": { "shared": true, "min": { "numerator": 5, "denominator": 8 }, "max": { "numerator": 5, "denominator": 8 } }, "overhangStart": { "shared": true, "min": 0, "max": 0 }, "overhangEnd": { "shared": true, "min": 0, "max": 0 } }, "placements": [ { "refStart": 24, "refEnd": 46, "crossesOrigin": false, "wholeCircle": false, "readStart": 1, "readEnd": 24, "asSupplied": { "readStart": 1, "readEnd": 24 }, "alignments": 3, "band": { "diagonalMin": 22, "diagonalMax": 23, "cellsNeeded": 100, "bandLimited": false } } ] } }, { "mode": "local", "region": null, "strand": "+", "strandUndetermined": false, "plus": { "score": 43, "count": 1, "overCap": false, "state": "aligned", "biopython": { "score": 43, "count": 1, "tailScore": 24, "tailCountSubtracted": 0, "certifiedText": { "extension": 24, "textLength": 127, "reruns": 0, "differencesUpTo": 2 } }, "uniquePairs": [ [ 71, 1 ], [ 72, 2 ], [ 73, 3 ], [ 74, 4 ], [ 75, 5 ], [ 76, 6 ], [ 77, 7 ], [ 78, 8 ], [ 79, 9 ], [ 80, 10 ], [ 1, 11 ], [ 2, 12 ], [ 3, 13 ], [ 4, 14 ], [ 5, 15 ], [ 6, 16 ], [ 7, 17 ], [ 8, 18 ], [ 9, 19 ], [ 10, 20 ], [ 11, 21 ], [ 12, 22 ], [ 13, 23 ], [ 14, 24 ] ], "uniquePlacement": true, "placementNotDetermined": false, "noCommonColumn": false, "hull": { "refStart": 71, "refEnd": 14, "crossesOrigin": true, "wholeCircle": false }, "selected": { "coordinates": [ [ 70, 94 ], [ 0, 24 ] ], "gappedReference": "GGTGCGGATAGATGCTGGTTGCCA", "gappedRead": "GGTGCGGATAGCTGCTGGTTGCCA", "columns": 24, "identical": 23, "mismatches": 1, "ambiguousColumns": 0, "gapColumns": 0, "gapOpens": 0, "identity": { "numerator": 23, "denominator": 24 }, "readAligned": { "bases": 24, "of": 24 }, "referenceCovered": { "bases": 24, "of": 80 }, "placement": { "refStart": 71, "refEnd": 14, "readStart": 1, "readEnd": 24, "crossesOrigin": true }, "overhang": [], "differences": [ { "kind": "substitution", "ref": 2, "refBase": "A", "readBase": "C", "read": 12, "common": true } ] }, "band": { "diagonalMin": 70, "diagonalMax": 70, "cellsNeeded": 75, "unionBandLimited": false, "scope": "every optimal path", "gridCells": 3200, "searchedBanded": false, "sharedWords": 1, "sharedWordsOverCap": false, "seedGuarantee": { "differencesUpTo": 2, "guaranteed": false } }, "enumeration": "listed", "alignments": [ [ [ 70, 94 ], [ 0, 24 ] ] ], "tuples": [ [ 23, 0, 24, 1, 0, 0, 24, 24 ] ], "tupleFields": [ "identical", "ambiguousColumns", "columns", "mismatches", "gapColumns", "gapOpens", "readAligned", "referenceCovered" ], "variation": { "readAligned": { "shared": true, "min": 24, "max": 24 }, "referenceCovered": { "shared": true, "min": 24, "max": 24 }, "identity": { "shared": true, "min": { "numerator": 23, "denominator": 24 }, "max": { "numerator": 23, "denominator": 24 } }, "overhangStart": { "shared": true, "min": 0, "max": 0 }, "overhangEnd": { "shared": true, "min": 0, "max": 0 } }, "placements": [ { "refStart": 71, "refEnd": 14, "crossesOrigin": true, "wholeCircle": false, "readStart": 1, "readEnd": 24, "alignments": 1, "band": { "diagonalMin": 70, "diagonalMax": 70, "cellsNeeded": 75, "bandLimited": false } } ] }, "minus": { "score": 11, "count": 1, "overCap": false, "state": "aligned", "biopython": { "score": 11, "count": 2, "tailScore": 11, "tailCountSubtracted": 1, "certifiedText": { "extension": 24, "textLength": 127, "reruns": 0, "differencesUpTo": 18 } }, "uniquePairs": [ [ 10, 1 ], [ 11, 2 ], [ 12, 3 ], [ 13, 4 ], [ 14, 5 ], [ 15, 6 ], [ 16, 7 ], [ 17, 8 ], [ 18, 9 ], [ 19, 10 ], [ 20, 11 ], [ 21, 12 ], [ 22, 13 ] ], "uniquePlacement": true, "placementNotDetermined": false, "noCommonColumn": false, "hull": { "refStart": 10, "refEnd": 22, "crossesOrigin": false, "wholeCircle": false }, "selected": { "coordinates": [ [ 9, 22 ], [ 0, 13 ] ], "gappedReference": "TGCCAACGATCAG", "gappedRead": "TGGCAACCAGCAG", "columns": 13, "identical": 10, "mismatches": 3, "ambiguousColumns": 0, "gapColumns": 0, "gapOpens": 0, "identity": { "numerator": 10, "denominator": 13 }, "readAligned": { "bases": 13, "of": 24 }, "referenceCovered": { "bases": 13, "of": 80 }, "placement": { "refStart": 10, "refEnd": 22, "readStart": 1, "readEnd": 13, "crossesOrigin": false, "asSupplied": { "readStart": 12, "readEnd": 24 } }, "overhang": [], "differences": [ { "kind": "substitution", "ref": 12, "refBase": "C", "readBase": "G", "read": 3, "common": true, "asSupplied": { "read": 22, "readBase": "C" } }, { "kind": "substitution", "ref": 17, "refBase": "G", "readBase": "C", "read": 8, "common": true, "asSupplied": { "read": 17, "readBase": "G" } }, { "kind": "substitution", "ref": 19, "refBase": "T", "readBase": "G", "read": 10, "common": true, "asSupplied": { "read": 15, "readBase": "C" } } ] }, "band": { "diagonalMin": 9, "diagonalMax": 9, "cellsNeeded": 75, "unionBandLimited": false, "scope": "every optimal path", "gridCells": 3200, "searchedBanded": false, "sharedWords": 0, "sharedWordsOverCap": false, "seedGuarantee": { "differencesUpTo": 18, "guaranteed": false } }, "enumeration": "listed", "alignments": [ [ [ 9, 22 ], [ 0, 13 ] ] ], "tuples": [ [ 10, 0, 13, 3, 0, 0, 13, 13 ] ], "tupleFields": [ "identical", "ambiguousColumns", "columns", "mismatches", "gapColumns", "gapOpens", "readAligned", "referenceCovered" ], "variation": { "readAligned": { "shared": true, "min": 13, "max": 13 }, "referenceCovered": { "shared": true, "min": 13, "max": 13 }, "identity": { "shared": true, "min": { "numerator": 10, "denominator": 13 }, "max": { "numerator": 10, "denominator": 13 } }, "overhangStart": { "shared": true, "min": 0, "max": 0 }, "overhangEnd": { "shared": true, "min": 0, "max": 0 } }, "placements": [ { "refStart": 10, "refEnd": 22, "crossesOrigin": false, "wholeCircle": false, "readStart": 1, "readEnd": 13, "asSupplied": { "readStart": 12, "readEnd": 24 }, "alignments": 1, "band": { "diagonalMin": 9, "diagonalMax": 9, "cellsNeeded": 75, "bandLimited": false } } ] } } ] } }, { "id": "rna-read", "note": "A read declared RNA: its U is read as T.", "input": { "reference": { "residues": "GGATTTTCGCCTGCTGGGGCAAACCAGCGTGGACCGCTTGCTGCAACTCTCTCAGGGCCAGGCGGTGAAGGGCAATCAGCTGTTGCCCGTCTCACTGGTGAAAAGAAAAACCACCCTGGCGCCCAATACGCAAACCGCCTCTCCCCGCGC", "topology": "linear", "source": "J01636.1 951-1100" }, "read": { "residues": "CUCAGGGCCAGGCGGUGAAGGGCAAUCAGCUGUUGCCCGU", "alphabet": "rna", "source": "J01636.1 1001-1040 as RNA" }, "modes": [ "semiglobal-read" ] }, "expected": { "results": [ { "mode": "semiglobal-read", "region": null, "strand": "+", "strandUndetermined": false, "plus": { "score": 80, "count": 1, "overCap": false, "state": "aligned", "biopython": { "score": 80, "count": 1 }, "uniquePairs": [ [ 51, 1 ], [ 52, 2 ], [ 53, 3 ], [ 54, 4 ], [ 55, 5 ], [ 56, 6 ], [ 57, 7 ], [ 58, 8 ], [ 59, 9 ], [ 60, 10 ], [ 61, 11 ], [ 62, 12 ], [ 63, 13 ], [ 64, 14 ], [ 65, 15 ], [ 66, 16 ], [ 67, 17 ], [ 68, 18 ], [ 69, 19 ], [ 70, 20 ], [ 71, 21 ], [ 72, 22 ], [ 73, 23 ], [ 74, 24 ], [ 75, 25 ], [ 76, 26 ], [ 77, 27 ], [ 78, 28 ], [ 79, 29 ], [ 80, 30 ], [ 81, 31 ], [ 82, 32 ], [ 83, 33 ], [ 84, 34 ], [ 85, 35 ], [ 86, 36 ], [ 87, 37 ], [ 88, 38 ], [ 89, 39 ], [ 90, 40 ] ], "uniquePlacement": true, "placementNotDetermined": false, "noCommonColumn": false, "hull": { "refStart": 51, "refEnd": 90, "crossesOrigin": false, "wholeCircle": false }, "selected": { "coordinates": [ [ 0, 50, 90, 150 ], [ 0, 0, 40, 40 ] ], "gappedReference": "CTCAGGGCCAGGCGGTGAAGGGCAATCAGCTGTTGCCCGT", "gappedRead": "CTCAGGGCCAGGCGGTGAAGGGCAATCAGCTGTTGCCCGT", "columns": 40, "identical": 40, "mismatches": 0, "ambiguousColumns": 0, "gapColumns": 0, "gapOpens": 0, "identity": { "numerator": 40, "denominator": 40 }, "readAligned": { "bases": 40, "of": 40 }, "referenceCovered": { "bases": 40, "of": 150 }, "placement": { "refStart": 51, "refEnd": 90, "readStart": 1, "readEnd": 40, "crossesOrigin": false }, "overhang": [], "differences": [] }, "band": { "diagonalMin": 50, "diagonalMax": 50, "cellsNeeded": 123, "unionBandLimited": false, "scope": "every optimal path", "gridCells": 6191, "searchedBanded": false, "sharedWords": 29, "sharedWordsOverCap": false, "seedGuarantee": { "differencesUpTo": 0, "guaranteed": true } }, "enumeration": "listed", "alignments": [ [ [ 0, 50, 90, 150 ], [ 0, 0, 40, 40 ] ] ], "tuples": [ [ 40, 0, 40, 0, 0, 0, 40, 40 ] ], "tupleFields": [ "identical", "ambiguousColumns", "columns", "mismatches", "gapColumns", "gapOpens", "readAligned", "referenceCovered" ], "variation": { "readAligned": { "shared": true, "min": 40, "max": 40 }, "referenceCovered": { "shared": true, "min": 40, "max": 40 }, "identity": { "shared": true, "min": { "numerator": 1, "denominator": 1 }, "max": { "numerator": 1, "denominator": 1 } }, "overhangStart": { "shared": true, "min": 0, "max": 0 }, "overhangEnd": { "shared": true, "min": 0, "max": 0 } }, "placements": [ { "refStart": 51, "refEnd": 90, "crossesOrigin": false, "wholeCircle": false, "readStart": 1, "readEnd": 40, "alignments": 1, "band": { "diagonalMin": 50, "diagonalMax": 50, "cellsNeeded": 123, "bandLimited": false } } ] }, "minus": { "score": 17, "count": 2, "overCap": false, "state": "aligned", "biopython": { "score": 17, "count": 2 }, "uniquePairs": [ [ 68, 1 ], [ 69, 2 ], [ 70, 3 ], [ 71, 4 ], [ 72, 5 ], [ 73, 6 ], [ 74, 7 ], [ 75, 8 ], [ 77, 9 ], [ 78, 10 ], [ 79, 11 ], [ 80, 12 ], [ 81, 13 ], [ 82, 14 ], [ 83, 16 ], [ 84, 17 ], [ 85, 18 ], [ 86, 19 ], [ 87, 20 ], [ 88, 21 ], [ 89, 22 ], [ 90, 23 ], [ 91, 24 ], [ 92, 25 ], [ 93, 26 ], [ 95, 30 ], [ 96, 31 ], [ 97, 32 ], [ 98, 33 ], [ 99, 37 ], [ 100, 38 ], [ 101, 39 ], [ 102, 40 ] ], "uniquePlacement": true, "placementNotDetermined": false, "noCommonColumn": false, "hull": { "refStart": 68, "refEnd": 102, "crossesOrigin": false, "wholeCircle": false }, "selected": { "coordinates": [ [ 0, 67, 75, 76, 82, 82, 93, 93, 98, 98, 102, 150 ], [ 0, 0, 8, 8, 14, 15, 26, 28, 33, 36, 40, 40 ] ], "gappedReference": "AAGGGCAATCAGCTG-TTGCCCGTCTC--ACTGG---TGAA", "gappedRead": "ACGGGCAA-CAGCTGATTGCCCTTCACCGCCTGGCCCTGAG", "columns": 41, "identical": 29, "mismatches": 5, "ambiguousColumns": 0, "gapColumns": 7, "gapOpens": 4, "identity": { "numerator": 29, "denominator": 41 }, "readAligned": { "bases": 40, "of": 40 }, "referenceCovered": { "bases": 35, "of": 150 }, "placement": { "refStart": 68, "refEnd": 102, "readStart": 1, "readEnd": 40, "crossesOrigin": false, "asSupplied": { "readStart": 1, "readEnd": 40 } }, "overhang": [], "differences": [ { "kind": "substitution", "ref": 69, "refBase": "A", "readBase": "C", "read": 2, "common": true, "asSupplied": { "read": 39, "readBase": "G" } }, { "kind": "deletion", "refStart": 76, "refEnd": 76, "length": 1, "bases": "T", "readAfter": 8, "asSupplied": { "readBetween": [ 32, 33 ] }, "common": true }, { "kind": "insertion", "refAfter": 82, "length": 1, "bases": "A", "readStart": 15, "readEnd": 15, "asSupplied": { "readStart": 26, "readEnd": 26, "bases": "T" }, "common": true }, { "kind": "substitution", "ref": 89, "refBase": "G", "readBase": "T", "read": 22, "common": true, "asSupplied": { "read": 19, "readBase": "A" } }, { "kind": "substitution", "ref": 92, "refBase": "T", "readBase": "A", "read": 25, "common": true, "asSupplied": { "read": 16, "readBase": "T" } }, { "kind": "insertion", "refAfter": 93, "length": 2, "bases": "CG", "readStart": 27, "readEnd": 28, "asSupplied": { "readStart": 13, "readEnd": 14, "bases": "CG" }, "common": false, "notFixed": { "from": { "ref": 93, "read": 26, "readAsSupplied": 15 }, "to": { "ref": 95, "read": 30, "readAsSupplied": 11 } } }, { "kind": "substitution", "ref": 94, "refBase": "A", "readBase": "C", "read": 29, "common": false, "notFixed": { "from": { "ref": 93, "read": 26, "readAsSupplied": 15 }, "to": { "ref": 95, "read": 30, "readAsSupplied": 11 } }, "asSupplied": { "read": 12, "readBase": "G" } }, { "kind": "insertion", "refAfter": 98, "length": 3, "bases": "CCC", "readStart": 34, "readEnd": 36, "asSupplied": { "readStart": 5, "readEnd": 7, "bases": "GGG" }, "common": true }, { "kind": "substitution", "ref": 102, "refBase": "A", "readBase": "G", "read": 40, "common": true, "asSupplied": { "read": 1, "readBase": "C" } } ] }, "band": { "diagonalMin": 62, "diagonalMax": 68, "cellsNeeded": 369, "unionBandLimited": false, "scope": "every optimal path", "gridCells": 6191, "searchedBanded": false, "sharedWords": 0, "sharedWordsOverCap": false, "seedGuarantee": { "differencesUpTo": 31, "guaranteed": false } }, "enumeration": "listed", "alignments": [ [ [ 0, 67, 75, 76, 82, 82, 93, 93, 98, 98, 102, 150 ], [ 0, 0, 8, 8, 14, 15, 26, 28, 33, 36, 40, 40 ] ], [ [ 0, 67, 75, 76, 82, 82, 94, 94, 98, 98, 102, 150 ], [ 0, 0, 8, 8, 14, 15, 27, 29, 33, 36, 40, 40 ] ] ], "tuples": [ [ 29, 0, 41, 5, 7, 4, 40, 35 ] ], "tupleFields": [ "identical", "ambiguousColumns", "columns", "mismatches", "gapColumns", "gapOpens", "readAligned", "referenceCovered" ], "variation": { "readAligned": { "shared": true, "min": 40, "max": 40 }, "referenceCovered": { "shared": true, "min": 35, "max": 35 }, "identity": { "shared": true, "min": { "numerator": 29, "denominator": 41 }, "max": { "numerator": 29, "denominator": 41 } }, "overhangStart": { "shared": true, "min": 0, "max": 0 }, "overhangEnd": { "shared": true, "min": 0, "max": 0 } }, "placements": [ { "refStart": 68, "refEnd": 102, "crossesOrigin": false, "wholeCircle": false, "readStart": 1, "readEnd": 40, "asSupplied": { "readStart": 1, "readEnd": 40 }, "alignments": 2, "band": { "diagonalMin": 62, "diagonalMax": 68, "cellsNeeded": 369, "bandLimited": false } } ] } } ] } }, { "id": "designs-global", "note": "Two 40-base designs end to end: a substitution, a 2-base deletion and a 2-base insertion.", "input": { "reference": { "residues": "GTTGGCCGATTCATTAATGCAGCTGGCACGACAGGTTTCC", "topology": "linear", "source": "J01636.1 1101-1140" }, "read": { "residues": "GTTGGCCGAATCATTAATGCAGCTCACGACGAAGGTTTCC", "source": "the same with base 10 changed, bases 25-26 removed and GA inserted after base 32" }, "modes": [ "global", "local" ] }, "expected": { "results": [ { "mode": "global", "region": null, "strand": "+", "strandUndetermined": false, "plus": { "score": 57, "count": 1, "overCap": false, "state": "aligned", "biopython": { "score": 57, "count": 1 }, "uniquePairs": [ [ 1, 1 ], [ 2, 2 ], [ 3, 3 ], [ 4, 4 ], [ 5, 5 ], [ 6, 6 ], [ 7, 7 ], [ 8, 8 ], [ 9, 9 ], [ 10, 10 ], [ 11, 11 ], [ 12, 12 ], [ 13, 13 ], [ 14, 14 ], [ 15, 15 ], [ 16, 16 ], [ 17, 17 ], [ 18, 18 ], [ 19, 19 ], [ 20, 20 ], [ 21, 21 ], [ 22, 22 ], [ 23, 23 ], [ 24, 24 ], [ 27, 25 ], [ 28, 26 ], [ 29, 27 ], [ 30, 28 ], [ 31, 29 ], [ 32, 30 ], [ 33, 33 ], [ 34, 34 ], [ 35, 35 ], [ 36, 36 ], [ 37, 37 ], [ 38, 38 ], [ 39, 39 ], [ 40, 40 ] ], "uniquePlacement": true, "placementNotDetermined": false, "noCommonColumn": false, "hull": { "refStart": 1, "refEnd": 40, "crossesOrigin": false, "wholeCircle": false }, "selected": { "coordinates": [ [ 0, 24, 26, 32, 32, 40 ], [ 0, 24, 24, 30, 32, 40 ] ], "gappedReference": "GTTGGCCGATTCATTAATGCAGCTGGCACGAC--AGGTTTCC", "gappedRead": "GTTGGCCGAATCATTAATGCAGCT--CACGACGAAGGTTTCC", "columns": 42, "identical": 37, "mismatches": 1, "ambiguousColumns": 0, "gapColumns": 4, "gapOpens": 2, "identity": { "numerator": 37, "denominator": 42 }, "readAligned": { "bases": 40, "of": 40 }, "referenceCovered": { "bases": 40, "of": 40 }, "placement": { "refStart": 1, "refEnd": 40, "readStart": 1, "readEnd": 40, "crossesOrigin": false }, "overhang": [], "differences": [ { "kind": "substitution", "ref": 10, "refBase": "T", "readBase": "A", "read": 10, "common": true }, { "kind": "deletion", "refStart": 25, "refEnd": 26, "length": 2, "bases": "GG", "readAfter": 24, "common": true }, { "kind": "insertion", "refAfter": 32, "length": 2, "bases": "GA", "readStart": 31, "readEnd": 32, "common": true } ] }, "band": { "diagonalMin": 0, "diagonalMax": 2, "cellsNeeded": 198, "unionBandLimited": false, "scope": "every optimal path", "gridCells": 1681, "searchedBanded": false, "sharedWords": 3, "sharedWordsOverCap": false, "seedGuarantee": { "differencesUpTo": 11, "guaranteed": false } }, "enumeration": "listed", "alignments": [ [ [ 0, 24, 26, 32, 32, 40 ], [ 0, 24, 24, 30, 32, 40 ] ] ], "tuples": [ [ 37, 0, 42, 1, 4, 2, 40, 40 ] ], "tupleFields": [ "identical", "ambiguousColumns", "columns", "mismatches", "gapColumns", "gapOpens", "readAligned", "referenceCovered" ], "variation": { "readAligned": { "shared": true, "min": 40, "max": 40 }, "referenceCovered": { "shared": true, "min": 40, "max": 40 }, "identity": { "shared": true, "min": { "numerator": 37, "denominator": 42 }, "max": { "numerator": 37, "denominator": 42 } }, "overhangStart": { "shared": true, "min": 0, "max": 0 }, "overhangEnd": { "shared": true, "min": 0, "max": 0 } }, "placements": [ { "refStart": 1, "refEnd": 40, "crossesOrigin": false, "wholeCircle": false, "readStart": 1, "readEnd": 40, "alignments": 1, "band": { "diagonalMin": 0, "diagonalMax": 2, "cellsNeeded": 198, "bandLimited": false } } ] }, "minus": { "score": -29, "count": 10, "overCap": false, "state": "aligned", "biopython": { "score": -29, "count": 10 }, "uniquePairs": [ [ 1, 1 ], [ 2, 2 ], [ 3, 3 ], [ 4, 4 ], [ 5, 5 ], [ 6, 6 ], [ 7, 7 ], [ 10, 8 ], [ 11, 9 ], [ 12, 10 ], [ 18, 15 ], [ 19, 16 ], [ 21, 17 ], [ 22, 18 ], [ 23, 19 ], [ 24, 20 ], [ 27, 22 ], [ 28, 23 ], [ 29, 24 ], [ 30, 25 ], [ 31, 26 ], [ 33, 27 ], [ 34, 28 ], [ 35, 29 ], [ 36, 30 ], [ 37, 31 ], [ 38, 32 ], [ 39, 33 ], [ 40, 40 ] ], "uniquePlacement": true, "placementNotDetermined": false, "noCommonColumn": false, "hull": { "refStart": 1, "refEnd": 40, "crossesOrigin": false, "wholeCircle": false }, "selected": { "coordinates": [ [ 0, 7, 9, 12, 13, 19, 20, 24, 25, 31, 32, 39, 39, 40 ], [ 0, 7, 7, 10, 10, 16, 16, 20, 20, 26, 26, 33, 39, 40 ] ], "gappedReference": "GTTGGCCGATTCATTAATGCAGCTGGCACGACAGGTTTC------C", "gappedRead": "GGAAACC--TTC-GTCGTG-AGCT-GCATTA-ATGATTCGGCCAAC", "columns": 46, "identical": 23, "mismatches": 11, "ambiguousColumns": 0, "gapColumns": 12, "gapOpens": 6, "identity": { "numerator": 23, "denominator": 46 }, "readAligned": { "bases": 40, "of": 40 }, "referenceCovered": { "bases": 40, "of": 40 }, "placement": { "refStart": 1, "refEnd": 40, "readStart": 1, "readEnd": 40, "crossesOrigin": false, "asSupplied": { "readStart": 1, "readEnd": 40 } }, "overhang": [], "differences": [ { "kind": "substitution", "ref": 2, "refBase": "T", "readBase": "G", "read": 2, "common": true, "asSupplied": { "read": 39, "readBase": "C" } }, { "kind": "substitution", "ref": 3, "refBase": "T", "readBase": "A", "read": 3, "common": true, "asSupplied": { "read": 38, "readBase": "T" } }, { "kind": "substitution", "ref": 4, "refBase": "G", "readBase": "A", "read": 4, "common": true, "asSupplied": { "read": 37, "readBase": "T" } }, { "kind": "substitution", "ref": 5, "refBase": "G", "readBase": "A", "read": 5, "common": true, "asSupplied": { "read": 36, "readBase": "T" } }, { "kind": "deletion", "refStart": 8, "refEnd": 9, "length": 2, "bases": "GA", "readAfter": 7, "asSupplied": { "readBetween": [ 33, 34 ] }, "common": true }, { "kind": "deletion", "refStart": 13, "refEnd": 13, "length": 1, "bases": "A", "readAfter": 10, "asSupplied": { "readBetween": [ 30, 31 ] }, "common": false, "notFixed": { "from": { "ref": 12, "read": 10, "readAsSupplied": 31 }, "to": { "ref": 18, "read": 15, "readAsSupplied": 26 } } }, { "kind": "substitution", "ref": 14, "refBase": "T", "readBase": "G", "read": 11, "common": false, "notFixed": { "from": { "ref": 12, "read": 10, "readAsSupplied": 31 }, "to": { "ref": 18, "read": 15, "readAsSupplied": 26 } }, "asSupplied": { "read": 30, "readBase": "C" } }, { "kind": "substitution", "ref": 16, "refBase": "A", "readBase": "C", "read": 13, "common": false, "notFixed": { "from": { "ref": 12, "read": 10, "readAsSupplied": 31 }, "to": { "ref": 18, "read": 15, "readAsSupplied": 26 } }, "asSupplied": { "read": 28, "readBase": "G" } }, { "kind": "substitution", "ref": 17, "refBase": "A", "readBase": "G", "read": 14, "common": false, "notFixed": { "from": { "ref": 12, "read": 10, "readAsSupplied": 31 }, "to": { "ref": 18, "read": 15, "readAsSupplied": 26 } }, "asSupplied": { "read": 27, "readBase": "C" } }, { "kind": "deletion", "refStart": 20, "refEnd": 20, "length": 1, "bases": "C", "readAfter": 16, "asSupplied": { "readBetween": [ 24, 25 ] }, "common": true }, { "kind": "deletion", "refStart": 25, "refEnd": 25, "length": 1, "bases": "G", "readAfter": 20, "asSupplied": { "readBetween": [ 20, 21 ] }, "common": false, "notFixed": { "from": { "ref": 24, "read": 20, "readAsSupplied": 21 }, "to": { "ref": 27, "read": 22, "readAsSupplied": 19 } } }, { "kind": "substitution", "ref": 29, "refBase": "C", "readBase": "T", "read": 24, "common": true, "asSupplied": { "read": 17, "readBase": "A" } }, { "kind": "substitution", "ref": 30, "refBase": "G", "readBase": "T", "read": 25, "common": true, "asSupplied": { "read": 16, "readBase": "A" } }, { "kind": "deletion", "refStart": 32, "refEnd": 32, "length": 1, "bases": "C", "readAfter": 26, "asSupplied": { "readBetween": [ 14, 15 ] }, "common": true }, { "kind": "substitution", "ref": 34, "refBase": "G", "readBase": "T", "read": 28, "common": true, "asSupplied": { "read": 13, "readBase": "A" } }, { "kind": "substitution", "ref": 36, "refBase": "T", "readBase": "A", "read": 30, "common": true, "asSupplied": { "read": 11, "readBase": "T" } }, { "kind": "insertion", "refAfter": 39, "length": 6, "bases": "GGCCAA", "readStart": 34, "readEnd": 39, "asSupplied": { "readStart": 2, "readEnd": 7, "bases": "TTGGCC" }, "common": true } ] }, "band": { "diagonalMin": 0, "diagonalMax": 6, "cellsNeeded": 340, "unionBandLimited": false, "scope": "every optimal path", "gridCells": 1681, "searchedBanded": false, "sharedWords": 0, "sharedWordsOverCap": false, "seedGuarantee": { "differencesUpTo": 54, "guaranteed": false } }, "enumeration": "listed", "alignments": [ [ [ 0, 7, 9, 12, 13, 19, 20, 24, 25, 31, 32, 39, 39, 40 ], [ 0, 7, 7, 10, 10, 16, 16, 20, 20, 26, 26, 33, 39, 40 ] ], [ [ 0, 7, 9, 13, 14, 19, 20, 24, 25, 31, 32, 39, 39, 40 ], [ 0, 7, 7, 11, 11, 16, 16, 20, 20, 26, 26, 33, 39, 40 ] ], [ [ 0, 7, 9, 14, 15, 19, 20, 24, 25, 31, 32, 39, 39, 40 ], [ 0, 7, 7, 12, 12, 16, 16, 20, 20, 26, 26, 33, 39, 40 ] ], [ [ 0, 7, 9, 15, 16, 19, 20, 24, 25, 31, 32, 39, 39, 40 ], [ 0, 7, 7, 13, 13, 16, 16, 20, 20, 26, 26, 33, 39, 40 ] ], [ [ 0, 7, 9, 16, 17, 19, 20, 24, 25, 31, 32, 39, 39, 40 ], [ 0, 7, 7, 14, 14, 16, 16, 20, 20, 26, 26, 33, 39, 40 ] ], [ [ 0, 7, 9, 12, 13, 19, 20, 25, 26, 31, 32, 39, 39, 40 ], [ 0, 7, 7, 10, 10, 16, 16, 21, 21, 26, 26, 33, 39, 40 ] ], [ [ 0, 7, 9, 13, 14, 19, 20, 25, 26, 31, 32, 39, 39, 40 ], [ 0, 7, 7, 11, 11, 16, 16, 21, 21, 26, 26, 33, 39, 40 ] ], [ [ 0, 7, 9, 14, 15, 19, 20, 25, 26, 31, 32, 39, 39, 40 ], [ 0, 7, 7, 12, 12, 16, 16, 21, 21, 26, 26, 33, 39, 40 ] ], [ [ 0, 7, 9, 15, 16, 19, 20, 25, 26, 31, 32, 39, 39, 40 ], [ 0, 7, 7, 13, 13, 16, 16, 21, 21, 26, 26, 33, 39, 40 ] ], [ [ 0, 7, 9, 16, 17, 19, 20, 25, 26, 31, 32, 39, 39, 40 ], [ 0, 7, 7, 14, 14, 16, 16, 21, 21, 26, 26, 33, 39, 40 ] ] ], "tuples": [ [ 23, 0, 46, 11, 12, 6, 40, 40 ] ], "tupleFields": [ "identical", "ambiguousColumns", "columns", "mismatches", "gapColumns", "gapOpens", "readAligned", "referenceCovered" ], "variation": { "readAligned": { "shared": true, "min": 40, "max": 40 }, "referenceCovered": { "shared": true, "min": 40, "max": 40 }, "identity": { "shared": true, "min": { "numerator": 1, "denominator": 2 }, "max": { "numerator": 1, "denominator": 2 } }, "overhangStart": { "shared": true, "min": 0, "max": 0 }, "overhangEnd": { "shared": true, "min": 0, "max": 0 } }, "placements": [ { "refStart": 1, "refEnd": 40, "crossesOrigin": false, "wholeCircle": false, "readStart": 1, "readEnd": 40, "asSupplied": { "readStart": 1, "readEnd": 40 }, "alignments": 10, "band": { "diagonalMin": 0, "diagonalMax": 6, "cellsNeeded": 340, "bandLimited": false } } ] } }, { "mode": "local", "region": null, "strand": "+", "strandUndetermined": false, "plus": { "score": 57, "count": 1, "overCap": false, "state": "aligned", "biopython": { "score": 57, "count": 1 }, "uniquePairs": [ [ 1, 1 ], [ 2, 2 ], [ 3, 3 ], [ 4, 4 ], [ 5, 5 ], [ 6, 6 ], [ 7, 7 ], [ 8, 8 ], [ 9, 9 ], [ 10, 10 ], [ 11, 11 ], [ 12, 12 ], [ 13, 13 ], [ 14, 14 ], [ 15, 15 ], [ 16, 16 ], [ 17, 17 ], [ 18, 18 ], [ 19, 19 ], [ 20, 20 ], [ 21, 21 ], [ 22, 22 ], [ 23, 23 ], [ 24, 24 ], [ 27, 25 ], [ 28, 26 ], [ 29, 27 ], [ 30, 28 ], [ 31, 29 ], [ 32, 30 ], [ 33, 33 ], [ 34, 34 ], [ 35, 35 ], [ 36, 36 ], [ 37, 37 ], [ 38, 38 ], [ 39, 39 ], [ 40, 40 ] ], "uniquePlacement": true, "placementNotDetermined": false, "noCommonColumn": false, "hull": { "refStart": 1, "refEnd": 40, "crossesOrigin": false, "wholeCircle": false }, "selected": { "coordinates": [ [ 0, 24, 26, 32, 32, 40 ], [ 0, 24, 24, 30, 32, 40 ] ], "gappedReference": "GTTGGCCGATTCATTAATGCAGCTGGCACGAC--AGGTTTCC", "gappedRead": "GTTGGCCGAATCATTAATGCAGCT--CACGACGAAGGTTTCC", "columns": 42, "identical": 37, "mismatches": 1, "ambiguousColumns": 0, "gapColumns": 4, "gapOpens": 2, "identity": { "numerator": 37, "denominator": 42 }, "readAligned": { "bases": 40, "of": 40 }, "referenceCovered": { "bases": 40, "of": 40 }, "placement": { "refStart": 1, "refEnd": 40, "readStart": 1, "readEnd": 40, "crossesOrigin": false }, "overhang": [], "differences": [ { "kind": "substitution", "ref": 10, "refBase": "T", "readBase": "A", "read": 10, "common": true }, { "kind": "deletion", "refStart": 25, "refEnd": 26, "length": 2, "bases": "GG", "readAfter": 24, "common": true }, { "kind": "insertion", "refAfter": 32, "length": 2, "bases": "GA", "readStart": 31, "readEnd": 32, "common": true } ] }, "band": { "diagonalMin": 0, "diagonalMax": 2, "cellsNeeded": 198, "unionBandLimited": false, "scope": "every optimal path", "gridCells": 1681, "searchedBanded": false, "sharedWords": 3, "sharedWordsOverCap": false, "seedGuarantee": { "differencesUpTo": 11, "guaranteed": false } }, "enumeration": "listed", "alignments": [ [ [ 0, 24, 26, 32, 32, 40 ], [ 0, 24, 24, 30, 32, 40 ] ] ], "tuples": [ [ 37, 0, 42, 1, 4, 2, 40, 40 ] ], "tupleFields": [ "identical", "ambiguousColumns", "columns", "mismatches", "gapColumns", "gapOpens", "readAligned", "referenceCovered" ], "variation": { "readAligned": { "shared": true, "min": 40, "max": 40 }, "referenceCovered": { "shared": true, "min": 40, "max": 40 }, "identity": { "shared": true, "min": { "numerator": 37, "denominator": 42 }, "max": { "numerator": 37, "denominator": 42 } }, "overhangStart": { "shared": true, "min": 0, "max": 0 }, "overhangEnd": { "shared": true, "min": 0, "max": 0 } }, "placements": [ { "refStart": 1, "refEnd": 40, "crossesOrigin": false, "wholeCircle": false, "readStart": 1, "readEnd": 40, "alignments": 1, "band": { "diagonalMin": 0, "diagonalMax": 2, "cellsNeeded": 198, "bandLimited": false } } ] }, "minus": { "score": 16, "count": 1, "overCap": false, "state": "aligned", "biopython": { "score": 16, "count": 1 }, "uniquePairs": [ [ 12, 22 ], [ 13, 23 ], [ 14, 24 ], [ 15, 25 ], [ 16, 26 ], [ 17, 27 ], [ 18, 28 ], [ 19, 29 ] ], "uniquePlacement": true, "placementNotDetermined": false, "noCommonColumn": false, "hull": { "refStart": 12, "refEnd": 19, "crossesOrigin": false, "wholeCircle": false }, "selected": { "coordinates": [ [ 11, 19 ], [ 21, 29 ] ], "gappedReference": "CATTAATG", "gappedRead": "CATTAATG", "columns": 8, "identical": 8, "mismatches": 0, "ambiguousColumns": 0, "gapColumns": 0, "gapOpens": 0, "identity": { "numerator": 8, "denominator": 8 }, "readAligned": { "bases": 8, "of": 40 }, "referenceCovered": { "bases": 8, "of": 40 }, "placement": { "refStart": 12, "refEnd": 19, "readStart": 22, "readEnd": 29, "crossesOrigin": false, "asSupplied": { "readStart": 12, "readEnd": 19 } }, "overhang": [], "differences": [] }, "band": { "diagonalMin": -10, "diagonalMax": -10, "cellsNeeded": 93, "unionBandLimited": false, "scope": "every optimal path", "gridCells": 1681, "searchedBanded": false, "sharedWords": 0, "sharedWordsOverCap": false, "seedGuarantee": { "differencesUpTo": 32, "guaranteed": false } }, "enumeration": "listed", "alignments": [ [ [ 11, 19 ], [ 21, 29 ] ] ], "tuples": [ [ 8, 0, 8, 0, 0, 0, 8, 8 ] ], "tupleFields": [ "identical", "ambiguousColumns", "columns", "mismatches", "gapColumns", "gapOpens", "readAligned", "referenceCovered" ], "variation": { "readAligned": { "shared": true, "min": 8, "max": 8 }, "referenceCovered": { "shared": true, "min": 8, "max": 8 }, "identity": { "shared": true, "min": { "numerator": 1, "denominator": 1 }, "max": { "numerator": 1, "denominator": 1 } }, "overhangStart": { "shared": true, "min": 0, "max": 0 }, "overhangEnd": { "shared": true, "min": 0, "max": 0 } }, "placements": [ { "refStart": 12, "refEnd": 19, "crossesOrigin": false, "wholeCircle": false, "readStart": 22, "readEnd": 29, "asSupplied": { "readStart": 12, "readEnd": 19 }, "alignments": 1, "band": { "diagonalMin": -10, "diagonalMax": -10, "cellsNeeded": 93, "bandLimited": false } } ] } } ] } }, { "id": "banded-accepted", "note": "A 297-base read (J01636.1 401-700 less 551-553, two substitutions) on the 1,500-base reference: the grid exceeds the budget, so the search is banded, and the narrow band holds every optimal path.", "input": { "reference": { "residues": "GACACCATCGAATGGCGCAAAACCTTTCGCGGTATGGCATGATAGCGCCCGGAAGAGAGTCAATTCAGGGTGGTGAATGTGAAACCAGTAACGTTATACGATGTCGCAGAGTATGCCGGTGTCTCTTATCAGACCGTTTCCCGCGTGGTGAACCAGGCCAGCCACGTTTCTGCGAAAACGCGGGAAAAAGTGGAAGCGGCGATGGCGGAGCTGAATTACATTCCCAACCGCGTGGCACAACAACTGGCGGGCAAACAGTCGTTGCTGATTGGCGTTGCCACCTCCAGTCTGGCCCTGCACGCGCCGTCGCAAATTGTCGCGGCGATTAAATCTCGCGCCGATCAACTGGGTGCCAGCGTGGTGGTGTCGATGGTAGAACGAAGCGGCGTCGAAGCCTGTAAAGCGGCGGTGCACAATCTTCTCGCGCAACGCGTCAGTGGGCTGATCATTAACTATCCGCTGGATGACCAGGATGCCATTGCTGTGGAAGCTGCCTGCACTAATGTTCCGGCGTTATTTCTTGATGTCTCTGACCAGACACCCATCAACAGTATTATTTTCTCCCATGAAGACGGTACGCGACTGGGCGTGGAGCATCTGGTCGCATTGGGTCACCAGCAAATCGCGCTGTTAGCGGGCCCATTAAGTTCTGTCTCGGCGCGTCTGCGTCTGGCTGGCTGGCATAAATATCTCACTCGCAATCAAATTCAGCCGATAGCGGAACGGGAAGGCGACTGGAGTGCCATGTCCGGTTTTCAACAAACCATGCAAATGCTGAATGAGGGCATCGTTCCCACTGCGATGCTGGTTGCCAACGATCAGATGGCGCTGGGCGCAATGCGCGCCATTACCGAGTCCGGGCTGCGCGTTGGTGCGGATATCTCGGTAGTGGGATACGACGATACCGAAGACAGCTCATGTTATATCCCGCCGTCAACCACCATCAAACAGGATTTTCGCCTGCTGGGGCAAACCAGCGTGGACCGCTTGCTGCAACTCTCTCAGGGCCAGGCGGTGAAGGGCAATCAGCTGTTGCCCGTCTCACTGGTGAAAAGAAAAACCACCCTGGCGCCCAATACGCAAACCGCCTCTCCCCGCGCGTTGGCCGATTCATTAATGCAGCTGGCACGACAGGTTTCCCGACTGGAAAGCGGGCAGTGAGCGCAACGCAATTAATGTGAGTTAGCTCACTCATTAGGCACCCCAGGCTTTACACTTTATGCTTCCGGCTCGTATGTTGTGTGGAATTGTGAGCGGATAACAATTTCACACAGGAAACAGCTATGACCATGATTACGGATTCACTGGCCGTCGTTTTACAACGTCGTGACTGGGAAAACCCTGGCGTTACCCAACTTAATCGCCTTGCAGCACATCCCCCTTTCGCCAGCTGGCGTAATAGCGAAGAGGCCCGCACCGATCGCCCTTCCCAACAGTTGCGCAGCCTGAATGGCGAATGGCGCTTTGCCTGGTTTCCGGCACCAGAAGCGGTGCCGGAAA", "topology": "linear", "source": "J01636.1 1-1500" }, "read": { "residues": "AAGCGGCGGTGCACAATCTTCTCGCGCAACGCGTCAGTGGGCTGATCATAAACTATCCGCTGGATGACCAGGATGCCATTGCTGTGGAAGCTGCCTGCACTAATGTTCCGGCGTTATTTCTTGATGTCTCTGACCAGACACCCATCAACATTATTTTCTCCCATGAAGACGGTACGCGACTGGGCGTGGAGCATCTGGTCGCATTGGGTCACCAGCAAATCGCGCTGTTAGCGGGCCCAATAAGTTCTGTCTCGGCGCGTCTGCGTCTGGCTGGCTGGCATAAATATCTCACTCGCA", "source": "J01636.1 401-550 and 554-700, read bases 50 and 240 changed" }, "modes": [ "semiglobal-read", "local" ] }, "expected": { "results": [ { "mode": "semiglobal-read", "region": null, "strand": "+", "strandUndetermined": false, "plus": { "score": 575, "count": 2, "overCap": false, "state": "aligned", "biopython": { "score": 575, "count": 2 }, "uniquePairs": [ [ 401, 1 ], [ 402, 2 ], [ 403, 3 ], [ 404, 4 ], [ 405, 5 ], [ 406, 6 ], [ 407, 7 ], [ 408, 8 ], [ 409, 9 ], [ 410, 10 ], [ 411, 11 ], [ 412, 12 ], [ 413, 13 ], [ 414, 14 ], [ 415, 15 ], [ 416, 16 ], [ 417, 17 ], [ 418, 18 ], [ 419, 19 ], [ 420, 20 ], [ 421, 21 ], [ 422, 22 ], [ 423, 23 ], [ 424, 24 ], [ 425, 25 ], [ 426, 26 ], [ 427, 27 ], [ 428, 28 ], [ 429, 29 ], [ 430, 30 ], [ 431, 31 ], [ 432, 32 ], [ 433, 33 ], [ 434, 34 ], [ 435, 35 ], [ 436, 36 ], [ 437, 37 ], [ 438, 38 ], [ 439, 39 ], [ 440, 40 ], [ 441, 41 ], [ 442, 42 ], [ 443, 43 ], [ 444, 44 ], [ 445, 45 ], [ 446, 46 ], [ 447, 47 ], [ 448, 48 ], [ 449, 49 ], [ 450, 50 ], [ 451, 51 ], [ 452, 52 ], [ 453, 53 ], [ 454, 54 ], [ 455, 55 ], [ 456, 56 ], [ 457, 57 ], [ 458, 58 ], [ 459, 59 ], [ 460, 60 ], [ 461, 61 ], [ 462, 62 ], [ 463, 63 ], [ 464, 64 ], [ 465, 65 ], [ 466, 66 ], [ 467, 67 ], [ 468, 68 ], [ 469, 69 ], [ 470, 70 ], [ 471, 71 ], [ 472, 72 ], [ 473, 73 ], [ 474, 74 ], [ 475, 75 ], [ 476, 76 ], [ 477, 77 ], [ 478, 78 ], [ 479, 79 ], [ 480, 80 ], [ 481, 81 ], [ 482, 82 ], [ 483, 83 ], [ 484, 84 ], [ 485, 85 ], [ 486, 86 ], [ 487, 87 ], [ 488, 88 ], [ 489, 89 ], [ 490, 90 ], [ 491, 91 ], [ 492, 92 ], [ 493, 93 ], [ 494, 94 ], [ 495, 95 ], [ 496, 96 ], [ 497, 97 ], [ 498, 98 ], [ 499, 99 ], [ 500, 100 ], [ 501, 101 ], [ 502, 102 ], [ 503, 103 ], [ 504, 104 ], [ 505, 105 ], [ 506, 106 ], [ 507, 107 ], [ 508, 108 ], [ 509, 109 ], [ 510, 110 ], [ 511, 111 ], [ 512, 112 ], [ 513, 113 ], [ 514, 114 ], [ 515, 115 ], [ 516, 116 ], [ 517, 117 ], [ 518, 118 ], [ 519, 119 ], [ 520, 120 ], [ 521, 121 ], [ 522, 122 ], [ 523, 123 ], [ 524, 124 ], [ 525, 125 ], [ 526, 126 ], [ 527, 127 ], [ 528, 128 ], [ 529, 129 ], [ 530, 130 ], [ 531, 131 ], [ 532, 132 ], [ 533, 133 ], [ 534, 134 ], [ 535, 135 ], [ 536, 136 ], [ 537, 137 ], [ 538, 138 ], [ 539, 139 ], [ 540, 140 ], [ 541, 141 ], [ 542, 142 ], [ 543, 143 ], [ 544, 144 ], [ 545, 145 ], [ 546, 146 ], [ 547, 147 ], [ 548, 148 ], [ 549, 149 ], [ 554, 151 ], [ 555, 152 ], [ 556, 153 ], [ 557, 154 ], [ 558, 155 ], [ 559, 156 ], [ 560, 157 ], [ 561, 158 ], [ 562, 159 ], [ 563, 160 ], [ 564, 161 ], [ 565, 162 ], [ 566, 163 ], [ 567, 164 ], [ 568, 165 ], [ 569, 166 ], [ 570, 167 ], [ 571, 168 ], [ 572, 169 ], [ 573, 170 ], [ 574, 171 ], [ 575, 172 ], [ 576, 173 ], [ 577, 174 ], [ 578, 175 ], [ 579, 176 ], [ 580, 177 ], [ 581, 178 ], [ 582, 179 ], [ 583, 180 ], [ 584, 181 ], [ 585, 182 ], [ 586, 183 ], [ 587, 184 ], [ 588, 185 ], [ 589, 186 ], [ 590, 187 ], [ 591, 188 ], [ 592, 189 ], [ 593, 190 ], [ 594, 191 ], [ 595, 192 ], [ 596, 193 ], [ 597, 194 ], [ 598, 195 ], [ 599, 196 ], [ 600, 197 ], [ 601, 198 ], [ 602, 199 ], [ 603, 200 ], [ 604, 201 ], [ 605, 202 ], [ 606, 203 ], [ 607, 204 ], [ 608, 205 ], [ 609, 206 ], [ 610, 207 ], [ 611, 208 ], [ 612, 209 ], [ 613, 210 ], [ 614, 211 ], [ 615, 212 ], [ 616, 213 ], [ 617, 214 ], [ 618, 215 ], [ 619, 216 ], [ 620, 217 ], [ 621, 218 ], [ 622, 219 ], [ 623, 220 ], [ 624, 221 ], [ 625, 222 ], [ 626, 223 ], [ 627, 224 ], [ 628, 225 ], [ 629, 226 ], [ 630, 227 ], [ 631, 228 ], [ 632, 229 ], [ 633, 230 ], [ 634, 231 ], [ 635, 232 ], [ 636, 233 ], [ 637, 234 ], [ 638, 235 ], [ 639, 236 ], [ 640, 237 ], [ 641, 238 ], [ 642, 239 ], [ 643, 240 ], [ 644, 241 ], [ 645, 242 ], [ 646, 243 ], [ 647, 244 ], [ 648, 245 ], [ 649, 246 ], [ 650, 247 ], [ 651, 248 ], [ 652, 249 ], [ 653, 250 ], [ 654, 251 ], [ 655, 252 ], [ 656, 253 ], [ 657, 254 ], [ 658, 255 ], [ 659, 256 ], [ 660, 257 ], [ 661, 258 ], [ 662, 259 ], [ 663, 260 ], [ 664, 261 ], [ 665, 262 ], [ 666, 263 ], [ 667, 264 ], [ 668, 265 ], [ 669, 266 ], [ 670, 267 ], [ 671, 268 ], [ 672, 269 ], [ 673, 270 ], [ 674, 271 ], [ 675, 272 ], [ 676, 273 ], [ 677, 274 ], [ 678, 275 ], [ 679, 276 ], [ 680, 277 ], [ 681, 278 ], [ 682, 279 ], [ 683, 280 ], [ 684, 281 ], [ 685, 282 ], [ 686, 283 ], [ 687, 284 ], [ 688, 285 ], [ 689, 286 ], [ 690, 287 ], [ 691, 288 ], [ 692, 289 ], [ 693, 290 ], [ 694, 291 ], [ 695, 292 ], [ 696, 293 ], [ 697, 294 ], [ 698, 295 ], [ 699, 296 ], [ 700, 297 ] ], "uniquePlacement": true, "placementNotDetermined": false, "noCommonColumn": false, "hull": { "refStart": 401, "refEnd": 700, "crossesOrigin": false, "wholeCircle": false }, "selected": { "coordinates": [ [ 0, 400, 549, 552, 700, 1500 ], [ 0, 0, 149, 149, 297, 297 ] ], "gappedReference": "AAGCGGCGGTGCACAATCTTCTCGCGCAACGCGTCAGTGGGCTGATCATTAACTATCCGCTGGATGACCAGGATGCCATTGCTGTGGAAGCTGCCTGCACTAATGTTCCGGCGTTATTTCTTGATGTCTCTGACCAGACACCCATCAACAGTATTATTTTCTCCCATGAAGACGGTACGCGACTGGGCGTGGAGCATCTGGTCGCATTGGGTCACCAGCAAATCGCGCTGTTAGCGGGCCCATTAAGTTCTGTCTCGGCGCGTCTGCGTCTGGCTGGCTGGCATAAATATCTCACTCGCA", "gappedRead": "AAGCGGCGGTGCACAATCTTCTCGCGCAACGCGTCAGTGGGCTGATCATAAACTATCCGCTGGATGACCAGGATGCCATTGCTGTGGAAGCTGCCTGCACTAATGTTCCGGCGTTATTTCTTGATGTCTCTGACCAGACACCCATCAAC---ATTATTTTCTCCCATGAAGACGGTACGCGACTGGGCGTGGAGCATCTGGTCGCATTGGGTCACCAGCAAATCGCGCTGTTAGCGGGCCCAATAAGTTCTGTCTCGGCGCGTCTGCGTCTGGCTGGCTGGCATAAATATCTCACTCGCA", "columns": 300, "identical": 295, "mismatches": 2, "ambiguousColumns": 0, "gapColumns": 3, "gapOpens": 1, "identity": { "numerator": 295, "denominator": 300 }, "readAligned": { "bases": 297, "of": 297 }, "referenceCovered": { "bases": 300, "of": 1500 }, "placement": { "refStart": 401, "refEnd": 700, "readStart": 1, "readEnd": 297, "crossesOrigin": false }, "overhang": [], "differences": [ { "kind": "substitution", "ref": 450, "refBase": "T", "readBase": "A", "read": 50, "common": true }, { "kind": "deletion", "refStart": 550, "refEnd": 552, "length": 3, "bases": "AGT", "readAfter": 149, "common": false, "notFixed": { "from": { "ref": 549, "read": 149 }, "to": { "ref": 554, "read": 151 } } }, { "kind": "substitution", "ref": 643, "refBase": "T", "readBase": "A", "read": 240, "common": true } ] }, "band": { "diagonalMin": 400, "diagonalMax": 403, "cellsNeeded": 1788, "unionBandLimited": false, "scope": "every optimal path", "gridCells": 447298, "searchedBanded": true, "sharedWords": 252, "sharedWordsOverCap": false, "seedGuarantee": { "differencesUpTo": 9, "guaranteed": true } }, "enumeration": "listed", "alignments": [ [ [ 0, 400, 549, 552, 700, 1500 ], [ 0, 0, 149, 149, 297, 297 ] ], [ [ 0, 400, 550, 553, 700, 1500 ], [ 0, 0, 150, 150, 297, 297 ] ] ], "tuples": [ [ 295, 0, 300, 2, 3, 1, 297, 300 ] ], "tupleFields": [ "identical", "ambiguousColumns", "columns", "mismatches", "gapColumns", "gapOpens", "readAligned", "referenceCovered" ], "variation": { "readAligned": { "shared": true, "min": 297, "max": 297 }, "referenceCovered": { "shared": true, "min": 300, "max": 300 }, "identity": { "shared": true, "min": { "numerator": 59, "denominator": 60 }, "max": { "numerator": 59, "denominator": 60 } }, "overhangStart": { "shared": true, "min": 0, "max": 0 }, "overhangEnd": { "shared": true, "min": 0, "max": 0 } }, "placements": [ { "refStart": 401, "refEnd": 700, "crossesOrigin": false, "wholeCircle": false, "readStart": 1, "readEnd": 297, "alignments": 2, "band": { "diagonalMin": 400, "diagonalMax": 403, "cellsNeeded": 1788, "bandLimited": false } } ] }, "minus": { "score": -121, "count": 1209600, "overCap": true, "state": "aligned", "biopython": { "score": -121, "count": 1209600 }, "uniquePairs": [ [ 736, 1 ], [ 737, 2 ], [ 738, 4 ], [ 739, 5 ], [ 740, 6 ], [ 741, 7 ], [ 742, 8 ], [ 743, 9 ], [ 744, 10 ], [ 745, 11 ], [ 746, 12 ], [ 747, 13 ], [ 748, 14 ], [ 753, 15 ], [ 754, 16 ], [ 755, 17 ], [ 756, 18 ], [ 757, 21 ], [ 758, 22 ], [ 759, 23 ], [ 760, 24 ], [ 761, 25 ], [ 762, 26 ], [ 763, 27 ], [ 764, 28 ], [ 765, 29 ], [ 768, 34 ], [ 769, 35 ], [ 770, 36 ], [ 771, 37 ], [ 772, 38 ], [ 773, 39 ], [ 774, 40 ], [ 777, 51 ], [ 778, 52 ], [ 779, 53 ], [ 780, 55 ], [ 781, 56 ], [ 782, 57 ], [ 783, 60 ], [ 784, 61 ], [ 785, 62 ], [ 786, 63 ], [ 789, 65 ], [ 790, 66 ], [ 791, 67 ], [ 792, 68 ], [ 793, 69 ], [ 794, 70 ], [ 795, 71 ], [ 796, 72 ], [ 797, 73 ], [ 798, 74 ], [ 799, 75 ], [ 800, 76 ], [ 801, 77 ], [ 802, 78 ], [ 804, 82 ], [ 805, 83 ], [ 806, 84 ], [ 807, 85 ], [ 808, 86 ], [ 811, 88 ], [ 812, 91 ], [ 813, 92 ], [ 814, 93 ], [ 815, 94 ], [ 816, 97 ], [ 817, 98 ], [ 818, 99 ], [ 819, 100 ], [ 820, 101 ], [ 821, 102 ], [ 822, 103 ], [ 823, 104 ], [ 824, 105 ], [ 827, 107 ], [ 828, 108 ], [ 829, 109 ], [ 830, 110 ], [ 831, 111 ], [ 832, 112 ], [ 833, 113 ], [ 834, 114 ], [ 835, 115 ], [ 836, 116 ], [ 837, 117 ], [ 838, 118 ], [ 839, 119 ], [ 841, 120 ], [ 842, 121 ], [ 843, 122 ], [ 844, 123 ], [ 849, 124 ], [ 850, 125 ], [ 851, 126 ], [ 852, 127 ], [ 853, 128 ], [ 854, 129 ], [ 855, 130 ], [ 856, 131 ], [ 857, 132 ], [ 858, 133 ], [ 859, 136 ], [ 860, 137 ], [ 861, 138 ], [ 879, 158 ], [ 880, 159 ], [ 881, 160 ], [ 882, 161 ], [ 883, 162 ], [ 885, 163 ], [ 886, 164 ], [ 887, 165 ], [ 888, 167 ], [ 889, 168 ], [ 890, 169 ], [ 891, 170 ], [ 892, 171 ], [ 893, 172 ], [ 894, 173 ], [ 895, 174 ], [ 896, 184 ], [ 897, 185 ], [ 898, 186 ], [ 899, 187 ], [ 900, 188 ], [ 904, 197 ], [ 905, 198 ], [ 906, 199 ], [ 907, 200 ], [ 908, 201 ], [ 909, 202 ], [ 910, 203 ], [ 911, 204 ], [ 912, 205 ], [ 913, 206 ], [ 914, 207 ], [ 915, 208 ], [ 916, 209 ], [ 917, 212 ], [ 918, 213 ], [ 920, 216 ], [ 921, 217 ], [ 922, 218 ], [ 923, 219 ], [ 924, 220 ], [ 925, 224 ], [ 926, 225 ], [ 927, 226 ], [ 928, 227 ], [ 929, 228 ], [ 930, 229 ], [ 933, 230 ], [ 934, 231 ], [ 935, 232 ], [ 936, 233 ], [ 937, 234 ], [ 938, 235 ], [ 939, 236 ], [ 940, 237 ], [ 941, 238 ], [ 942, 239 ], [ 943, 242 ], [ 944, 243 ], [ 945, 244 ], [ 946, 245 ], [ 947, 246 ], [ 948, 247 ], [ 949, 248 ], [ 950, 249 ], [ 951, 250 ], [ 952, 251 ], [ 953, 252 ], [ 954, 253 ], [ 955, 254 ], [ 956, 255 ], [ 957, 256 ], [ 958, 257 ], [ 959, 258 ], [ 960, 259 ], [ 961, 261 ], [ 962, 262 ], [ 965, 269 ], [ 966, 270 ], [ 967, 271 ], [ 968, 272 ], [ 969, 273 ], [ 970, 274 ], [ 973, 278 ], [ 974, 279 ], [ 975, 280 ], [ 976, 281 ], [ 977, 282 ], [ 978, 283 ], [ 979, 284 ], [ 980, 285 ], [ 981, 286 ], [ 982, 287 ], [ 983, 288 ] ], "uniquePlacement": true, "placementNotDetermined": false, "noCommonColumn": false, "hull": { "refStart": 736, "refEnd": 993, "crossesOrigin": false, "wholeCircle": false }, "selected": { "coordinates": [ [ 0, 735, 737, 737, 748, 752, 756, 756, 765, 765, 774, 774, 779, 779, 782, 782, 786, 787, 802, 802, 808, 809, 811, 811, 815, 815, 824, 825, 839, 840, 844, 848, 858, 858, 861, 862, 869, 869, 874, 874, 883, 884, 887, 887, 895, 895, 900, 900, 902, 902, 916, 916, 918, 918, 924, 924, 930, 932, 942, 942, 960, 960, 963, 963, 964, 964, 970, 970, 983, 983, 989, 1500 ], [ 0, 0, 2, 3, 14, 14, 18, 20, 29, 31, 40, 48, 53, 54, 57, 59, 63, 63, 78, 80, 86, 86, 88, 90, 94, 96, 105, 105, 119, 119, 123, 123, 133, 135, 138, 138, 145, 147, 152, 153, 162, 162, 165, 166, 174, 183, 188, 189, 191, 195, 209, 211, 213, 214, 220, 223, 229, 229, 239, 241, 259, 260, 263, 264, 265, 268, 274, 275, 288, 291, 297, 297 ] ], "gappedReference": "TG-GAGTGCCATGTCCGGTTTT--CAACAAACC--ATGCAAATG--------CTGAA-TGA--GGGCATCGTTCCCACTGCGA--TGCTGGTTG--CCAA--CGATCAGATGGCGCTGGGCGCAATGCGCGCCATTACCGAGTCC--GGGCTGCGCGT--TGGTG-CGGATATCTCGGT-AGTGGGAT---------ACGAC-GA----TACCGAAGACAGCT--CA-TGTTAT---ATCCCGCCGTCAACCACC--ATCAAACAGGATTTTCGC-CTG-C---TGGGGC-AAACCAGCGTGGA---CCGCTT", "gappedRead": "TGCGAGTGAGATAT----TTATGCCAGCCAGCCAGACGCAGACGCGCCGAGACAGAACTTATTGGGC-CCGCTAACAGCGCGATTTGCTGG-TGACCCAATGCGACCAGAT-GCTCCACGCCCAGT-CGCG----TACCGTCTTCATGGG-AGAAAATAATGTTGATGGGTGTCT-GGTCAGAGACATCAAGAAATAACGCCGGAACATTAGTGCAGGCAGCTTCCACAGCAATGGCATCCTG--GTCATCCAGCGGATAGTTTATGATCAGCCCACTGACGCGTTGCGCGAGAAGATTGTGCACCGCCGCTT", "columns": 313, "identical": 169, "mismatches": 69, "ambiguousColumns": 0, "gapColumns": 75, "gapOpens": 34, "identity": { "numerator": 169, "denominator": 313 }, "readAligned": { "bases": 297, "of": 297 }, "referenceCovered": { "bases": 254, "of": 1500 }, "placement": { "refStart": 736, "refEnd": 989, "readStart": 1, "readEnd": 297, "crossesOrigin": false, "asSupplied": { "readStart": 1, "readEnd": 297 } }, "overhang": [], "differences": [ { "kind": "insertion", "refAfter": 737, "length": 1, "bases": "C", "readStart": 3, "readEnd": 3, "asSupplied": { "readStart": 295, "readEnd": 295, "bases": "G" }, "common": true }, { "kind": "substitution", "ref": 743, "refBase": "C", "readBase": "A", "read": 9, "common": true, "asSupplied": { "read": 289, "readBase": "T" } }, { "kind": "substitution", "ref": 744, "refBase": "C", "readBase": "G", "read": 10, "common": true, "asSupplied": { "read": 288, "readBase": "C" } }, { "kind": "substitution", "ref": 747, "refBase": "G", "readBase": "A", "read": 13, "common": true, "asSupplied": { "read": 285, "readBase": "T" } }, { "kind": "deletion", "refStart": 749, "refEnd": 752, "length": 4, "bases": "CCGG", "readAfter": 14, "asSupplied": { "readBetween": [ 283, 284 ] }, "common": true }, { "kind": "substitution", "ref": 755, "refBase": "T", "readBase": "A", "read": 17, "common": true, "asSupplied": { "read": 281, "readBase": "T" } }, { "kind": "insertion", "refAfter": 756, "length": 2, "bases": "GC", "readStart": 19, "readEnd": 20, "asSupplied": { "readStart": 278, "readEnd": 279, "bases": "GC" }, "common": true }, { "kind": "substitution", "ref": 759, "refBase": "A", "readBase": "G", "read": 23, "common": true, "asSupplied": { "read": 275, "readBase": "C" } }, { "kind": "substitution", "ref": 761, "refBase": "A", "readBase": "C", "read": 25, "common": true, "asSupplied": { "read": 273, "readBase": "G" } }, { "kind": "substitution", "ref": 763, "refBase": "A", "readBase": "G", "read": 27, "common": true, "asSupplied": { "read": 271, "readBase": "C" } }, { "kind": "insertion", "refAfter": 765, "length": 2, "bases": "AG", "readStart": 30, "readEnd": 31, "asSupplied": { "readStart": 267, "readEnd": 268, "bases": "CT" }, "common": false, "notFixed": { "from": { "ref": 765, "read": 29, "readAsSupplied": 269 }, "to": { "ref": 768, "read": 34, "readAsSupplied": 264 } } }, { "kind": "substitution", "ref": 767, "refBase": "T", "readBase": "C", "read": 33, "common": false, "notFixed": { "from": { "ref": 765, "read": 29, "readAsSupplied": 269 }, "to": { "ref": 768, "read": 34, "readAsSupplied": 264 } }, "asSupplied": { "read": 265, "readBase": "G" } }, { "kind": "substitution", "ref": 771, "refBase": "A", "readBase": "G", "read": 37, "common": true, "asSupplied": { "read": 261, "readBase": "C" } }, { "kind": "substitution", "ref": 773, "refBase": "T", "readBase": "C", "read": 39, "common": true, "asSupplied": { "read": 259, "readBase": "G" } }, { "kind": "insertion", "refAfter": 774, "length": 8, "bases": "CGCCGAGA", "readStart": 41, "readEnd": 48, "asSupplied": { "readStart": 250, "readEnd": 257, "bases": "TCTCGGCG" }, "common": false, "notFixed": { "from": { "ref": 774, "read": 40, "readAsSupplied": 258 }, "to": { "ref": 777, "read": 51, "readAsSupplied": 247 } } }, { "kind": "substitution", "ref": 776, "refBase": "T", "readBase": "A", "read": 50, "common": false, "notFixed": { "from": { "ref": 774, "read": 40, "readAsSupplied": 258 }, "to": { "ref": 777, "read": 51, "readAsSupplied": 247 } }, "asSupplied": { "read": 248, "readBase": "T" } }, { "kind": "insertion", "refAfter": 779, "length": 1, "bases": "C", "readStart": 54, "readEnd": 54, "asSupplied": { "readStart": 244, "readEnd": 244, "bases": "G" }, "common": true }, { "kind": "substitution", "ref": 781, "refBase": "G", "readBase": "T", "read": 56, "common": true, "asSupplied": { "read": 242, "readBase": "A" } }, { "kind": "insertion", "refAfter": 782, "length": 2, "bases": "TT", "readStart": 58, "readEnd": 59, "asSupplied": { "readStart": 239, "readEnd": 240, "bases": "AA" }, "common": true }, { "kind": "deletion", "refStart": 787, "refEnd": 787, "length": 1, "bases": "A", "readAfter": 63, "asSupplied": { "readBetween": [ 234, 235 ] }, "common": false, "notFixed": { "from": { "ref": 786, "read": 63, "readAsSupplied": 235 }, "to": { "ref": 789, "read": 65, "readAsSupplied": 233 } } }, { "kind": "substitution", "ref": 788, "refBase": "T", "readBase": "C", "read": 64, "common": false, "notFixed": { "from": { "ref": 786, "read": 63, "readAsSupplied": 235 }, "to": { "ref": 789, "read": 65, "readAsSupplied": 233 } }, "asSupplied": { "read": 234, "readBase": "G" } }, { "kind": "substitution", "ref": 791, "refBase": "T", "readBase": "C", "read": 67, "common": true, "asSupplied": { "read": 231, "readBase": "G" } }, { "kind": "substitution", "ref": 793, "refBase": "C", "readBase": "A", "read": 69, "common": true, "asSupplied": { "read": 229, "readBase": "T" } }, { "kind": "substitution", "ref": 794, "refBase": "C", "readBase": "A", "read": 70, "common": true, "asSupplied": { "read": 228, "readBase": "T" } }, { "kind": "substitution", "ref": 797, "refBase": "C", "readBase": "G", "read": 73, "common": true, "asSupplied": { "read": 225, "readBase": "C" } }, { "kind": "substitution", "ref": 798, "refBase": "T", "readBase": "C", "read": 74, "common": true, "asSupplied": { "read": 224, "readBase": "G" } }, { "kind": "insertion", "refAfter": 802, "length": 2, "bases": "TT", "readStart": 79, "readEnd": 80, "asSupplied": { "readStart": 218, "readEnd": 219, "bases": "AA" }, "common": false, "notFixed": { "from": { "ref": 802, "read": 78, "readAsSupplied": 220 }, "to": { "ref": 804, "read": 82, "readAsSupplied": 216 } } }, { "kind": "deletion", "refStart": 809, "refEnd": 809, "length": 1, "bases": "T", "readAfter": 86, "asSupplied": { "readBetween": [ 211, 212 ] }, "common": false, "notFixed": { "from": { "ref": 808, "read": 86, "readAsSupplied": 212 }, "to": { "ref": 811, "read": 88, "readAsSupplied": 210 } } }, { "kind": "insertion", "refAfter": 811, "length": 2, "bases": "AC", "readStart": 89, "readEnd": 90, "asSupplied": { "readStart": 208, "readEnd": 209, "bases": "GT" }, "common": true }, { "kind": "insertion", "refAfter": 815, "length": 2, "bases": "TG", "readStart": 95, "readEnd": 96, "asSupplied": { "readStart": 202, "readEnd": 203, "bases": "CA" }, "common": true }, { "kind": "substitution", "ref": 819, "refBase": "T", "readBase": "C", "read": 100, "common": true, "asSupplied": { "read": 198, "readBase": "G" } }, { "kind": "deletion", "refStart": 825, "refEnd": 825, "length": 1, "bases": "G", "readAfter": 105, "asSupplied": { "readBetween": [ 192, 193 ] }, "common": false, "notFixed": { "from": { "ref": 824, "read": 105, "readAsSupplied": 193 }, "to": { "ref": 827, "read": 107, "readAsSupplied": 191 } } }, { "kind": "substitution", "ref": 828, "refBase": "G", "readBase": "T", "read": 108, "common": true, "asSupplied": { "read": 190, "readBase": "A" } }, { "kind": "substitution", "ref": 830, "refBase": "T", "readBase": "C", "read": 110, "common": true, "asSupplied": { "read": 188, "readBase": "G" } }, { "kind": "substitution", "ref": 831, "refBase": "G", "readBase": "A", "read": 111, "common": true, "asSupplied": { "read": 187, "readBase": "T" } }, { "kind": "substitution", "ref": 832, "refBase": "G", "readBase": "C", "read": 112, "common": true, "asSupplied": { "read": 186, "readBase": "G" } }, { "kind": "substitution", "ref": 835, "refBase": "G", "readBase": "C", "read": 115, "common": true, "asSupplied": { "read": 183, "readBase": "G" } }, { "kind": "substitution", "ref": 838, "refBase": "A", "readBase": "G", "read": 118, "common": true, "asSupplied": { "read": 180, "readBase": "C" } }, { "kind": "deletion", "refStart": 840, "refEnd": 840, "length": 1, "bases": "G", "readAfter": 119, "asSupplied": { "readBetween": [ 178, 179 ] }, "common": true }, { "kind": "deletion", "refStart": 845, "refEnd": 848, "length": 4, "bases": "CCAT", "readAfter": 123, "asSupplied": { "readBetween": [ 174, 175 ] }, "common": true }, { "kind": "substitution", "ref": 854, "refBase": "A", "readBase": "T", "read": 129, "common": true, "asSupplied": { "read": 169, "readBase": "A" } }, { "kind": "substitution", "ref": 855, "refBase": "G", "readBase": "C", "read": 130, "common": true, "asSupplied": { "read": 168, "readBase": "G" } }, { "kind": "substitution", "ref": 857, "refBase": "C", "readBase": "T", "read": 132, "common": true, "asSupplied": { "read": 166, "readBase": "A" } }, { "kind": "insertion", "refAfter": 858, "length": 2, "bases": "AT", "readStart": 134, "readEnd": 135, "asSupplied": { "readStart": 163, "readEnd": 164, "bases": "AT" }, "common": true }, { "kind": "deletion", "refStart": 862, "refEnd": 862, "length": 1, "bases": "C", "readAfter": 138, "asSupplied": { "readBetween": [ 159, 160 ] }, "common": false, "notFixed": { "from": { "ref": 861, "read": 138, "readAsSupplied": 160 }, "to": { "ref": 879, "read": 158, "readAsSupplied": 140 } } }, { "kind": "substitution", "ref": 863, "refBase": "T", "readBase": "A", "read": 139, "common": false, "notFixed": { "from": { "ref": 861, "read": 138, "readAsSupplied": 160 }, "to": { "ref": 879, "read": 158, "readAsSupplied": 140 } }, "asSupplied": { "read": 159, "readBase": "T" } }, { "kind": "substitution", "ref": 865, "refBase": "C", "readBase": "A", "read": 141, "common": false, "notFixed": { "from": { "ref": 861, "read": 138, "readAsSupplied": 160 }, "to": { "ref": 879, "read": 158, "readAsSupplied": 140 } }, "asSupplied": { "read": 157, "readBase": "T" } }, { "kind": "substitution", "ref": 866, "refBase": "G", "readBase": "A", "read": 142, "common": false, "notFixed": { "from": { "ref": 861, "read": 138, "readAsSupplied": 160 }, "to": { "ref": 879, "read": 158, "readAsSupplied": 140 } }, "asSupplied": { "read": 156, "readBase": "T" } }, { "kind": "substitution", "ref": 867, "refBase": "C", "readBase": "A", "read": 143, "common": false, "notFixed": { "from": { "ref": 861, "read": 138, "readAsSupplied": 160 }, "to": { "ref": 879, "read": 158, "readAsSupplied": 140 } }, "asSupplied": { "read": 155, "readBase": "T" } }, { "kind": "substitution", "ref": 868, "refBase": "G", "readBase": "A", "read": 144, "common": false, "notFixed": { "from": { "ref": 861, "read": 138, "readAsSupplied": 160 }, "to": { "ref": 879, "read": 158, "readAsSupplied": 140 } }, "asSupplied": { "read": 154, "readBase": "T" } }, { "kind": "insertion", "refAfter": 869, "length": 2, "bases": "AA", "readStart": 146, "readEnd": 147, "asSupplied": { "readStart": 151, "readEnd": 152, "bases": "TT" }, "common": false, "notFixed": { "from": { "ref": 861, "read": 138, "readAsSupplied": 160 }, "to": { "ref": 879, "read": 158, "readAsSupplied": 140 } } }, { "kind": "substitution", "ref": 872, "refBase": "G", "readBase": "T", "read": 150, "common": false, "notFixed": { "from": { "ref": 861, "read": 138, "readAsSupplied": 160 }, "to": { "ref": 879, "read": 158, "readAsSupplied": 140 } }, "asSupplied": { "read": 148, "readBase": "A" } }, { "kind": "insertion", "refAfter": 874, "length": 1, "bases": "A", "readStart": 153, "readEnd": 153, "asSupplied": { "readStart": 145, "readEnd": 145, "bases": "T" }, "common": false, "notFixed": { "from": { "ref": 861, "read": 138, "readAsSupplied": 160 }, "to": { "ref": 879, "read": 158, "readAsSupplied": 140 } } }, { "kind": "substitution", "ref": 875, "refBase": "C", "readBase": "T", "read": 154, "common": false, "notFixed": { "from": { "ref": 861, "read": 138, "readAsSupplied": 160 }, "to": { "ref": 879, "read": 158, "readAsSupplied": 140 } }, "asSupplied": { "read": 144, "readBase": "A" } }, { "kind": "substitution", "ref": 878, "refBase": "A", "readBase": "G", "read": 157, "common": false, "notFixed": { "from": { "ref": 861, "read": 138, "readAsSupplied": 160 }, "to": { "ref": 879, "read": 158, "readAsSupplied": 140 } }, "asSupplied": { "read": 141, "readBase": "C" } }, { "kind": "substitution", "ref": 880, "refBase": "A", "readBase": "G", "read": 159, "common": true, "asSupplied": { "read": 139, "readBase": "C" } }, { "kind": "deletion", "refStart": 884, "refEnd": 884, "length": 1, "bases": "C", "readAfter": 162, "asSupplied": { "readBetween": [ 135, 136 ] }, "common": true }, { "kind": "insertion", "refAfter": 887, "length": 1, "bases": "C", "readStart": 166, "readEnd": 166, "asSupplied": { "readStart": 132, "readEnd": 132, "bases": "G" }, "common": true }, { "kind": "substitution", "ref": 890, "refBase": "T", "readBase": "A", "read": 169, "common": true, "asSupplied": { "read": 129, "readBase": "T" } }, { "kind": "substitution", "ref": 892, "refBase": "G", "readBase": "A", "read": 171, "common": true, "asSupplied": { "read": 127, "readBase": "T" } }, { "kind": "substitution", "ref": 893, "refBase": "G", "readBase": "C", "read": 172, "common": true, "asSupplied": { "read": 126, "readBase": "G" } }, { "kind": "insertion", "refAfter": 895, "length": 9, "bases": "CAAGAAATA", "readStart": 175, "readEnd": 183, "asSupplied": { "readStart": 115, "readEnd": 123, "bases": "TATTTCTTG" }, "common": true }, { "kind": "substitution", "ref": 899, "refBase": "A", "readBase": "C", "read": 187, "common": true, "asSupplied": { "read": 111, "readBase": "G" } }, { "kind": "insertion", "refAfter": 900, "length": 1, "bases": "G", "readStart": 189, "readEnd": 189, "asSupplied": { "readStart": 109, "readEnd": 109, "bases": "C" }, "common": false, "notFixed": { "from": { "ref": 900, "read": 188, "readAsSupplied": 110 }, "to": { "ref": 904, "read": 197, "readAsSupplied": 101 } } }, { "kind": "insertion", "refAfter": 902, "length": 4, "bases": "ACAT", "readStart": 192, "readEnd": 195, "asSupplied": { "readStart": 103, "readEnd": 106, "bases": "ATGT" }, "common": false, "notFixed": { "from": { "ref": 900, "read": 188, "readAsSupplied": 110 }, "to": { "ref": 904, "read": 197, "readAsSupplied": 101 } } }, { "kind": "substitution", "ref": 905, "refBase": "C", "readBase": "G", "read": 198, "common": true, "asSupplied": { "read": 100, "readBase": "C" } }, { "kind": "substitution", "ref": 906, "refBase": "C", "readBase": "T", "read": 199, "common": true, "asSupplied": { "read": 99, "readBase": "A" } }, { "kind": "substitution", "ref": 908, "refBase": "A", "readBase": "C", "read": 201, "common": true, "asSupplied": { "read": 97, "readBase": "G" } }, { "kind": "substitution", "ref": 911, "refBase": "A", "readBase": "G", "read": 204, "common": true, "asSupplied": { "read": 94, "readBase": "C" } }, { "kind": "insertion", "refAfter": 916, "length": 2, "bases": "TC", "readStart": 210, "readEnd": 211, "asSupplied": { "readStart": 87, "readEnd": 88, "bases": "GA" }, "common": true }, { "kind": "insertion", "refAfter": 918, "length": 1, "bases": "C", "readStart": 214, "readEnd": 214, "asSupplied": { "readStart": 84, "readEnd": 84, "bases": "G" }, "common": false, "notFixed": { "from": { "ref": 918, "read": 213, "readAsSupplied": 85 }, "to": { "ref": 920, "read": 216, "readAsSupplied": 82 } } }, { "kind": "substitution", "ref": 919, "refBase": "T", "readBase": "A", "read": 215, "common": false, "notFixed": { "from": { "ref": 918, "read": 213, "readAsSupplied": 85 }, "to": { "ref": 920, "read": 216, "readAsSupplied": 82 } }, "asSupplied": { "read": 83, "readBase": "T" } }, { "kind": "substitution", "ref": 921, "refBase": "T", "readBase": "C", "read": 217, "common": true, "asSupplied": { "read": 81, "readBase": "G" } }, { "kind": "substitution", "ref": 922, "refBase": "T", "readBase": "A", "read": 218, "common": true, "asSupplied": { "read": 80, "readBase": "T" } }, { "kind": "insertion", "refAfter": 924, "length": 3, "bases": "GGC", "readStart": 221, "readEnd": 223, "asSupplied": { "readStart": 75, "readEnd": 77, "bases": "GCC" }, "common": true }, { "kind": "substitution", "ref": 929, "refBase": "C", "readBase": "T", "read": 228, "common": true, "asSupplied": { "read": 70, "readBase": "A" } }, { "kind": "deletion", "refStart": 931, "refEnd": 932, "length": 2, "bases": "CC", "readAfter": 229, "asSupplied": { "readBetween": [ 68, 69 ] }, "common": true }, { "kind": "substitution", "ref": 937, "refBase": "A", "readBase": "T", "read": 234, "common": true, "asSupplied": { "read": 64, "readBase": "A" } }, { "kind": "substitution", "ref": 941, "refBase": "C", "readBase": "G", "read": 238, "common": true, "asSupplied": { "read": 60, "readBase": "C" } }, { "kind": "insertion", "refAfter": 942, "length": 2, "bases": "GG", "readStart": 240, "readEnd": 241, "asSupplied": { "readStart": 57, "readEnd": 58, "bases": "CC" }, "common": true }, { "kind": "substitution", "ref": 945, "refBase": "C", "readBase": "A", "read": 244, "common": true, "asSupplied": { "read": 54, "readBase": "T" } }, { "kind": "substitution", "ref": 946, "refBase": "A", "readBase": "G", "read": 245, "common": true, "asSupplied": { "read": 53, "readBase": "C" } }, { "kind": "substitution", "ref": 947, "refBase": "A", "readBase": "T", "read": 246, "common": true, "asSupplied": { "read": 52, "readBase": "A" } }, { "kind": "substitution", "ref": 948, "refBase": "A", "readBase": "T", "read": 247, "common": true, "asSupplied": { "read": 51, "readBase": "A" } }, { "kind": "substitution", "ref": 949, "refBase": "C", "readBase": "T", "read": 248, "common": true, "asSupplied": { "read": 50, "readBase": "A" } }, { "kind": "substitution", "ref": 951, "refBase": "G", "readBase": "T", "read": 250, "common": true, "asSupplied": { "read": 48, "readBase": "A" } }, { "kind": "substitution", "ref": 955, "refBase": "T", "readBase": "C", "read": 254, "common": true, "asSupplied": { "read": 44, "readBase": "G" } }, { "kind": "substitution", "ref": 956, "refBase": "T", "readBase": "A", "read": 255, "common": true, "asSupplied": { "read": 43, "readBase": "T" } }, { "kind": "substitution", "ref": 957, "refBase": "T", "readBase": "G", "read": 256, "common": true, "asSupplied": { "read": 42, "readBase": "C" } }, { "kind": "substitution", "ref": 959, "refBase": "G", "readBase": "C", "read": 258, "common": true, "asSupplied": { "read": 40, "readBase": "G" } }, { "kind": "insertion", "refAfter": 960, "length": 1, "bases": "A", "readStart": 260, "readEnd": 260, "asSupplied": { "readStart": 38, "readEnd": 38, "bases": "T" }, "common": true }, { "kind": "insertion", "refAfter": 963, "length": 1, "bases": "A", "readStart": 264, "readEnd": 264, "asSupplied": { "readStart": 34, "readEnd": 34, "bases": "T" }, "common": false, "notFixed": { "from": { "ref": 962, "read": 262, "readAsSupplied": 36 }, "to": { "ref": 965, "read": 269, "readAsSupplied": 29 } } }, { "kind": "insertion", "refAfter": 964, "length": 3, "bases": "GCG", "readStart": 266, "readEnd": 268, "asSupplied": { "readStart": 30, "readEnd": 32, "bases": "CGC" }, "common": false, "notFixed": { "from": { "ref": 962, "read": 262, "readAsSupplied": 36 }, "to": { "ref": 965, "read": 269, "readAsSupplied": 29 } } }, { "kind": "substitution", "ref": 966, "refBase": "G", "readBase": "T", "read": 270, "common": true, "asSupplied": { "read": 28, "readBase": "A" } }, { "kind": "substitution", "ref": 968, "refBase": "G", "readBase": "C", "read": 272, "common": true, "asSupplied": { "read": 26, "readBase": "G" } }, { "kind": "insertion", "refAfter": 970, "length": 1, "bases": "G", "readStart": 275, "readEnd": 275, "asSupplied": { "readStart": 23, "readEnd": 23, "bases": "C" }, "common": false, "notFixed": { "from": { "ref": 970, "read": 274, "readAsSupplied": 24 }, "to": { "ref": 973, "read": 278, "readAsSupplied": 20 } } }, { "kind": "substitution", "ref": 972, "refBase": "A", "readBase": "G", "read": 277, "common": false, "notFixed": { "from": { "ref": 970, "read": 274, "readAsSupplied": 24 }, "to": { "ref": 973, "read": 278, "readAsSupplied": 20 } }, "asSupplied": { "read": 21, "readBase": "C" } }, { "kind": "substitution", "ref": 974, "refBase": "C", "readBase": "A", "read": 279, "common": true, "asSupplied": { "read": 19, "readBase": "T" } }, { "kind": "substitution", "ref": 975, "refBase": "C", "readBase": "G", "read": 280, "common": true, "asSupplied": { "read": 18, "readBase": "C" } }, { "kind": "substitution", "ref": 977, "refBase": "G", "readBase": "T", "read": 282, "common": true, "asSupplied": { "read": 16, "readBase": "A" } }, { "kind": "substitution", "ref": 978, "refBase": "C", "readBase": "T", "read": 283, "common": true, "asSupplied": { "read": 15, "readBase": "A" } }, { "kind": "substitution", "ref": 982, "refBase": "G", "readBase": "C", "read": 287, "common": true, "asSupplied": { "read": 11, "readBase": "G" } }, { "kind": "insertion", "refAfter": 983, "length": 3, "bases": "CCG", "readStart": 289, "readEnd": 291, "asSupplied": { "readStart": 7, "readEnd": 9, "bases": "CGG" }, "common": false, "notFixed": { "from": { "ref": 983, "read": 288, "readAsSupplied": 10 }, "to": null } } ] }, "band": { "diagonalMin": 692, "diagonalMax": 738, "cellsNeeded": 14602, "unionBandLimited": false, "scope": "every optimal path", "gridCells": 447298, "searchedBanded": true, "sharedWords": 0, "sharedWordsOverCap": false, "seedGuarantee": { "differencesUpTo": 357, "guaranteed": false } }, "enumeration": "not-enumerated", "placements": [ { "refStart": 736, "refEnd": 993, "crossesOrigin": false, "wholeCircle": false, "readStart": 1, "readEnd": 297, "asSupplied": { "readStart": 1, "readEnd": 297 } } ] } }, { "mode": "local", "region": null, "strand": "+", "strandUndetermined": false, "plus": { "score": 575, "count": 2, "overCap": false, "state": "aligned", "biopython": { "score": 575, "count": 2 }, "uniquePairs": [ [ 401, 1 ], [ 402, 2 ], [ 403, 3 ], [ 404, 4 ], [ 405, 5 ], [ 406, 6 ], [ 407, 7 ], [ 408, 8 ], [ 409, 9 ], [ 410, 10 ], [ 411, 11 ], [ 412, 12 ], [ 413, 13 ], [ 414, 14 ], [ 415, 15 ], [ 416, 16 ], [ 417, 17 ], [ 418, 18 ], [ 419, 19 ], [ 420, 20 ], [ 421, 21 ], [ 422, 22 ], [ 423, 23 ], [ 424, 24 ], [ 425, 25 ], [ 426, 26 ], [ 427, 27 ], [ 428, 28 ], [ 429, 29 ], [ 430, 30 ], [ 431, 31 ], [ 432, 32 ], [ 433, 33 ], [ 434, 34 ], [ 435, 35 ], [ 436, 36 ], [ 437, 37 ], [ 438, 38 ], [ 439, 39 ], [ 440, 40 ], [ 441, 41 ], [ 442, 42 ], [ 443, 43 ], [ 444, 44 ], [ 445, 45 ], [ 446, 46 ], [ 447, 47 ], [ 448, 48 ], [ 449, 49 ], [ 450, 50 ], [ 451, 51 ], [ 452, 52 ], [ 453, 53 ], [ 454, 54 ], [ 455, 55 ], [ 456, 56 ], [ 457, 57 ], [ 458, 58 ], [ 459, 59 ], [ 460, 60 ], [ 461, 61 ], [ 462, 62 ], [ 463, 63 ], [ 464, 64 ], [ 465, 65 ], [ 466, 66 ], [ 467, 67 ], [ 468, 68 ], [ 469, 69 ], [ 470, 70 ], [ 471, 71 ], [ 472, 72 ], [ 473, 73 ], [ 474, 74 ], [ 475, 75 ], [ 476, 76 ], [ 477, 77 ], [ 478, 78 ], [ 479, 79 ], [ 480, 80 ], [ 481, 81 ], [ 482, 82 ], [ 483, 83 ], [ 484, 84 ], [ 485, 85 ], [ 486, 86 ], [ 487, 87 ], [ 488, 88 ], [ 489, 89 ], [ 490, 90 ], [ 491, 91 ], [ 492, 92 ], [ 493, 93 ], [ 494, 94 ], [ 495, 95 ], [ 496, 96 ], [ 497, 97 ], [ 498, 98 ], [ 499, 99 ], [ 500, 100 ], [ 501, 101 ], [ 502, 102 ], [ 503, 103 ], [ 504, 104 ], [ 505, 105 ], [ 506, 106 ], [ 507, 107 ], [ 508, 108 ], [ 509, 109 ], [ 510, 110 ], [ 511, 111 ], [ 512, 112 ], [ 513, 113 ], [ 514, 114 ], [ 515, 115 ], [ 516, 116 ], [ 517, 117 ], [ 518, 118 ], [ 519, 119 ], [ 520, 120 ], [ 521, 121 ], [ 522, 122 ], [ 523, 123 ], [ 524, 124 ], [ 525, 125 ], [ 526, 126 ], [ 527, 127 ], [ 528, 128 ], [ 529, 129 ], [ 530, 130 ], [ 531, 131 ], [ 532, 132 ], [ 533, 133 ], [ 534, 134 ], [ 535, 135 ], [ 536, 136 ], [ 537, 137 ], [ 538, 138 ], [ 539, 139 ], [ 540, 140 ], [ 541, 141 ], [ 542, 142 ], [ 543, 143 ], [ 544, 144 ], [ 545, 145 ], [ 546, 146 ], [ 547, 147 ], [ 548, 148 ], [ 549, 149 ], [ 554, 151 ], [ 555, 152 ], [ 556, 153 ], [ 557, 154 ], [ 558, 155 ], [ 559, 156 ], [ 560, 157 ], [ 561, 158 ], [ 562, 159 ], [ 563, 160 ], [ 564, 161 ], [ 565, 162 ], [ 566, 163 ], [ 567, 164 ], [ 568, 165 ], [ 569, 166 ], [ 570, 167 ], [ 571, 168 ], [ 572, 169 ], [ 573, 170 ], [ 574, 171 ], [ 575, 172 ], [ 576, 173 ], [ 577, 174 ], [ 578, 175 ], [ 579, 176 ], [ 580, 177 ], [ 581, 178 ], [ 582, 179 ], [ 583, 180 ], [ 584, 181 ], [ 585, 182 ], [ 586, 183 ], [ 587, 184 ], [ 588, 185 ], [ 589, 186 ], [ 590, 187 ], [ 591, 188 ], [ 592, 189 ], [ 593, 190 ], [ 594, 191 ], [ 595, 192 ], [ 596, 193 ], [ 597, 194 ], [ 598, 195 ], [ 599, 196 ], [ 600, 197 ], [ 601, 198 ], [ 602, 199 ], [ 603, 200 ], [ 604, 201 ], [ 605, 202 ], [ 606, 203 ], [ 607, 204 ], [ 608, 205 ], [ 609, 206 ], [ 610, 207 ], [ 611, 208 ], [ 612, 209 ], [ 613, 210 ], [ 614, 211 ], [ 615, 212 ], [ 616, 213 ], [ 617, 214 ], [ 618, 215 ], [ 619, 216 ], [ 620, 217 ], [ 621, 218 ], [ 622, 219 ], [ 623, 220 ], [ 624, 221 ], [ 625, 222 ], [ 626, 223 ], [ 627, 224 ], [ 628, 225 ], [ 629, 226 ], [ 630, 227 ], [ 631, 228 ], [ 632, 229 ], [ 633, 230 ], [ 634, 231 ], [ 635, 232 ], [ 636, 233 ], [ 637, 234 ], [ 638, 235 ], [ 639, 236 ], [ 640, 237 ], [ 641, 238 ], [ 642, 239 ], [ 643, 240 ], [ 644, 241 ], [ 645, 242 ], [ 646, 243 ], [ 647, 244 ], [ 648, 245 ], [ 649, 246 ], [ 650, 247 ], [ 651, 248 ], [ 652, 249 ], [ 653, 250 ], [ 654, 251 ], [ 655, 252 ], [ 656, 253 ], [ 657, 254 ], [ 658, 255 ], [ 659, 256 ], [ 660, 257 ], [ 661, 258 ], [ 662, 259 ], [ 663, 260 ], [ 664, 261 ], [ 665, 262 ], [ 666, 263 ], [ 667, 264 ], [ 668, 265 ], [ 669, 266 ], [ 670, 267 ], [ 671, 268 ], [ 672, 269 ], [ 673, 270 ], [ 674, 271 ], [ 675, 272 ], [ 676, 273 ], [ 677, 274 ], [ 678, 275 ], [ 679, 276 ], [ 680, 277 ], [ 681, 278 ], [ 682, 279 ], [ 683, 280 ], [ 684, 281 ], [ 685, 282 ], [ 686, 283 ], [ 687, 284 ], [ 688, 285 ], [ 689, 286 ], [ 690, 287 ], [ 691, 288 ], [ 692, 289 ], [ 693, 290 ], [ 694, 291 ], [ 695, 292 ], [ 696, 293 ], [ 697, 294 ], [ 698, 295 ], [ 699, 296 ], [ 700, 297 ] ], "uniquePlacement": true, "placementNotDetermined": false, "noCommonColumn": false, "hull": { "refStart": 401, "refEnd": 700, "crossesOrigin": false, "wholeCircle": false }, "selected": { "coordinates": [ [ 400, 549, 552, 700 ], [ 0, 149, 149, 297 ] ], "gappedReference": "AAGCGGCGGTGCACAATCTTCTCGCGCAACGCGTCAGTGGGCTGATCATTAACTATCCGCTGGATGACCAGGATGCCATTGCTGTGGAAGCTGCCTGCACTAATGTTCCGGCGTTATTTCTTGATGTCTCTGACCAGACACCCATCAACAGTATTATTTTCTCCCATGAAGACGGTACGCGACTGGGCGTGGAGCATCTGGTCGCATTGGGTCACCAGCAAATCGCGCTGTTAGCGGGCCCATTAAGTTCTGTCTCGGCGCGTCTGCGTCTGGCTGGCTGGCATAAATATCTCACTCGCA", "gappedRead": "AAGCGGCGGTGCACAATCTTCTCGCGCAACGCGTCAGTGGGCTGATCATAAACTATCCGCTGGATGACCAGGATGCCATTGCTGTGGAAGCTGCCTGCACTAATGTTCCGGCGTTATTTCTTGATGTCTCTGACCAGACACCCATCAAC---ATTATTTTCTCCCATGAAGACGGTACGCGACTGGGCGTGGAGCATCTGGTCGCATTGGGTCACCAGCAAATCGCGCTGTTAGCGGGCCCAATAAGTTCTGTCTCGGCGCGTCTGCGTCTGGCTGGCTGGCATAAATATCTCACTCGCA", "columns": 300, "identical": 295, "mismatches": 2, "ambiguousColumns": 0, "gapColumns": 3, "gapOpens": 1, "identity": { "numerator": 295, "denominator": 300 }, "readAligned": { "bases": 297, "of": 297 }, "referenceCovered": { "bases": 300, "of": 1500 }, "placement": { "refStart": 401, "refEnd": 700, "readStart": 1, "readEnd": 297, "crossesOrigin": false }, "overhang": [], "differences": [ { "kind": "substitution", "ref": 450, "refBase": "T", "readBase": "A", "read": 50, "common": true }, { "kind": "deletion", "refStart": 550, "refEnd": 552, "length": 3, "bases": "AGT", "readAfter": 149, "common": false, "notFixed": { "from": { "ref": 549, "read": 149 }, "to": { "ref": 554, "read": 151 } } }, { "kind": "substitution", "ref": 643, "refBase": "T", "readBase": "A", "read": 240, "common": true } ] }, "band": { "diagonalMin": 400, "diagonalMax": 403, "cellsNeeded": 1788, "unionBandLimited": false, "scope": "every optimal path", "gridCells": 447298, "searchedBanded": true, "sharedWords": 252, "sharedWordsOverCap": false, "seedGuarantee": { "differencesUpTo": 9, "guaranteed": true } }, "enumeration": "listed", "alignments": [ [ [ 400, 549, 552, 700 ], [ 0, 149, 149, 297 ] ], [ [ 400, 550, 553, 700 ], [ 0, 150, 150, 297 ] ] ], "tuples": [ [ 295, 0, 300, 2, 3, 1, 297, 300 ] ], "tupleFields": [ "identical", "ambiguousColumns", "columns", "mismatches", "gapColumns", "gapOpens", "readAligned", "referenceCovered" ], "variation": { "readAligned": { "shared": true, "min": 297, "max": 297 }, "referenceCovered": { "shared": true, "min": 300, "max": 300 }, "identity": { "shared": true, "min": { "numerator": 59, "denominator": 60 }, "max": { "numerator": 59, "denominator": 60 } }, "overhangStart": { "shared": true, "min": 0, "max": 0 }, "overhangEnd": { "shared": true, "min": 0, "max": 0 } }, "placements": [ { "refStart": 401, "refEnd": 700, "crossesOrigin": false, "wholeCircle": false, "readStart": 1, "readEnd": 297, "alignments": 2, "band": { "diagonalMin": 400, "diagonalMax": 403, "cellsNeeded": 1788, "bandLimited": false } } ] }, "minus": { "score": 21, "count": 4, "overCap": false, "state": "aligned", "biopython": { "score": 21, "count": 4 }, "uniquePairs": [ [ 799, 75 ], [ 800, 76 ], [ 801, 77 ], [ 802, 78 ], [ 804, 82 ], [ 805, 83 ], [ 806, 84 ], [ 807, 85 ], [ 808, 86 ], [ 811, 88 ], [ 812, 91 ], [ 813, 92 ], [ 814, 93 ], [ 815, 94 ], [ 816, 97 ], [ 817, 98 ], [ 818, 99 ], [ 819, 100 ], [ 820, 101 ], [ 821, 102 ], [ 822, 103 ], [ 823, 104 ], [ 824, 105 ], [ 825, 106 ] ], "uniquePlacement": true, "placementNotDetermined": false, "noCommonColumn": false, "hull": { "refStart": 799, "refEnd": 825, "crossesOrigin": false, "wholeCircle": false }, "selected": { "coordinates": [ [ 798, 802, 802, 808, 809, 811, 811, 815, 815, 825 ], [ 74, 78, 80, 86, 86, 88, 90, 94, 96, 106 ] ], "gappedReference": "GCGA--TGCTGGTTG--CCAA--CGATCAGATG", "gappedRead": "GCGATTTGCTGG-TGACCCAATGCGACCAGATG", "columns": 33, "identical": 25, "mismatches": 1, "ambiguousColumns": 0, "gapColumns": 7, "gapOpens": 4, "identity": { "numerator": 25, "denominator": 33 }, "readAligned": { "bases": 32, "of": 297 }, "referenceCovered": { "bases": 27, "of": 1500 }, "placement": { "refStart": 799, "refEnd": 825, "readStart": 75, "readEnd": 106, "crossesOrigin": false, "asSupplied": { "readStart": 192, "readEnd": 223 } }, "overhang": [], "differences": [ { "kind": "insertion", "refAfter": 802, "length": 2, "bases": "TT", "readStart": 79, "readEnd": 80, "asSupplied": { "readStart": 218, "readEnd": 219, "bases": "AA" }, "common": false, "notFixed": { "from": { "ref": 802, "read": 78, "readAsSupplied": 220 }, "to": { "ref": 804, "read": 82, "readAsSupplied": 216 } } }, { "kind": "deletion", "refStart": 809, "refEnd": 809, "length": 1, "bases": "T", "readAfter": 86, "asSupplied": { "readBetween": [ 211, 212 ] }, "common": false, "notFixed": { "from": { "ref": 808, "read": 86, "readAsSupplied": 212 }, "to": { "ref": 811, "read": 88, "readAsSupplied": 210 } } }, { "kind": "insertion", "refAfter": 811, "length": 2, "bases": "AC", "readStart": 89, "readEnd": 90, "asSupplied": { "readStart": 208, "readEnd": 209, "bases": "GT" }, "common": true }, { "kind": "insertion", "refAfter": 815, "length": 2, "bases": "TG", "readStart": 95, "readEnd": 96, "asSupplied": { "readStart": 202, "readEnd": 203, "bases": "CA" }, "common": true }, { "kind": "substitution", "ref": 819, "refBase": "T", "readBase": "C", "read": 100, "common": true, "asSupplied": { "read": 198, "readBase": "G" } } ] }, "band": { "diagonalMin": 719, "diagonalMax": 724, "cellsNeeded": 2384, "unionBandLimited": false, "scope": "every optimal path", "gridCells": 447298, "searchedBanded": true, "sharedWords": 0, "sharedWordsOverCap": false, "seedGuarantee": { "differencesUpTo": 286, "guaranteed": false } }, "enumeration": "listed", "alignments": [ [ [ 798, 802, 802, 808, 809, 811, 811, 815, 815, 825 ], [ 74, 78, 80, 86, 86, 88, 90, 94, 96, 106 ] ], [ [ 798, 803, 803, 808, 809, 811, 811, 815, 815, 825 ], [ 74, 79, 81, 86, 86, 88, 90, 94, 96, 106 ] ], [ [ 798, 802, 802, 809, 810, 811, 811, 815, 815, 825 ], [ 74, 78, 80, 87, 87, 88, 90, 94, 96, 106 ] ], [ [ 798, 803, 803, 809, 810, 811, 811, 815, 815, 825 ], [ 74, 79, 81, 87, 87, 88, 90, 94, 96, 106 ] ] ], "tuples": [ [ 25, 0, 33, 1, 7, 4, 32, 27 ] ], "tupleFields": [ "identical", "ambiguousColumns", "columns", "mismatches", "gapColumns", "gapOpens", "readAligned", "referenceCovered" ], "variation": { "readAligned": { "shared": true, "min": 32, "max": 32 }, "referenceCovered": { "shared": true, "min": 27, "max": 27 }, "identity": { "shared": true, "min": { "numerator": 25, "denominator": 33 }, "max": { "numerator": 25, "denominator": 33 } }, "overhangStart": { "shared": true, "min": 0, "max": 0 }, "overhangEnd": { "shared": true, "min": 0, "max": 0 } }, "placements": [ { "refStart": 799, "refEnd": 825, "crossesOrigin": false, "wholeCircle": false, "readStart": 75, "readEnd": 106, "asSupplied": { "readStart": 192, "readEnd": 223 }, "alignments": 4, "band": { "diagonalMin": 719, "diagonalMax": 724, "cellsNeeded": 2384, "bandLimited": false } } ] } } ] } }, { "id": "band-limited", "note": "A read of J01636.1 51-200 then 301-450 on 1-600: the optimal path needs a 100-base deletion, a band wider than the budget allows, so a banded search must say band-limited.", "input": { "reference": { "residues": "GACACCATCGAATGGCGCAAAACCTTTCGCGGTATGGCATGATAGCGCCCGGAAGAGAGTCAATTCAGGGTGGTGAATGTGAAACCAGTAACGTTATACGATGTCGCAGAGTATGCCGGTGTCTCTTATCAGACCGTTTCCCGCGTGGTGAACCAGGCCAGCCACGTTTCTGCGAAAACGCGGGAAAAAGTGGAAGCGGCGATGGCGGAGCTGAATTACATTCCCAACCGCGTGGCACAACAACTGGCGGGCAAACAGTCGTTGCTGATTGGCGTTGCCACCTCCAGTCTGGCCCTGCACGCGCCGTCGCAAATTGTCGCGGCGATTAAATCTCGCGCCGATCAACTGGGTGCCAGCGTGGTGGTGTCGATGGTAGAACGAAGCGGCGTCGAAGCCTGTAAAGCGGCGGTGCACAATCTTCTCGCGCAACGCGTCAGTGGGCTGATCATTAACTATCCGCTGGATGACCAGGATGCCATTGCTGTGGAAGCTGCCTGCACTAATGTTCCGGCGTTATTTCTTGATGTCTCTGACCAGACACCCATCAACAGTATTATTTTCTCCCATGAAGACGGTACGCGACTGGGCGTGGAGCATCTG", "topology": "linear", "source": "J01636.1 1-600" }, "read": { "residues": "GGAAGAGAGTCAATTCAGGGTGGTGAATGTGAAACCAGTAACGTTATACGATGTCGCAGAGTATGCCGGTGTCTCTTATCAGACCGTTTCCCGCGTGGTGAACCAGGCCAGCCACGTTTCTGCGAAAACGCGGGAAAAAGTGGAAGCGGCGCGCCGTCGCAAATTGTCGCGGCGATTAAATCTCGCGCCGATCAACTGGGTGCCAGCGTGGTGGTGTCGATGGTAGAACGAAGCGGCGTCGAAGCCTGTAAAGCGGCGGTGCACAATCTTCTCGCGCAACGCGTCAGTGGGCTGATCATT", "source": "J01636.1 51-200 and 301-450" }, "modes": [ "semiglobal-read", "local" ] }, "expected": { "results": [ { "mode": "semiglobal-read", "region": null, "strand": "+", "strandUndetermined": false, "plus": { "score": 397, "count": 3, "overCap": false, "state": "aligned", "biopython": { "score": 397, "count": 3 }, "uniquePairs": [ [ 51, 1 ], [ 52, 2 ], [ 53, 3 ], [ 54, 4 ], [ 55, 5 ], [ 56, 6 ], [ 57, 7 ], [ 58, 8 ], [ 59, 9 ], [ 60, 10 ], [ 61, 11 ], [ 62, 12 ], [ 63, 13 ], [ 64, 14 ], [ 65, 15 ], [ 66, 16 ], [ 67, 17 ], [ 68, 18 ], [ 69, 19 ], [ 70, 20 ], [ 71, 21 ], [ 72, 22 ], [ 73, 23 ], [ 74, 24 ], [ 75, 25 ], [ 76, 26 ], [ 77, 27 ], [ 78, 28 ], [ 79, 29 ], [ 80, 30 ], [ 81, 31 ], [ 82, 32 ], [ 83, 33 ], [ 84, 34 ], [ 85, 35 ], [ 86, 36 ], [ 87, 37 ], [ 88, 38 ], [ 89, 39 ], [ 90, 40 ], [ 91, 41 ], [ 92, 42 ], [ 93, 43 ], [ 94, 44 ], [ 95, 45 ], [ 96, 46 ], [ 97, 47 ], [ 98, 48 ], [ 99, 49 ], [ 100, 50 ], [ 101, 51 ], [ 102, 52 ], [ 103, 53 ], [ 104, 54 ], [ 105, 55 ], [ 106, 56 ], [ 107, 57 ], [ 108, 58 ], [ 109, 59 ], [ 110, 60 ], [ 111, 61 ], [ 112, 62 ], [ 113, 63 ], [ 114, 64 ], [ 115, 65 ], [ 116, 66 ], [ 117, 67 ], [ 118, 68 ], [ 119, 69 ], [ 120, 70 ], [ 121, 71 ], [ 122, 72 ], [ 123, 73 ], [ 124, 74 ], [ 125, 75 ], [ 126, 76 ], [ 127, 77 ], [ 128, 78 ], [ 129, 79 ], [ 130, 80 ], [ 131, 81 ], [ 132, 82 ], [ 133, 83 ], [ 134, 84 ], [ 135, 85 ], [ 136, 86 ], [ 137, 87 ], [ 138, 88 ], [ 139, 89 ], [ 140, 90 ], [ 141, 91 ], [ 142, 92 ], [ 143, 93 ], [ 144, 94 ], [ 145, 95 ], [ 146, 96 ], [ 147, 97 ], [ 148, 98 ], [ 149, 99 ], [ 150, 100 ], [ 151, 101 ], [ 152, 102 ], [ 153, 103 ], [ 154, 104 ], [ 155, 105 ], [ 156, 106 ], [ 157, 107 ], [ 158, 108 ], [ 159, 109 ], [ 160, 110 ], [ 161, 111 ], [ 162, 112 ], [ 163, 113 ], [ 164, 114 ], [ 165, 115 ], [ 166, 116 ], [ 167, 117 ], [ 168, 118 ], [ 169, 119 ], [ 170, 120 ], [ 171, 121 ], [ 172, 122 ], [ 173, 123 ], [ 174, 124 ], [ 175, 125 ], [ 176, 126 ], [ 177, 127 ], [ 178, 128 ], [ 179, 129 ], [ 180, 130 ], [ 181, 131 ], [ 182, 132 ], [ 183, 133 ], [ 184, 134 ], [ 185, 135 ], [ 186, 136 ], [ 187, 137 ], [ 188, 138 ], [ 189, 139 ], [ 190, 140 ], [ 191, 141 ], [ 192, 142 ], [ 193, 143 ], [ 194, 144 ], [ 195, 145 ], [ 196, 146 ], [ 197, 147 ], [ 198, 148 ], [ 199, 149 ], [ 302, 152 ], [ 303, 153 ], [ 304, 154 ], [ 305, 155 ], [ 306, 156 ], [ 307, 157 ], [ 308, 158 ], [ 309, 159 ], [ 310, 160 ], [ 311, 161 ], [ 312, 162 ], [ 313, 163 ], [ 314, 164 ], [ 315, 165 ], [ 316, 166 ], [ 317, 167 ], [ 318, 168 ], [ 319, 169 ], [ 320, 170 ], [ 321, 171 ], [ 322, 172 ], [ 323, 173 ], [ 324, 174 ], [ 325, 175 ], [ 326, 176 ], [ 327, 177 ], [ 328, 178 ], [ 329, 179 ], [ 330, 180 ], [ 331, 181 ], [ 332, 182 ], [ 333, 183 ], [ 334, 184 ], [ 335, 185 ], [ 336, 186 ], [ 337, 187 ], [ 338, 188 ], [ 339, 189 ], [ 340, 190 ], [ 341, 191 ], [ 342, 192 ], [ 343, 193 ], [ 344, 194 ], [ 345, 195 ], [ 346, 196 ], [ 347, 197 ], [ 348, 198 ], [ 349, 199 ], [ 350, 200 ], [ 351, 201 ], [ 352, 202 ], [ 353, 203 ], [ 354, 204 ], [ 355, 205 ], [ 356, 206 ], [ 357, 207 ], [ 358, 208 ], [ 359, 209 ], [ 360, 210 ], [ 361, 211 ], [ 362, 212 ], [ 363, 213 ], [ 364, 214 ], [ 365, 215 ], [ 366, 216 ], [ 367, 217 ], [ 368, 218 ], [ 369, 219 ], [ 370, 220 ], [ 371, 221 ], [ 372, 222 ], [ 373, 223 ], [ 374, 224 ], [ 375, 225 ], [ 376, 226 ], [ 377, 227 ], [ 378, 228 ], [ 379, 229 ], [ 380, 230 ], [ 381, 231 ], [ 382, 232 ], [ 383, 233 ], [ 384, 234 ], [ 385, 235 ], [ 386, 236 ], [ 387, 237 ], [ 388, 238 ], [ 389, 239 ], [ 390, 240 ], [ 391, 241 ], [ 392, 242 ], [ 393, 243 ], [ 394, 244 ], [ 395, 245 ], [ 396, 246 ], [ 397, 247 ], [ 398, 248 ], [ 399, 249 ], [ 400, 250 ], [ 401, 251 ], [ 402, 252 ], [ 403, 253 ], [ 404, 254 ], [ 405, 255 ], [ 406, 256 ], [ 407, 257 ], [ 408, 258 ], [ 409, 259 ], [ 410, 260 ], [ 411, 261 ], [ 412, 262 ], [ 413, 263 ], [ 414, 264 ], [ 415, 265 ], [ 416, 266 ], [ 417, 267 ], [ 418, 268 ], [ 419, 269 ], [ 420, 270 ], [ 421, 271 ], [ 422, 272 ], [ 423, 273 ], [ 424, 274 ], [ 425, 275 ], [ 426, 276 ], [ 427, 277 ], [ 428, 278 ], [ 429, 279 ], [ 430, 280 ], [ 431, 281 ], [ 432, 282 ], [ 433, 283 ], [ 434, 284 ], [ 435, 285 ], [ 436, 286 ], [ 437, 287 ], [ 438, 288 ], [ 439, 289 ], [ 440, 290 ], [ 441, 291 ], [ 442, 292 ], [ 443, 293 ], [ 444, 294 ], [ 445, 295 ], [ 446, 296 ], [ 447, 297 ], [ 448, 298 ], [ 449, 299 ], [ 450, 300 ] ], "uniquePlacement": true, "placementNotDetermined": false, "noCommonColumn": false, "hull": { "refStart": 51, "refEnd": 450, "crossesOrigin": false, "wholeCircle": false }, "selected": { "coordinates": [ [ 0, 50, 199, 299, 450, 600 ], [ 0, 0, 149, 149, 300, 300 ] ], "gappedReference": "GGAAGAGAGTCAATTCAGGGTGGTGAATGTGAAACCAGTAACGTTATACGATGTCGCAGAGTATGCCGGTGTCTCTTATCAGACCGTTTCCCGCGTGGTGAACCAGGCCAGCCACGTTTCTGCGAAAACGCGGGAAAAAGTGGAAGCGGCGATGGCGGAGCTGAATTACATTCCCAACCGCGTGGCACAACAACTGGCGGGCAAACAGTCGTTGCTGATTGGCGTTGCCACCTCCAGTCTGGCCCTGCACGCGCCGTCGCAAATTGTCGCGGCGATTAAATCTCGCGCCGATCAACTGGGTGCCAGCGTGGTGGTGTCGATGGTAGAACGAAGCGGCGTCGAAGCCTGTAAAGCGGCGGTGCACAATCTTCTCGCGCAACGCGTCAGTGGGCTGATCATT", "gappedRead": "GGAAGAGAGTCAATTCAGGGTGGTGAATGTGAAACCAGTAACGTTATACGATGTCGCAGAGTATGCCGGTGTCTCTTATCAGACCGTTTCCCGCGTGGTGAACCAGGCCAGCCACGTTTCTGCGAAAACGCGGGAAAAAGTGGAAGCGG----------------------------------------------------------------------------------------------------CGCGCCGTCGCAAATTGTCGCGGCGATTAAATCTCGCGCCGATCAACTGGGTGCCAGCGTGGTGGTGTCGATGGTAGAACGAAGCGGCGTCGAAGCCTGTAAAGCGGCGGTGCACAATCTTCTCGCGCAACGCGTCAGTGGGCTGATCATT", "columns": 400, "identical": 300, "mismatches": 0, "ambiguousColumns": 0, "gapColumns": 100, "gapOpens": 1, "identity": { "numerator": 300, "denominator": 400 }, "readAligned": { "bases": 300, "of": 300 }, "referenceCovered": { "bases": 400, "of": 600 }, "placement": { "refStart": 51, "refEnd": 450, "readStart": 1, "readEnd": 300, "crossesOrigin": false }, "overhang": [], "differences": [ { "kind": "deletion", "refStart": 200, "refEnd": 299, "length": 100, "bases": "CGATGGCGGAGCTGAATTACATTCCCAACCGCGTGGCACAACAACTGGCGGGCAAACAGTCGTTGCTGATTGGCGTTGCCACCTCCAGTCTGGCCCTGCA", "readAfter": 149, "common": false, "notFixed": { "from": { "ref": 199, "read": 149 }, "to": { "ref": 302, "read": 152 } } } ] }, "band": { "diagonalMin": 50, "diagonalMax": 150, "cellsNeeded": 31003, "unionBandLimited": true, "scope": "every optimal path", "gridCells": 180901, "searchedBanded": true, "sharedWords": 280, "sharedWordsOverCap": false, "seedGuarantee": { "differencesUpTo": 101, "guaranteed": false } }, "enumeration": "listed", "alignments": [ [ [ 0, 50, 199, 299, 450, 600 ], [ 0, 0, 149, 149, 300, 300 ] ], [ [ 0, 50, 200, 300, 450, 600 ], [ 0, 0, 150, 150, 300, 300 ] ], [ [ 0, 50, 201, 301, 450, 600 ], [ 0, 0, 151, 151, 300, 300 ] ] ], "tuples": [ [ 300, 0, 400, 0, 100, 1, 300, 400 ] ], "tupleFields": [ "identical", "ambiguousColumns", "columns", "mismatches", "gapColumns", "gapOpens", "readAligned", "referenceCovered" ], "variation": { "readAligned": { "shared": true, "min": 300, "max": 300 }, "referenceCovered": { "shared": true, "min": 400, "max": 400 }, "identity": { "shared": true, "min": { "numerator": 3, "denominator": 4 }, "max": { "numerator": 3, "denominator": 4 } }, "overhangStart": { "shared": true, "min": 0, "max": 0 }, "overhangEnd": { "shared": true, "min": 0, "max": 0 } }, "placements": [ { "refStart": 51, "refEnd": 450, "crossesOrigin": false, "wholeCircle": false, "readStart": 1, "readEnd": 300, "alignments": 3, "band": { "diagonalMin": 50, "diagonalMax": 150, "cellsNeeded": 31003, "bandLimited": true } } ] }, "minus": { "score": -108, "count": 464486400, "overCap": true, "state": "aligned", "biopython": { "score": -108, "count": 464486400 }, "uniquePairs": [ [ 214, 1 ], [ 215, 2 ], [ 216, 3 ], [ 217, 4 ], [ 218, 5 ], [ 219, 7 ], [ 220, 8 ], [ 223, 10 ], [ 224, 11 ], [ 225, 12 ], [ 230, 19 ], [ 231, 20 ], [ 232, 21 ], [ 233, 22 ], [ 234, 23 ], [ 235, 24 ], [ 236, 25 ], [ 237, 26 ], [ 238, 27 ], [ 239, 28 ], [ 240, 29 ], [ 241, 30 ], [ 242, 31 ], [ 245, 36 ], [ 246, 37 ], [ 247, 39 ], [ 251, 47 ], [ 252, 48 ], [ 255, 52 ], [ 256, 53 ], [ 257, 54 ], [ 258, 55 ], [ 259, 59 ], [ 260, 60 ], [ 261, 61 ], [ 262, 62 ], [ 263, 63 ], [ 264, 64 ], [ 265, 65 ], [ 266, 66 ], [ 267, 67 ], [ 268, 68 ], [ 269, 69 ], [ 270, 70 ], [ 277, 83 ], [ 278, 84 ], [ 279, 85 ], [ 280, 86 ], [ 281, 87 ], [ 282, 88 ], [ 283, 89 ], [ 284, 90 ], [ 285, 91 ], [ 286, 92 ], [ 287, 93 ], [ 288, 94 ], [ 289, 95 ], [ 290, 96 ], [ 291, 97 ], [ 292, 98 ], [ 293, 99 ], [ 294, 101 ], [ 295, 102 ], [ 298, 103 ], [ 299, 104 ], [ 300, 105 ], [ 301, 106 ], [ 302, 107 ], [ 303, 108 ], [ 305, 111 ], [ 306, 112 ], [ 307, 113 ], [ 308, 114 ], [ 309, 115 ], [ 310, 116 ], [ 313, 120 ], [ 314, 121 ], [ 315, 122 ], [ 317, 126 ], [ 318, 127 ], [ 319, 128 ], [ 320, 129 ], [ 321, 130 ], [ 322, 131 ], [ 323, 132 ], [ 324, 133 ], [ 325, 134 ], [ 329, 136 ], [ 330, 137 ], [ 331, 138 ], [ 332, 139 ], [ 333, 140 ], [ 334, 148 ], [ 335, 149 ], [ 336, 150 ], [ 337, 151 ], [ 338, 152 ], [ 339, 153 ], [ 340, 154 ], [ 343, 158 ], [ 344, 159 ], [ 345, 160 ], [ 346, 161 ], [ 347, 162 ], [ 356, 170 ], [ 357, 171 ], [ 358, 172 ], [ 359, 173 ], [ 361, 186 ], [ 362, 187 ], [ 363, 188 ], [ 364, 189 ], [ 365, 191 ], [ 366, 192 ], [ 367, 193 ], [ 368, 194 ], [ 371, 196 ], [ 372, 197 ], [ 373, 198 ], [ 374, 199 ], [ 381, 205 ], [ 382, 206 ], [ 383, 207 ], [ 384, 208 ], [ 385, 209 ], [ 386, 210 ], [ 391, 211 ], [ 392, 212 ], [ 393, 213 ], [ 396, 219 ], [ 397, 220 ], [ 398, 221 ], [ 399, 223 ], [ 400, 224 ], [ 401, 225 ], [ 402, 227 ], [ 403, 228 ], [ 404, 230 ], [ 405, 231 ], [ 406, 232 ], [ 407, 233 ], [ 408, 234 ], [ 412, 236 ], [ 413, 237 ], [ 414, 238 ], [ 415, 239 ], [ 416, 240 ], [ 417, 241 ], [ 418, 242 ], [ 419, 243 ], [ 434, 260 ], [ 435, 261 ], [ 436, 262 ], [ 437, 263 ], [ 438, 264 ], [ 439, 265 ], [ 440, 266 ], [ 441, 267 ], [ 442, 268 ], [ 443, 269 ], [ 444, 270 ], [ 445, 271 ], [ 447, 272 ], [ 448, 273 ], [ 449, 274 ], [ 450, 275 ], [ 451, 276 ], [ 452, 277 ], [ 453, 278 ], [ 454, 279 ], [ 455, 280 ], [ 457, 281 ], [ 458, 282 ], [ 460, 283 ], [ 461, 284 ], [ 462, 285 ], [ 463, 286 ], [ 464, 287 ], [ 466, 290 ], [ 467, 291 ], [ 468, 292 ], [ 469, 294 ], [ 474, 297 ], [ 475, 298 ], [ 476, 299 ], [ 477, 300 ] ], "uniquePlacement": true, "placementNotDetermined": false, "noCommonColumn": false, "hull": { "refStart": 214, "refEnd": 477, "crossesOrigin": false, "wholeCircle": false }, "selected": { "coordinates": [ [ 0, 213, 218, 218, 220, 221, 226, 226, 227, 228, 242, 242, 246, 246, 247, 247, 249, 249, 252, 252, 258, 258, 272, 272, 293, 293, 295, 297, 303, 303, 310, 310, 315, 315, 325, 327, 333, 333, 340, 340, 347, 348, 359, 359, 360, 360, 364, 364, 368, 369, 374, 375, 386, 390, 393, 393, 398, 398, 401, 401, 403, 403, 408, 410, 421, 421, 429, 431, 445, 446, 455, 456, 458, 459, 464, 464, 468, 468, 469, 471, 477, 600 ], [ 0, 0, 5, 6, 8, 8, 13, 16, 17, 17, 31, 33, 37, 38, 39, 42, 44, 45, 48, 49, 55, 58, 72, 78, 99, 100, 102, 102, 108, 109, 116, 117, 122, 124, 134, 134, 140, 147, 154, 155, 162, 162, 173, 177, 178, 185, 189, 190, 194, 194, 199, 199, 210, 210, 213, 216, 221, 222, 225, 226, 228, 229, 234, 234, 245, 249, 257, 257, 271, 271, 280, 280, 282, 282, 287, 288, 292, 293, 294, 294, 300, 300 ] ], "gappedReference": "AATTA-CATTCCCA---ACCGCGTGGCACAACA--ACTG-G---CG-GGC-AAACAG---TCGTTGCTGATTGG------CGTTGCCACCTCCAGTCTGGC-CCTGCACGCG-CCGTCGC-AAATT--GTCGCGGCGATTAAATCT-------CGCGCCG-ATCAACTGGGTGCCAGCGT----G-------GTGG-TGTCGATGGTAGAACGAAGCGGCGTCGAA---GCCTG-TAA-AG-CGGCGGTGCACAATCTTC----TCGCGCAACGCGTCAGTGGGCTGATCATTAACTATCCGCTGGA-TGAC-CAGGATGCC", "gappedRead": "AATGATCA-GCCCACTGA-CGCGTTGCGCGAGAAGATTGTGCACCGCCGCTTTACAGGCTTCGACGCCGCTTCGTTCTACCATCGACACCACCACGCTGGCACC--CAGTTGATCGGCGCGAGATTTAATCGCCGCGA--CAATTTGCGACGGCGCGCCGCTTCCACT-TTTTCCCGCGTTTTCGCAGAAACGTGGCTGGC-CTGGT-TCACCACGCGG----GAAACGGTCTGATAAGAGACACCG--GCATACTCTGCGACATCGTATAA--CGTTACTGGTTTCA-CATTCACCA-CC-CTGAATTGACTC--TCTTCC", "columns": 322, "identical": 179, "mismatches": 63, "ambiguousColumns": 0, "gapColumns": 80, "gapOpens": 39, "identity": { "numerator": 179, "denominator": 322 }, "readAligned": { "bases": 300, "of": 300 }, "referenceCovered": { "bases": 264, "of": 600 }, "placement": { "refStart": 214, "refEnd": 477, "readStart": 1, "readEnd": 300, "crossesOrigin": false, "asSupplied": { "readStart": 1, "readEnd": 300 } }, "overhang": [], "differences": [ { "kind": "substitution", "ref": 217, "refBase": "T", "readBase": "G", "read": 4, "common": true, "asSupplied": { "read": 297, "readBase": "C" } }, { "kind": "insertion", "refAfter": 218, "length": 1, "bases": "T", "readStart": 6, "readEnd": 6, "asSupplied": { "readStart": 295, "readEnd": 295, "bases": "A" }, "common": true }, { "kind": "deletion", "refStart": 221, "refEnd": 221, "length": 1, "bases": "T", "readAfter": 8, "asSupplied": { "readBetween": [ 292, 293 ] }, "common": false, "notFixed": { "from": { "ref": 220, "read": 8, "readAsSupplied": 293 }, "to": { "ref": 223, "read": 10, "readAsSupplied": 291 } } }, { "kind": "substitution", "ref": 222, "refBase": "T", "readBase": "G", "read": 9, "common": false, "notFixed": { "from": { "ref": 220, "read": 8, "readAsSupplied": 293 }, "to": { "ref": 223, "read": 10, "readAsSupplied": 291 } }, "asSupplied": { "read": 292, "readBase": "C" } }, { "kind": "insertion", "refAfter": 226, "length": 3, "bases": "CTG", "readStart": 14, "readEnd": 16, "asSupplied": { "readStart": 285, "readEnd": 287, "bases": "CAG" }, "common": false, "notFixed": { "from": { "ref": 225, "read": 12, "readAsSupplied": 289 }, "to": { "ref": 230, "read": 19, "readAsSupplied": 282 } } }, { "kind": "deletion", "refStart": 228, "refEnd": 228, "length": 1, "bases": "C", "readAfter": 17, "asSupplied": { "readBetween": [ 283, 284 ] }, "common": false, "notFixed": { "from": { "ref": 225, "read": 12, "readAsSupplied": 289 }, "to": { "ref": 230, "read": 19, "readAsSupplied": 282 } } }, { "kind": "substitution", "ref": 234, "refBase": "G", "readBase": "T", "read": 23, "common": true, "asSupplied": { "read": 278, "readBase": "A" } }, { "kind": "substitution", "ref": 237, "refBase": "A", "readBase": "G", "read": 26, "common": true, "asSupplied": { "read": 275, "readBase": "C" } }, { "kind": "substitution", "ref": 239, "refBase": "A", "readBase": "G", "read": 28, "common": true, "asSupplied": { "read": 273, "readBase": "C" } }, { "kind": "substitution", "ref": 241, "refBase": "C", "readBase": "G", "read": 30, "common": true, "asSupplied": { "read": 271, "readBase": "C" } }, { "kind": "insertion", "refAfter": 242, "length": 2, "bases": "AG", "readStart": 32, "readEnd": 33, "asSupplied": { "readStart": 268, "readEnd": 269, "bases": "CT" }, "common": false, "notFixed": { "from": { "ref": 242, "read": 31, "readAsSupplied": 270 }, "to": { "ref": 245, "read": 36, "readAsSupplied": 265 } } }, { "kind": "substitution", "ref": 244, "refBase": "C", "readBase": "T", "read": 35, "common": false, "notFixed": { "from": { "ref": 242, "read": 31, "readAsSupplied": 270 }, "to": { "ref": 245, "read": 36, "readAsSupplied": 265 } }, "asSupplied": { "read": 266, "readBase": "A" } }, { "kind": "insertion", "refAfter": 246, "length": 1, "bases": "T", "readStart": 38, "readEnd": 38, "asSupplied": { "readStart": 263, "readEnd": 263, "bases": "A" }, "common": true }, { "kind": "insertion", "refAfter": 247, "length": 3, "bases": "CAC", "readStart": 40, "readEnd": 42, "asSupplied": { "readStart": 259, "readEnd": 261, "bases": "GTG" }, "common": false, "notFixed": { "from": { "ref": 247, "read": 39, "readAsSupplied": 262 }, "to": { "ref": 251, "read": 47, "readAsSupplied": 254 } } }, { "kind": "insertion", "refAfter": 249, "length": 1, "bases": "C", "readStart": 45, "readEnd": 45, "asSupplied": { "readStart": 256, "readEnd": 256, "bases": "G" }, "common": false, "notFixed": { "from": { "ref": 247, "read": 39, "readAsSupplied": 262 }, "to": { "ref": 251, "read": 47, "readAsSupplied": 254 } } }, { "kind": "substitution", "ref": 250, "refBase": "G", "readBase": "C", "read": 46, "common": false, "notFixed": { "from": { "ref": 247, "read": 39, "readAsSupplied": 262 }, "to": { "ref": 251, "read": 47, "readAsSupplied": 254 } }, "asSupplied": { "read": 255, "readBase": "G" } }, { "kind": "insertion", "refAfter": 252, "length": 1, "bases": "T", "readStart": 49, "readEnd": 49, "asSupplied": { "readStart": 252, "readEnd": 252, "bases": "A" }, "common": false, "notFixed": { "from": { "ref": 252, "read": 48, "readAsSupplied": 253 }, "to": { "ref": 255, "read": 52, "readAsSupplied": 249 } } }, { "kind": "substitution", "ref": 253, "refBase": "A", "readBase": "T", "read": 50, "common": false, "notFixed": { "from": { "ref": 252, "read": 48, "readAsSupplied": 253 }, "to": { "ref": 255, "read": 52, "readAsSupplied": 249 } }, "asSupplied": { "read": 251, "readBase": "A" } }, { "kind": "substitution", "ref": 254, "refBase": "A", "readBase": "T", "read": 51, "common": false, "notFixed": { "from": { "ref": 252, "read": 48, "readAsSupplied": 253 }, "to": { "ref": 255, "read": 52, "readAsSupplied": 249 } }, "asSupplied": { "read": 250, "readBase": "A" } }, { "kind": "insertion", "refAfter": 258, "length": 3, "bases": "GCT", "readStart": 56, "readEnd": 58, "asSupplied": { "readStart": 243, "readEnd": 245, "bases": "AGC" }, "common": true }, { "kind": "substitution", "ref": 262, "refBase": "T", "readBase": "A", "read": 62, "common": true, "asSupplied": { "read": 239, "readBase": "T" } }, { "kind": "substitution", "ref": 263, "refBase": "T", "readBase": "C", "read": 63, "common": true, "asSupplied": { "read": 238, "readBase": "G" } }, { "kind": "substitution", "ref": 266, "refBase": "T", "readBase": "C", "read": 66, "common": true, "asSupplied": { "read": 235, "readBase": "G" } }, { "kind": "substitution", "ref": 268, "refBase": "A", "readBase": "C", "read": 68, "common": true, "asSupplied": { "read": 233, "readBase": "G" } }, { "kind": "substitution", "ref": 271, "refBase": "G", "readBase": "C", "read": 71, "common": false, "notFixed": { "from": { "ref": 270, "read": 70, "readAsSupplied": 231 }, "to": { "ref": 277, "read": 83, "readAsSupplied": 218 } }, "asSupplied": { "read": 230, "readBase": "G" } }, { "kind": "insertion", "refAfter": 272, "length": 6, "bases": "TTCTAC", "readStart": 73, "readEnd": 78, "asSupplied": { "readStart": 223, "readEnd": 228, "bases": "GTAGAA" }, "common": false, "notFixed": { "from": { "ref": 270, "read": 70, "readAsSupplied": 231 }, "to": { "ref": 277, "read": 83, "readAsSupplied": 218 } } }, { "kind": "substitution", "ref": 274, "refBase": "G", "readBase": "A", "read": 80, "common": false, "notFixed": { "from": { "ref": 270, "read": 70, "readAsSupplied": 231 }, "to": { "ref": 277, "read": 83, "readAsSupplied": 218 } }, "asSupplied": { "read": 221, "readBase": "T" } }, { "kind": "substitution", "ref": 276, "refBase": "T", "readBase": "C", "read": 82, "common": false, "notFixed": { "from": { "ref": 270, "read": 70, "readAsSupplied": 231 }, "to": { "ref": 277, "read": 83, "readAsSupplied": 218 } }, "asSupplied": { "read": 219, "readBase": "G" } }, { "kind": "substitution", "ref": 278, "refBase": "C", "readBase": "A", "read": 84, "common": true, "asSupplied": { "read": 217, "readBase": "T" } }, { "kind": "substitution", "ref": 283, "refBase": "T", "readBase": "A", "read": 89, "common": true, "asSupplied": { "read": 212, "readBase": "T" } }, { "kind": "substitution", "ref": 287, "refBase": "G", "readBase": "C", "read": 93, "common": true, "asSupplied": { "read": 208, "readBase": "G" } }, { "kind": "substitution", "ref": 288, "refBase": "T", "readBase": "G", "read": 94, "common": true, "asSupplied": { "read": 207, "readBase": "C" } }, { "kind": "insertion", "refAfter": 293, "length": 1, "bases": "A", "readStart": 100, "readEnd": 100, "asSupplied": { "readStart": 201, "readEnd": 201, "bases": "T" }, "common": true }, { "kind": "deletion", "refStart": 296, "refEnd": 297, "length": 2, "bases": "TG", "readAfter": 102, "asSupplied": { "readBetween": [ 198, 199 ] }, "common": true }, { "kind": "substitution", "ref": 300, "refBase": "C", "readBase": "G", "read": 105, "common": true, "asSupplied": { "read": 196, "readBase": "C" } }, { "kind": "substitution", "ref": 301, "refBase": "G", "readBase": "T", "read": 106, "common": true, "asSupplied": { "read": 195, "readBase": "A" } }, { "kind": "substitution", "ref": 302, "refBase": "C", "readBase": "T", "read": 107, "common": true, "asSupplied": { "read": 194, "readBase": "A" } }, { "kind": "insertion", "refAfter": 303, "length": 1, "bases": "A", "readStart": 109, "readEnd": 109, "asSupplied": { "readStart": 192, "readEnd": 192, "bases": "T" }, "common": false, "notFixed": { "from": { "ref": 303, "read": 108, "readAsSupplied": 193 }, "to": { "ref": 305, "read": 111, "readAsSupplied": 190 } } }, { "kind": "substitution", "ref": 304, "refBase": "C", "readBase": "T", "read": 110, "common": false, "notFixed": { "from": { "ref": 303, "read": 108, "readAsSupplied": 193 }, "to": { "ref": 305, "read": 111, "readAsSupplied": 190 } }, "asSupplied": { "read": 191, "readBase": "A" } }, { "kind": "substitution", "ref": 307, "refBase": "T", "readBase": "G", "read": 113, "common": true, "asSupplied": { "read": 188, "readBase": "C" } }, { "kind": "insertion", "refAfter": 310, "length": 1, "bases": "G", "readStart": 117, "readEnd": 117, "asSupplied": { "readStart": 184, "readEnd": 184, "bases": "C" }, "common": false, "notFixed": { "from": { "ref": 310, "read": 116, "readAsSupplied": 185 }, "to": { "ref": 313, "read": 120, "readAsSupplied": 181 } } }, { "kind": "substitution", "ref": 312, "refBase": "A", "readBase": "G", "read": 119, "common": false, "notFixed": { "from": { "ref": 310, "read": 116, "readAsSupplied": 185 }, "to": { "ref": 313, "read": 120, "readAsSupplied": 181 } }, "asSupplied": { "read": 182, "readBase": "C" } }, { "kind": "insertion", "refAfter": 315, "length": 2, "bases": "TA", "readStart": 123, "readEnd": 124, "asSupplied": { "readStart": 177, "readEnd": 178, "bases": "TA" }, "common": false, "notFixed": { "from": { "ref": 315, "read": 122, "readAsSupplied": 179 }, "to": { "ref": 317, "read": 126, "readAsSupplied": 175 } } }, { "kind": "substitution", "ref": 316, "refBase": "G", "readBase": "A", "read": 125, "common": false, "notFixed": { "from": { "ref": 315, "read": 122, "readAsSupplied": 179 }, "to": { "ref": 317, "read": 126, "readAsSupplied": 175 } }, "asSupplied": { "read": 176, "readBase": "T" } }, { "kind": "substitution", "ref": 321, "refBase": "G", "readBase": "C", "read": 130, "common": true, "asSupplied": { "read": 171, "readBase": "G" } }, { "kind": "deletion", "refStart": 326, "refEnd": 327, "length": 2, "bases": "TT", "readAfter": 134, "asSupplied": { "readBetween": [ 166, 167 ] }, "common": false, "notFixed": { "from": { "ref": 325, "read": 134, "readAsSupplied": 167 }, "to": { "ref": 329, "read": 136, "readAsSupplied": 165 } } }, { "kind": "substitution", "ref": 328, "refBase": "A", "readBase": "C", "read": 135, "common": false, "notFixed": { "from": { "ref": 325, "read": 134, "readAsSupplied": 167 }, "to": { "ref": 329, "read": 136, "readAsSupplied": 165 } }, "asSupplied": { "read": 166, "readBase": "G" } }, { "kind": "substitution", "ref": 332, "refBase": "C", "readBase": "T", "read": 139, "common": true, "asSupplied": { "read": 162, "readBase": "A" } }, { "kind": "insertion", "refAfter": 333, "length": 7, "bases": "GCGACGG", "readStart": 141, "readEnd": 147, "asSupplied": { "readStart": 154, "readEnd": 160, "bases": "CCGTCGC" }, "common": true }, { "kind": "insertion", "refAfter": 340, "length": 1, "bases": "C", "readStart": 155, "readEnd": 155, "asSupplied": { "readStart": 146, "readEnd": 146, "bases": "G" }, "common": false, "notFixed": { "from": { "ref": 340, "read": 154, "readAsSupplied": 147 }, "to": { "ref": 343, "read": 158, "readAsSupplied": 143 } } }, { "kind": "substitution", "ref": 341, "refBase": "A", "readBase": "T", "read": 156, "common": false, "notFixed": { "from": { "ref": 340, "read": 154, "readAsSupplied": 147 }, "to": { "ref": 343, "read": 158, "readAsSupplied": 143 } }, "asSupplied": { "read": 145, "readBase": "A" } }, { "kind": "substitution", "ref": 344, "refBase": "A", "readBase": "C", "read": 159, "common": true, "asSupplied": { "read": 142, "readBase": "G" } }, { "kind": "deletion", "refStart": 348, "refEnd": 348, "length": 1, "bases": "G", "readAfter": 162, "asSupplied": { "readBetween": [ 138, 139 ] }, "common": false, "notFixed": { "from": { "ref": 347, "read": 162, "readAsSupplied": 139 }, "to": { "ref": 356, "read": 170, "readAsSupplied": 131 } } }, { "kind": "substitution", "ref": 349, "refBase": "G", "readBase": "T", "read": 163, "common": false, "notFixed": { "from": { "ref": 347, "read": 162, "readAsSupplied": 139 }, "to": { "ref": 356, "read": 170, "readAsSupplied": 131 } }, "asSupplied": { "read": 138, "readBase": "A" } }, { "kind": "substitution", "ref": 350, "refBase": "G", "readBase": "T", "read": 164, "common": false, "notFixed": { "from": { "ref": 347, "read": 162, "readAsSupplied": 139 }, "to": { "ref": 356, "read": 170, "readAsSupplied": 131 } }, "asSupplied": { "read": 137, "readBase": "A" } }, { "kind": "substitution", "ref": 352, "refBase": "G", "readBase": "T", "read": 166, "common": false, "notFixed": { "from": { "ref": 347, "read": 162, "readAsSupplied": 139 }, "to": { "ref": 356, "read": 170, "readAsSupplied": 131 } }, "asSupplied": { "read": 135, "readBase": "A" } }, { "kind": "substitution", "ref": 355, "refBase": "A", "readBase": "C", "read": 169, "common": false, "notFixed": { "from": { "ref": 347, "read": 162, "readAsSupplied": 139 }, "to": { "ref": 356, "read": 170, "readAsSupplied": 131 } }, "asSupplied": { "read": 132, "readBase": "G" } }, { "kind": "insertion", "refAfter": 359, "length": 4, "bases": "TTTC", "readStart": 174, "readEnd": 177, "asSupplied": { "readStart": 124, "readEnd": 127, "bases": "GAAA" }, "common": false, "notFixed": { "from": { "ref": 359, "read": 173, "readAsSupplied": 128 }, "to": { "ref": 361, "read": 186, "readAsSupplied": 115 } } }, { "kind": "insertion", "refAfter": 360, "length": 7, "bases": "CAGAAAC", "readStart": 179, "readEnd": 185, "asSupplied": { "readStart": 116, "readEnd": 122, "bases": "GTTTCTG" }, "common": false, "notFixed": { "from": { "ref": 359, "read": 173, "readAsSupplied": 128 }, "to": { "ref": 361, "read": 186, "readAsSupplied": 115 } } }, { "kind": "insertion", "refAfter": 364, "length": 1, "bases": "C", "readStart": 190, "readEnd": 190, "asSupplied": { "readStart": 111, "readEnd": 111, "bases": "G" }, "common": true }, { "kind": "substitution", "ref": 367, "refBase": "T", "readBase": "G", "read": 193, "common": true, "asSupplied": { "read": 108, "readBase": "C" } }, { "kind": "deletion", "refStart": 369, "refEnd": 369, "length": 1, "bases": "G", "readAfter": 194, "asSupplied": { "readBetween": [ 106, 107 ] }, "common": false, "notFixed": { "from": { "ref": 368, "read": 194, "readAsSupplied": 107 }, "to": { "ref": 371, "read": 196, "readAsSupplied": 105 } } }, { "kind": "substitution", "ref": 370, "refBase": "A", "readBase": "C", "read": 195, "common": false, "notFixed": { "from": { "ref": 368, "read": 194, "readAsSupplied": 107 }, "to": { "ref": 371, "read": 196, "readAsSupplied": 105 } }, "asSupplied": { "read": 106, "readBase": "G" } }, { "kind": "deletion", "refStart": 375, "refEnd": 375, "length": 1, "bases": "A", "readAfter": 199, "asSupplied": { "readBetween": [ 101, 102 ] }, "common": false, "notFixed": { "from": { "ref": 374, "read": 199, "readAsSupplied": 102 }, "to": { "ref": 381, "read": 205, "readAsSupplied": 96 } } }, { "kind": "substitution", "ref": 376, "refBase": "G", "readBase": "T", "read": 200, "common": false, "notFixed": { "from": { "ref": 374, "read": 199, "readAsSupplied": 102 }, "to": { "ref": 381, "read": 205, "readAsSupplied": 96 } }, "asSupplied": { "read": 101, "readBase": "A" } }, { "kind": "substitution", "ref": 377, "refBase": "A", "readBase": "C", "read": 201, "common": false, "notFixed": { "from": { "ref": 374, "read": 199, "readAsSupplied": 102 }, "to": { "ref": 381, "read": 205, "readAsSupplied": 96 } }, "asSupplied": { "read": 100, "readBase": "G" } }, { "kind": "substitution", "ref": 380, "refBase": "G", "readBase": "C", "read": 204, "common": false, "notFixed": { "from": { "ref": 374, "read": 199, "readAsSupplied": 102 }, "to": { "ref": 381, "read": 205, "readAsSupplied": 96 } }, "asSupplied": { "read": 97, "readBase": "G" } }, { "kind": "substitution", "ref": 382, "refBase": "A", "readBase": "C", "read": 206, "common": true, "asSupplied": { "read": 95, "readBase": "G" } }, { "kind": "deletion", "refStart": 387, "refEnd": 390, "length": 4, "bases": "CGTC", "readAfter": 210, "asSupplied": { "readBetween": [ 90, 91 ] }, "common": true }, { "kind": "insertion", "refAfter": 393, "length": 3, "bases": "ACG", "readStart": 214, "readEnd": 216, "asSupplied": { "readStart": 85, "readEnd": 87, "bases": "CGT" }, "common": false, "notFixed": { "from": { "ref": 393, "read": 213, "readAsSupplied": 88 }, "to": { "ref": 396, "read": 219, "readAsSupplied": 82 } } }, { "kind": "substitution", "ref": 395, "refBase": "C", "readBase": "T", "read": 218, "common": false, "notFixed": { "from": { "ref": 393, "read": 213, "readAsSupplied": 88 }, "to": { "ref": 396, "read": 219, "readAsSupplied": 82 } }, "asSupplied": { "read": 83, "readBase": "A" } }, { "kind": "insertion", "refAfter": 398, "length": 1, "bases": "A", "readStart": 222, "readEnd": 222, "asSupplied": { "readStart": 79, "readEnd": 79, "bases": "T" }, "common": true }, { "kind": "insertion", "refAfter": 401, "length": 1, "bases": "G", "readStart": 226, "readEnd": 226, "asSupplied": { "readStart": 75, "readEnd": 75, "bases": "C" }, "common": true }, { "kind": "insertion", "refAfter": 403, "length": 1, "bases": "A", "readStart": 229, "readEnd": 229, "asSupplied": { "readStart": 72, "readEnd": 72, "bases": "T" }, "common": true }, { "kind": "substitution", "ref": 405, "refBase": "G", "readBase": "A", "read": 231, "common": true, "asSupplied": { "read": 70, "readBase": "T" } }, { "kind": "substitution", "ref": 406, "refBase": "G", "readBase": "C", "read": 232, "common": true, "asSupplied": { "read": 69, "readBase": "G" } }, { "kind": "deletion", "refStart": 409, "refEnd": 410, "length": 2, "bases": "GT", "readAfter": 234, "asSupplied": { "readBetween": [ 66, 67 ] }, "common": false, "notFixed": { "from": { "ref": 408, "read": 234, "readAsSupplied": 67 }, "to": { "ref": 412, "read": 236, "readAsSupplied": 65 } } }, { "kind": "substitution", "ref": 414, "refBase": "C", "readBase": "T", "read": 238, "common": true, "asSupplied": { "read": 63, "readBase": "A" } }, { "kind": "substitution", "ref": 416, "refBase": "A", "readBase": "C", "read": 240, "common": true, "asSupplied": { "read": 61, "readBase": "G" } }, { "kind": "substitution", "ref": 420, "refBase": "T", "readBase": "G", "read": 244, "common": false, "notFixed": { "from": { "ref": 419, "read": 243, "readAsSupplied": 58 }, "to": { "ref": 434, "read": 260, "readAsSupplied": 41 } }, "asSupplied": { "read": 57, "readBase": "C" } }, { "kind": "insertion", "refAfter": 421, "length": 4, "bases": "GACA", "readStart": 246, "readEnd": 249, "asSupplied": { "readStart": 52, "readEnd": 55, "bases": "TGTC" }, "common": false, "notFixed": { "from": { "ref": 419, "read": 243, "readAsSupplied": 58 }, "to": { "ref": 434, "read": 260, "readAsSupplied": 41 } } }, { "kind": "substitution", "ref": 425, "refBase": "C", "readBase": "T", "read": 253, "common": false, "notFixed": { "from": { "ref": 419, "read": 243, "readAsSupplied": 58 }, "to": { "ref": 434, "read": 260, "readAsSupplied": 41 } }, "asSupplied": { "read": 48, "readBase": "A" } }, { "kind": "substitution", "ref": 426, "refBase": "G", "readBase": "A", "read": 254, "common": false, "notFixed": { "from": { "ref": 419, "read": 243, "readAsSupplied": 58 }, "to": { "ref": 434, "read": 260, "readAsSupplied": 41 } }, "asSupplied": { "read": 47, "readBase": "T" } }, { "kind": "substitution", "ref": 427, "refBase": "C", "readBase": "T", "read": 255, "common": false, "notFixed": { "from": { "ref": 419, "read": 243, "readAsSupplied": 58 }, "to": { "ref": 434, "read": 260, "readAsSupplied": 41 } }, "asSupplied": { "read": 46, "readBase": "A" } }, { "kind": "deletion", "refStart": 430, "refEnd": 431, "length": 2, "bases": "CG", "readAfter": 257, "asSupplied": { "readBetween": [ 43, 44 ] }, "common": false, "notFixed": { "from": { "ref": 419, "read": 243, "readAsSupplied": 58 }, "to": { "ref": 434, "read": 260, "readAsSupplied": 41 } } }, { "kind": "substitution", "ref": 435, "refBase": "C", "readBase": "T", "read": 261, "common": true, "asSupplied": { "read": 40, "readBase": "A" } }, { "kind": "substitution", "ref": 437, "refBase": "G", "readBase": "C", "read": 263, "common": true, "asSupplied": { "read": 38, "readBase": "G" } }, { "kind": "substitution", "ref": 441, "refBase": "G", "readBase": "T", "read": 267, "common": true, "asSupplied": { "read": 34, "readBase": "A" } }, { "kind": "substitution", "ref": 442, "refBase": "C", "readBase": "T", "read": 268, "common": true, "asSupplied": { "read": 33, "readBase": "A" } }, { "kind": "substitution", "ref": 444, "refBase": "G", "readBase": "C", "read": 270, "common": true, "asSupplied": { "read": 31, "readBase": "G" } }, { "kind": "deletion", "refStart": 446, "refEnd": 446, "length": 1, "bases": "T", "readAfter": 271, "asSupplied": { "readBetween": [ 29, 30 ] }, "common": true }, { "kind": "substitution", "ref": 451, "refBase": "A", "readBase": "C", "read": 276, "common": true, "asSupplied": { "read": 25, "readBase": "G" } }, { "kind": "substitution", "ref": 454, "refBase": "T", "readBase": "C", "read": 279, "common": true, "asSupplied": { "read": 22, "readBase": "G" } }, { "kind": "deletion", "refStart": 456, "refEnd": 456, "length": 1, "bases": "T", "readAfter": 280, "asSupplied": { "readBetween": [ 20, 21 ] }, "common": true }, { "kind": "deletion", "refStart": 459, "refEnd": 459, "length": 1, "bases": "G", "readAfter": 282, "asSupplied": { "readBetween": [ 18, 19 ] }, "common": true }, { "kind": "substitution", "ref": 463, "refBase": "G", "readBase": "A", "read": 286, "common": true, "asSupplied": { "read": 15, "readBase": "T" } }, { "kind": "insertion", "refAfter": 464, "length": 1, "bases": "T", "readStart": 288, "readEnd": 288, "asSupplied": { "readStart": 13, "readEnd": 13, "bases": "A" }, "common": false, "notFixed": { "from": { "ref": 464, "read": 287, "readAsSupplied": 14 }, "to": { "ref": 466, "read": 290, "readAsSupplied": 11 } } }, { "kind": "insertion", "refAfter": 468, "length": 1, "bases": "T", "readStart": 293, "readEnd": 293, "asSupplied": { "readStart": 8, "readEnd": 8, "bases": "A" }, "common": true }, { "kind": "deletion", "refStart": 470, "refEnd": 471, "length": 2, "bases": "AG", "readAfter": 294, "asSupplied": { "readBetween": [ 6, 7 ] }, "common": false, "notFixed": { "from": { "ref": 469, "read": 294, "readAsSupplied": 7 }, "to": { "ref": 474, "read": 297, "readAsSupplied": 4 } } }, { "kind": "substitution", "ref": 472, "refBase": "G", "readBase": "T", "read": 295, "common": false, "notFixed": { "from": { "ref": 469, "read": 294, "readAsSupplied": 7 }, "to": { "ref": 474, "read": 297, "readAsSupplied": 4 } }, "asSupplied": { "read": 6, "readBase": "A" } }, { "kind": "substitution", "ref": 473, "refBase": "A", "readBase": "C", "read": 296, "common": false, "notFixed": { "from": { "ref": 469, "read": 294, "readAsSupplied": 7 }, "to": { "ref": 474, "read": 297, "readAsSupplied": 4 } }, "asSupplied": { "read": 5, "readBase": "G" } }, { "kind": "substitution", "ref": 475, "refBase": "G", "readBase": "T", "read": 298, "common": true, "asSupplied": { "read": 3, "readBase": "A" } } ] }, "band": { "diagonalMin": 172, "diagonalMax": 214, "cellsNeeded": 13545, "unionBandLimited": false, "scope": "every optimal path", "gridCells": 180901, "searchedBanded": true, "sharedWords": 0, "sharedWordsOverCap": false, "seedGuarantee": { "differencesUpTo": 354, "guaranteed": false } }, "enumeration": "not-enumerated", "placements": [ { "refStart": 214, "refEnd": 477, "crossesOrigin": false, "wholeCircle": false, "readStart": 1, "readEnd": 300, "asSupplied": { "readStart": 1, "readEnd": 300 } } ] } }, { "mode": "local", "region": null, "strand": "+", "strandUndetermined": false, "plus": { "score": 397, "count": 3, "overCap": false, "state": "aligned", "biopython": { "score": 397, "count": 3 }, "uniquePairs": [ [ 51, 1 ], [ 52, 2 ], [ 53, 3 ], [ 54, 4 ], [ 55, 5 ], [ 56, 6 ], [ 57, 7 ], [ 58, 8 ], [ 59, 9 ], [ 60, 10 ], [ 61, 11 ], [ 62, 12 ], [ 63, 13 ], [ 64, 14 ], [ 65, 15 ], [ 66, 16 ], [ 67, 17 ], [ 68, 18 ], [ 69, 19 ], [ 70, 20 ], [ 71, 21 ], [ 72, 22 ], [ 73, 23 ], [ 74, 24 ], [ 75, 25 ], [ 76, 26 ], [ 77, 27 ], [ 78, 28 ], [ 79, 29 ], [ 80, 30 ], [ 81, 31 ], [ 82, 32 ], [ 83, 33 ], [ 84, 34 ], [ 85, 35 ], [ 86, 36 ], [ 87, 37 ], [ 88, 38 ], [ 89, 39 ], [ 90, 40 ], [ 91, 41 ], [ 92, 42 ], [ 93, 43 ], [ 94, 44 ], [ 95, 45 ], [ 96, 46 ], [ 97, 47 ], [ 98, 48 ], [ 99, 49 ], [ 100, 50 ], [ 101, 51 ], [ 102, 52 ], [ 103, 53 ], [ 104, 54 ], [ 105, 55 ], [ 106, 56 ], [ 107, 57 ], [ 108, 58 ], [ 109, 59 ], [ 110, 60 ], [ 111, 61 ], [ 112, 62 ], [ 113, 63 ], [ 114, 64 ], [ 115, 65 ], [ 116, 66 ], [ 117, 67 ], [ 118, 68 ], [ 119, 69 ], [ 120, 70 ], [ 121, 71 ], [ 122, 72 ], [ 123, 73 ], [ 124, 74 ], [ 125, 75 ], [ 126, 76 ], [ 127, 77 ], [ 128, 78 ], [ 129, 79 ], [ 130, 80 ], [ 131, 81 ], [ 132, 82 ], [ 133, 83 ], [ 134, 84 ], [ 135, 85 ], [ 136, 86 ], [ 137, 87 ], [ 138, 88 ], [ 139, 89 ], [ 140, 90 ], [ 141, 91 ], [ 142, 92 ], [ 143, 93 ], [ 144, 94 ], [ 145, 95 ], [ 146, 96 ], [ 147, 97 ], [ 148, 98 ], [ 149, 99 ], [ 150, 100 ], [ 151, 101 ], [ 152, 102 ], [ 153, 103 ], [ 154, 104 ], [ 155, 105 ], [ 156, 106 ], [ 157, 107 ], [ 158, 108 ], [ 159, 109 ], [ 160, 110 ], [ 161, 111 ], [ 162, 112 ], [ 163, 113 ], [ 164, 114 ], [ 165, 115 ], [ 166, 116 ], [ 167, 117 ], [ 168, 118 ], [ 169, 119 ], [ 170, 120 ], [ 171, 121 ], [ 172, 122 ], [ 173, 123 ], [ 174, 124 ], [ 175, 125 ], [ 176, 126 ], [ 177, 127 ], [ 178, 128 ], [ 179, 129 ], [ 180, 130 ], [ 181, 131 ], [ 182, 132 ], [ 183, 133 ], [ 184, 134 ], [ 185, 135 ], [ 186, 136 ], [ 187, 137 ], [ 188, 138 ], [ 189, 139 ], [ 190, 140 ], [ 191, 141 ], [ 192, 142 ], [ 193, 143 ], [ 194, 144 ], [ 195, 145 ], [ 196, 146 ], [ 197, 147 ], [ 198, 148 ], [ 199, 149 ], [ 302, 152 ], [ 303, 153 ], [ 304, 154 ], [ 305, 155 ], [ 306, 156 ], [ 307, 157 ], [ 308, 158 ], [ 309, 159 ], [ 310, 160 ], [ 311, 161 ], [ 312, 162 ], [ 313, 163 ], [ 314, 164 ], [ 315, 165 ], [ 316, 166 ], [ 317, 167 ], [ 318, 168 ], [ 319, 169 ], [ 320, 170 ], [ 321, 171 ], [ 322, 172 ], [ 323, 173 ], [ 324, 174 ], [ 325, 175 ], [ 326, 176 ], [ 327, 177 ], [ 328, 178 ], [ 329, 179 ], [ 330, 180 ], [ 331, 181 ], [ 332, 182 ], [ 333, 183 ], [ 334, 184 ], [ 335, 185 ], [ 336, 186 ], [ 337, 187 ], [ 338, 188 ], [ 339, 189 ], [ 340, 190 ], [ 341, 191 ], [ 342, 192 ], [ 343, 193 ], [ 344, 194 ], [ 345, 195 ], [ 346, 196 ], [ 347, 197 ], [ 348, 198 ], [ 349, 199 ], [ 350, 200 ], [ 351, 201 ], [ 352, 202 ], [ 353, 203 ], [ 354, 204 ], [ 355, 205 ], [ 356, 206 ], [ 357, 207 ], [ 358, 208 ], [ 359, 209 ], [ 360, 210 ], [ 361, 211 ], [ 362, 212 ], [ 363, 213 ], [ 364, 214 ], [ 365, 215 ], [ 366, 216 ], [ 367, 217 ], [ 368, 218 ], [ 369, 219 ], [ 370, 220 ], [ 371, 221 ], [ 372, 222 ], [ 373, 223 ], [ 374, 224 ], [ 375, 225 ], [ 376, 226 ], [ 377, 227 ], [ 378, 228 ], [ 379, 229 ], [ 380, 230 ], [ 381, 231 ], [ 382, 232 ], [ 383, 233 ], [ 384, 234 ], [ 385, 235 ], [ 386, 236 ], [ 387, 237 ], [ 388, 238 ], [ 389, 239 ], [ 390, 240 ], [ 391, 241 ], [ 392, 242 ], [ 393, 243 ], [ 394, 244 ], [ 395, 245 ], [ 396, 246 ], [ 397, 247 ], [ 398, 248 ], [ 399, 249 ], [ 400, 250 ], [ 401, 251 ], [ 402, 252 ], [ 403, 253 ], [ 404, 254 ], [ 405, 255 ], [ 406, 256 ], [ 407, 257 ], [ 408, 258 ], [ 409, 259 ], [ 410, 260 ], [ 411, 261 ], [ 412, 262 ], [ 413, 263 ], [ 414, 264 ], [ 415, 265 ], [ 416, 266 ], [ 417, 267 ], [ 418, 268 ], [ 419, 269 ], [ 420, 270 ], [ 421, 271 ], [ 422, 272 ], [ 423, 273 ], [ 424, 274 ], [ 425, 275 ], [ 426, 276 ], [ 427, 277 ], [ 428, 278 ], [ 429, 279 ], [ 430, 280 ], [ 431, 281 ], [ 432, 282 ], [ 433, 283 ], [ 434, 284 ], [ 435, 285 ], [ 436, 286 ], [ 437, 287 ], [ 438, 288 ], [ 439, 289 ], [ 440, 290 ], [ 441, 291 ], [ 442, 292 ], [ 443, 293 ], [ 444, 294 ], [ 445, 295 ], [ 446, 296 ], [ 447, 297 ], [ 448, 298 ], [ 449, 299 ], [ 450, 300 ] ], "uniquePlacement": true, "placementNotDetermined": false, "noCommonColumn": false, "hull": { "refStart": 51, "refEnd": 450, "crossesOrigin": false, "wholeCircle": false }, "selected": { "coordinates": [ [ 50, 199, 299, 450 ], [ 0, 149, 149, 300 ] ], "gappedReference": "GGAAGAGAGTCAATTCAGGGTGGTGAATGTGAAACCAGTAACGTTATACGATGTCGCAGAGTATGCCGGTGTCTCTTATCAGACCGTTTCCCGCGTGGTGAACCAGGCCAGCCACGTTTCTGCGAAAACGCGGGAAAAAGTGGAAGCGGCGATGGCGGAGCTGAATTACATTCCCAACCGCGTGGCACAACAACTGGCGGGCAAACAGTCGTTGCTGATTGGCGTTGCCACCTCCAGTCTGGCCCTGCACGCGCCGTCGCAAATTGTCGCGGCGATTAAATCTCGCGCCGATCAACTGGGTGCCAGCGTGGTGGTGTCGATGGTAGAACGAAGCGGCGTCGAAGCCTGTAAAGCGGCGGTGCACAATCTTCTCGCGCAACGCGTCAGTGGGCTGATCATT", "gappedRead": "GGAAGAGAGTCAATTCAGGGTGGTGAATGTGAAACCAGTAACGTTATACGATGTCGCAGAGTATGCCGGTGTCTCTTATCAGACCGTTTCCCGCGTGGTGAACCAGGCCAGCCACGTTTCTGCGAAAACGCGGGAAAAAGTGGAAGCGG----------------------------------------------------------------------------------------------------CGCGCCGTCGCAAATTGTCGCGGCGATTAAATCTCGCGCCGATCAACTGGGTGCCAGCGTGGTGGTGTCGATGGTAGAACGAAGCGGCGTCGAAGCCTGTAAAGCGGCGGTGCACAATCTTCTCGCGCAACGCGTCAGTGGGCTGATCATT", "columns": 400, "identical": 300, "mismatches": 0, "ambiguousColumns": 0, "gapColumns": 100, "gapOpens": 1, "identity": { "numerator": 300, "denominator": 400 }, "readAligned": { "bases": 300, "of": 300 }, "referenceCovered": { "bases": 400, "of": 600 }, "placement": { "refStart": 51, "refEnd": 450, "readStart": 1, "readEnd": 300, "crossesOrigin": false }, "overhang": [], "differences": [ { "kind": "deletion", "refStart": 200, "refEnd": 299, "length": 100, "bases": "CGATGGCGGAGCTGAATTACATTCCCAACCGCGTGGCACAACAACTGGCGGGCAAACAGTCGTTGCTGATTGGCGTTGCCACCTCCAGTCTGGCCCTGCA", "readAfter": 149, "common": false, "notFixed": { "from": { "ref": 199, "read": 149 }, "to": { "ref": 302, "read": 152 } } } ] }, "band": { "diagonalMin": 50, "diagonalMax": 150, "cellsNeeded": 31003, "unionBandLimited": true, "scope": "every optimal path", "gridCells": 180901, "searchedBanded": true, "sharedWords": 280, "sharedWordsOverCap": false, "seedGuarantee": { "differencesUpTo": 101, "guaranteed": false } }, "enumeration": "listed", "alignments": [ [ [ 50, 199, 299, 450 ], [ 0, 149, 149, 300 ] ], [ [ 50, 200, 300, 450 ], [ 0, 150, 150, 300 ] ], [ [ 50, 201, 301, 450 ], [ 0, 151, 151, 300 ] ] ], "tuples": [ [ 300, 0, 400, 0, 100, 1, 300, 400 ] ], "tupleFields": [ "identical", "ambiguousColumns", "columns", "mismatches", "gapColumns", "gapOpens", "readAligned", "referenceCovered" ], "variation": { "readAligned": { "shared": true, "min": 300, "max": 300 }, "referenceCovered": { "shared": true, "min": 400, "max": 400 }, "identity": { "shared": true, "min": { "numerator": 3, "denominator": 4 }, "max": { "numerator": 3, "denominator": 4 } }, "overhangStart": { "shared": true, "min": 0, "max": 0 }, "overhangEnd": { "shared": true, "min": 0, "max": 0 } }, "placements": [ { "refStart": 51, "refEnd": 450, "crossesOrigin": false, "wholeCircle": false, "readStart": 1, "readEnd": 300, "alignments": 3, "band": { "diagonalMin": 50, "diagonalMax": 150, "cellsNeeded": 31003, "bandLimited": true } } ] }, "minus": { "score": 20, "count": 2, "overCap": false, "state": "aligned", "biopython": { "score": 20, "count": 2 }, "uniquePairs": [], "uniquePlacement": false, "placementNotDetermined": false, "noCommonColumn": false, "hull": { "refStart": 137, "refEnd": 187, "crossesOrigin": false, "wholeCircle": false }, "selected": { "coordinates": [ [ 136, 146 ], [ 163, 173 ] ], "gappedReference": "TTTCCCGCGT", "gappedRead": "TTTCCCGCGT", "columns": 10, "identical": 10, "mismatches": 0, "ambiguousColumns": 0, "gapColumns": 0, "gapOpens": 0, "identity": { "numerator": 10, "denominator": 10 }, "readAligned": { "bases": 10, "of": 300 }, "referenceCovered": { "bases": 10, "of": 600 }, "placement": { "refStart": 137, "refEnd": 146, "readStart": 164, "readEnd": 173, "crossesOrigin": false, "asSupplied": { "readStart": 128, "readEnd": 137 } }, "overhang": [], "differences": [] }, "band": { "diagonalMin": -27, "diagonalMax": -27, "cellsNeeded": 822, "unionBandLimited": false, "scope": "every optimal path", "gridCells": 180901, "searchedBanded": true, "sharedWords": 0, "sharedWordsOverCap": false, "seedGuarantee": { "differencesUpTo": 290, "guaranteed": false } }, "enumeration": "listed", "alignments": [ [ [ 136, 146 ], [ 163, 173 ] ], [ [ 177, 187 ], [ 204, 214 ] ] ], "tuples": [ [ 10, 0, 10, 0, 0, 0, 10, 10 ] ], "tupleFields": [ "identical", "ambiguousColumns", "columns", "mismatches", "gapColumns", "gapOpens", "readAligned", "referenceCovered" ], "variation": { "readAligned": { "shared": true, "min": 10, "max": 10 }, "referenceCovered": { "shared": true, "min": 10, "max": 10 }, "identity": { "shared": true, "min": { "numerator": 1, "denominator": 1 }, "max": { "numerator": 1, "denominator": 1 } }, "overhangStart": { "shared": true, "min": 0, "max": 0 }, "overhangEnd": { "shared": true, "min": 0, "max": 0 } }, "placements": [ { "refStart": 137, "refEnd": 146, "crossesOrigin": false, "wholeCircle": false, "readStart": 164, "readEnd": 173, "asSupplied": { "readStart": 128, "readEnd": 137 }, "alignments": 1, "band": { "diagonalMin": -27, "diagonalMax": -27, "cellsNeeded": 822, "bandLimited": false } }, { "refStart": 178, "refEnd": 187, "crossesOrigin": false, "wholeCircle": false, "readStart": 205, "readEnd": 214, "asSupplied": { "readStart": 87, "readEnd": 96 }, "alignments": 1, "band": { "diagonalMin": -27, "diagonalMax": -27, "cellsNeeded": 822, "bandLimited": false } } ] } } ] } }, { "id": "local-zero-extension", "note": "Local: the optimum CGT could run on through two N columns scoring 0; Biopython ends a local alignment on a pair at the optimum and never extends through one, so the Ns are not part of it.", "input": { "reference": { "residues": "GGAAACGTNNTT", "topology": "linear" }, "read": { "residues": "CGTNN" }, "modes": [ "local" ] }, "expected": { "results": [ { "mode": "local", "region": null, "strand": "ambiguous", "strandUndetermined": false, "plus": { "score": 6, "count": 1, "overCap": false, "state": "aligned", "biopython": { "score": 6, "count": 1 }, "uniquePairs": [ [ 6, 1 ], [ 7, 2 ], [ 8, 3 ] ], "uniquePlacement": true, "placementNotDetermined": false, "noCommonColumn": false, "hull": { "refStart": 6, "refEnd": 8, "crossesOrigin": false, "wholeCircle": false }, "selected": { "coordinates": [ [ 5, 8 ], [ 0, 3 ] ], "gappedReference": "CGT", "gappedRead": "CGT", "columns": 3, "identical": 3, "mismatches": 0, "ambiguousColumns": 0, "gapColumns": 0, "gapOpens": 0, "identity": { "numerator": 3, "denominator": 3 }, "readAligned": { "bases": 3, "of": 5 }, "referenceCovered": { "bases": 3, "of": 12 }, "placement": { "refStart": 6, "refEnd": 8, "readStart": 1, "readEnd": 3, "crossesOrigin": false }, "overhang": [], "differences": [] }, "band": { "diagonalMin": 5, "diagonalMax": 5, "cellsNeeded": 18, "unionBandLimited": false, "scope": "every optimal path", "gridCells": 78, "searchedBanded": false, "sharedWords": 0, "sharedWordsOverCap": false, "seedGuarantee": { "differencesUpTo": 2, "guaranteed": false } }, "enumeration": "listed", "alignments": [ [ [ 5, 8 ], [ 0, 3 ] ] ], "tuples": [ [ 3, 0, 3, 0, 0, 0, 3, 3 ] ], "tupleFields": [ "identical", "ambiguousColumns", "columns", "mismatches", "gapColumns", "gapOpens", "readAligned", "referenceCovered" ], "variation": { "readAligned": { "shared": true, "min": 3, "max": 3 }, "referenceCovered": { "shared": true, "min": 3, "max": 3 }, "identity": { "shared": true, "min": { "numerator": 1, "denominator": 1 }, "max": { "numerator": 1, "denominator": 1 } }, "overhangStart": { "shared": true, "min": 0, "max": 0 }, "overhangEnd": { "shared": true, "min": 0, "max": 0 } }, "placements": [ { "refStart": 6, "refEnd": 8, "crossesOrigin": false, "wholeCircle": false, "readStart": 1, "readEnd": 3, "alignments": 1, "band": { "diagonalMin": 5, "diagonalMax": 5, "cellsNeeded": 18, "bandLimited": false } } ] }, "minus": { "score": 6, "count": 1, "overCap": false, "state": "aligned", "biopython": { "score": 6, "count": 1 }, "uniquePairs": [ [ 5, 3 ], [ 6, 4 ], [ 7, 5 ] ], "uniquePlacement": true, "placementNotDetermined": false, "noCommonColumn": false, "hull": { "refStart": 5, "refEnd": 7, "crossesOrigin": false, "wholeCircle": false }, "selected": { "coordinates": [ [ 4, 7 ], [ 2, 5 ] ], "gappedReference": "ACG", "gappedRead": "ACG", "columns": 3, "identical": 3, "mismatches": 0, "ambiguousColumns": 0, "gapColumns": 0, "gapOpens": 0, "identity": { "numerator": 3, "denominator": 3 }, "readAligned": { "bases": 3, "of": 5 }, "referenceCovered": { "bases": 3, "of": 12 }, "placement": { "refStart": 5, "refEnd": 7, "readStart": 3, "readEnd": 5, "crossesOrigin": false, "asSupplied": { "readStart": 1, "readEnd": 3 } }, "overhang": [], "differences": [] }, "band": { "diagonalMin": 2, "diagonalMax": 2, "cellsNeeded": 18, "unionBandLimited": false, "scope": "every optimal path", "gridCells": 78, "searchedBanded": false, "sharedWords": 0, "sharedWordsOverCap": false, "seedGuarantee": { "differencesUpTo": 2, "guaranteed": false } }, "enumeration": "listed", "alignments": [ [ [ 4, 7 ], [ 2, 5 ] ] ], "tuples": [ [ 3, 0, 3, 0, 0, 0, 3, 3 ] ], "tupleFields": [ "identical", "ambiguousColumns", "columns", "mismatches", "gapColumns", "gapOpens", "readAligned", "referenceCovered" ], "variation": { "readAligned": { "shared": true, "min": 3, "max": 3 }, "referenceCovered": { "shared": true, "min": 3, "max": 3 }, "identity": { "shared": true, "min": { "numerator": 1, "denominator": 1 }, "max": { "numerator": 1, "denominator": 1 } }, "overhangStart": { "shared": true, "min": 0, "max": 0 }, "overhangEnd": { "shared": true, "min": 0, "max": 0 } }, "placements": [ { "refStart": 5, "refEnd": 7, "crossesOrigin": false, "wholeCircle": false, "readStart": 3, "readEnd": 5, "asSupplied": { "readStart": 1, "readEnd": 3 }, "alignments": 1, "band": { "diagonalMin": 2, "diagonalMax": 2, "cellsNeeded": 18, "bandLimited": false } } ] } } ] } }, { "id": "local-zero-bridge", "note": "Local: two copies of ACGT joined by four N columns scoring 0; a path through the first optimum to the second is not counted, so four co-optimal alignments, not more.", "input": { "reference": { "residues": "ACGTNNNNACGT", "topology": "linear" }, "read": { "residues": "ACGTACGT" }, "modes": [ "local" ] }, "expected": { "results": [ { "mode": "local", "region": null, "strand": "ambiguous", "strandUndetermined": false, "plus": { "score": 8, "count": 4, "overCap": false, "state": "aligned", "biopython": { "score": 8, "count": 4 }, "uniquePairs": [], "uniquePlacement": false, "placementNotDetermined": false, "noCommonColumn": false, "hull": { "refStart": 1, "refEnd": 12, "crossesOrigin": false, "wholeCircle": false }, "selected": { "coordinates": [ [ 0, 4 ], [ 0, 4 ] ], "gappedReference": "ACGT", "gappedRead": "ACGT", "columns": 4, "identical": 4, "mismatches": 0, "ambiguousColumns": 0, "gapColumns": 0, "gapOpens": 0, "identity": { "numerator": 4, "denominator": 4 }, "readAligned": { "bases": 4, "of": 8 }, "referenceCovered": { "bases": 4, "of": 12 }, "placement": { "refStart": 1, "refEnd": 4, "readStart": 1, "readEnd": 4, "crossesOrigin": false }, "overhang": [], "differences": [] }, "band": { "diagonalMin": -4, "diagonalMax": 8, "cellsNeeded": 105, "unionBandLimited": false, "scope": "every optimal path", "gridCells": 117, "searchedBanded": false, "sharedWords": 0, "sharedWordsOverCap": false, "seedGuarantee": { "differencesUpTo": 4, "guaranteed": false } }, "enumeration": "listed", "alignments": [ [ [ 0, 4 ], [ 0, 4 ] ], [ [ 0, 4 ], [ 4, 8 ] ], [ [ 8, 12 ], [ 0, 4 ] ], [ [ 8, 12 ], [ 4, 8 ] ] ], "tuples": [ [ 4, 0, 4, 0, 0, 0, 4, 4 ] ], "tupleFields": [ "identical", "ambiguousColumns", "columns", "mismatches", "gapColumns", "gapOpens", "readAligned", "referenceCovered" ], "variation": { "readAligned": { "shared": true, "min": 4, "max": 4 }, "referenceCovered": { "shared": true, "min": 4, "max": 4 }, "identity": { "shared": true, "min": { "numerator": 1, "denominator": 1 }, "max": { "numerator": 1, "denominator": 1 } }, "overhangStart": { "shared": true, "min": 0, "max": 0 }, "overhangEnd": { "shared": true, "min": 0, "max": 0 } }, "placements": [ { "refStart": 1, "refEnd": 4, "crossesOrigin": false, "wholeCircle": false, "readStart": 1, "readEnd": 4, "alignments": 1, "band": { "diagonalMin": 0, "diagonalMax": 0, "cellsNeeded": 26, "bandLimited": false } }, { "refStart": 1, "refEnd": 4, "crossesOrigin": false, "wholeCircle": false, "readStart": 5, "readEnd": 8, "alignments": 1, "band": { "diagonalMin": -4, "diagonalMax": -4, "cellsNeeded": 15, "bandLimited": false } }, { "refStart": 9, "refEnd": 12, "crossesOrigin": false, "wholeCircle": false, "readStart": 1, "readEnd": 4, "alignments": 1, "band": { "diagonalMin": 8, "diagonalMax": 8, "cellsNeeded": 15, "bandLimited": false } }, { "refStart": 9, "refEnd": 12, "crossesOrigin": false, "wholeCircle": false, "readStart": 5, "readEnd": 8, "alignments": 1, "band": { "diagonalMin": 4, "diagonalMax": 4, "cellsNeeded": 26, "bandLimited": false } } ] }, "minus": { "score": 8, "count": 4, "overCap": false, "state": "aligned", "biopython": { "score": 8, "count": 4 }, "uniquePairs": [], "uniquePlacement": false, "placementNotDetermined": false, "noCommonColumn": false, "hull": { "refStart": 1, "refEnd": 12, "crossesOrigin": false, "wholeCircle": false }, "selected": { "coordinates": [ [ 0, 4 ], [ 0, 4 ] ], "gappedReference": "ACGT", "gappedRead": "ACGT", "columns": 4, "identical": 4, "mismatches": 0, "ambiguousColumns": 0, "gapColumns": 0, "gapOpens": 0, "identity": { "numerator": 4, "denominator": 4 }, "readAligned": { "bases": 4, "of": 8 }, "referenceCovered": { "bases": 4, "of": 12 }, "placement": { "refStart": 1, "refEnd": 4, "readStart": 1, "readEnd": 4, "crossesOrigin": false, "asSupplied": { "readStart": 5, "readEnd": 8 } }, "overhang": [], "differences": [] }, "band": { "diagonalMin": -4, "diagonalMax": 8, "cellsNeeded": 105, "unionBandLimited": false, "scope": "every optimal path", "gridCells": 117, "searchedBanded": false, "sharedWords": 0, "sharedWordsOverCap": false, "seedGuarantee": { "differencesUpTo": 4, "guaranteed": false } }, "enumeration": "listed", "alignments": [ [ [ 0, 4 ], [ 0, 4 ] ], [ [ 0, 4 ], [ 4, 8 ] ], [ [ 8, 12 ], [ 0, 4 ] ], [ [ 8, 12 ], [ 4, 8 ] ] ], "tuples": [ [ 4, 0, 4, 0, 0, 0, 4, 4 ] ], "tupleFields": [ "identical", "ambiguousColumns", "columns", "mismatches", "gapColumns", "gapOpens", "readAligned", "referenceCovered" ], "variation": { "readAligned": { "shared": true, "min": 4, "max": 4 }, "referenceCovered": { "shared": true, "min": 4, "max": 4 }, "identity": { "shared": true, "min": { "numerator": 1, "denominator": 1 }, "max": { "numerator": 1, "denominator": 1 } }, "overhangStart": { "shared": true, "min": 0, "max": 0 }, "overhangEnd": { "shared": true, "min": 0, "max": 0 } }, "placements": [ { "refStart": 1, "refEnd": 4, "crossesOrigin": false, "wholeCircle": false, "readStart": 1, "readEnd": 4, "asSupplied": { "readStart": 5, "readEnd": 8 }, "alignments": 1, "band": { "diagonalMin": 0, "diagonalMax": 0, "cellsNeeded": 26, "bandLimited": false } }, { "refStart": 1, "refEnd": 4, "crossesOrigin": false, "wholeCircle": false, "readStart": 5, "readEnd": 8, "asSupplied": { "readStart": 1, "readEnd": 4 }, "alignments": 1, "band": { "diagonalMin": -4, "diagonalMax": -4, "cellsNeeded": 15, "bandLimited": false } }, { "refStart": 9, "refEnd": 12, "crossesOrigin": false, "wholeCircle": false, "readStart": 1, "readEnd": 4, "asSupplied": { "readStart": 5, "readEnd": 8 }, "alignments": 1, "band": { "diagonalMin": 8, "diagonalMax": 8, "cellsNeeded": 15, "bandLimited": false } }, { "refStart": 9, "refEnd": 12, "crossesOrigin": false, "wholeCircle": false, "readStart": 5, "readEnd": 8, "asSupplied": { "readStart": 1, "readEnd": 4 }, "alignments": 1, "band": { "diagonalMin": 4, "diagonalMax": 4, "cellsNeeded": 26, "bandLimited": false } } ] } } ] } }, { "id": "band-widened", "note": "A read whose last 60 bases follow a 20-base deletion and carry a substitution every 10 bases, so no 12-base word seeds their diagonal: the first band (the seeds' diagonal and 16 either side) is touched and must widen.", "input": { "reference": { "residues": "GACACCATCGAATGGCGCAAAACCTTTCGCGGTATGGCATGATAGCGCCCGGAAGAGAGTCAATTCAGGGTGGTGAATGTGAAACCAGTAACGTTATACGATGTCGCAGAGTATGCCGGTGTCTCTTATCAGACCGTTTCCCGCGTGGTGAACCAGGCCAGCCACGTTTCTGCGAAAACGCGGGAAAAAGTGGAAGCGGCGATGGCGGAGCTGAATTACATTCCCAACCGCGTGGCACAACAACTGGCGGGCAAACAGTCGTTGCTGATTGGCGTTGCCACCTCCAGTCTGGCCCTGCACGCGCCGTCGCAAATTGTCGCGGCGATTAAATCTCGCGCCGATCAACTGGGTGCCAGCGTGGTGGTGTCGATGGTAGAACGAAGCGGCGTCGAAGCCTGTAAAGCGGCGGTGCACAATCTTCTCGCGCAACGCGTCAGTGGGCTGATCATTAACTATCCGCTGGATGACCAGGATGCCATTGCTGTGGAAGCTGCCTGCACTAATGTTCCGGCGTTATTTCTTGATGTCTCTGACCAGACACCCATCAACAGTATTATTTTCTCCCATGAAGACGGTACGCGACTGGGCGTGGAGCATCTGGTCGCATTGGGTCACCAGCAAATCGCGCTGTTAGCGGGCCCATTAAGTTCTGTCTCGGCGCGTCTGCGTCTGGCTGGCTGGCATAAATATCTCACTCGCAATCAAATTCAGCCGATAGCGGAACGGGAAGGCGACTGGAGTGCCATGTCCGGTTTTCAACAAACCATGCAAATGCTGAATGAGGGCATCGTTCCCACTGCGATGCTGGTTGCCAACGATCAGATGGCGCTGGGCGCAATGCGCGCCATTACCGAGTCCGGGCTGCGCGTTGGTGCGGATATCTCGGTAGTGGGATACGACGATACCGAAGACAGCTCATGTTATATCCCGCCGTCAACCACCATCAAACAGGATTTTCGCCTGCTGGGGCAAACCAGCGTGGACCGCTTGCTGCAACTCTCTCAGGGCCAGGCGGTGAAGGGCAATCAGCTGTTGCCCGTCTCACTGGTGAAAAGAAAAACCACCCTGGCGCCCAATACGCAAACCGCCTCTCCCCGCGCGTTGGCCGATTCATTAATGCAGCTGGCACGACAGGTTTCCCGACTGGAAAGCGGGCAGTGAGCGCAACGCAATTAATGTGAGTTAGCTCACTCATTAGGCACCCCAGGCTTTACACTTTATGCTTCCGGCTCGTATGTTGTGTGGAATTGTGAGCGGATAACAATTTCACACAGGAAACAGCTATGACCATGATTACGGATTCACTGGCCGTCGTTTTACAACGTCGTGACTGGGAAAACCCTGGCGTTACCCAACTTAATCGCCTTGCAGCACATCCCCCTTTCGCCAGCTGGCGTAATAGCGAAGAGGCCCGCACCGATCGCCCTTCCCAACAGTTGCGCAGCCTGAATGGCGAATGGCGCTTTGCCTGGTTTCCGGCACCAGAAGCGGTGCCGGAAA", "topology": "linear", "source": "J01636.1 1-1500" }, "read": { "residues": "GTCGCATTGGGTCACCAGCAAATCGCGCTGTTAGCGGGCCCATTAAGTTCTGTCTCGGCGCGTCTGCGTCTGGCTGGCTGGCATAAATATCTCACTCGCAGAACTGGAAGGCGAGTGGAGTGCCCTGTCCGGTTATCAACAAACGATGCAAATGGTGAAT", "source": "J01636.1 601-700 and 721-780, read bases 105, 115, ..., 155 changed" }, "modes": [ "semiglobal-read", "local" ] }, "expected": { "results": [ { "mode": "semiglobal-read", "region": null, "strand": "+", "strandUndetermined": false, "plus": { "score": 247, "count": 1, "overCap": false, "state": "aligned", "biopython": { "score": 247, "count": 1 }, "uniquePairs": [ [ 601, 1 ], [ 602, 2 ], [ 603, 3 ], [ 604, 4 ], [ 605, 5 ], [ 606, 6 ], [ 607, 7 ], [ 608, 8 ], [ 609, 9 ], [ 610, 10 ], [ 611, 11 ], [ 612, 12 ], [ 613, 13 ], [ 614, 14 ], [ 615, 15 ], [ 616, 16 ], [ 617, 17 ], [ 618, 18 ], [ 619, 19 ], [ 620, 20 ], [ 621, 21 ], [ 622, 22 ], [ 623, 23 ], [ 624, 24 ], [ 625, 25 ], [ 626, 26 ], [ 627, 27 ], [ 628, 28 ], [ 629, 29 ], [ 630, 30 ], [ 631, 31 ], [ 632, 32 ], [ 633, 33 ], [ 634, 34 ], [ 635, 35 ], [ 636, 36 ], [ 637, 37 ], [ 638, 38 ], [ 639, 39 ], [ 640, 40 ], [ 641, 41 ], [ 642, 42 ], [ 643, 43 ], [ 644, 44 ], [ 645, 45 ], [ 646, 46 ], [ 647, 47 ], [ 648, 48 ], [ 649, 49 ], [ 650, 50 ], [ 651, 51 ], [ 652, 52 ], [ 653, 53 ], [ 654, 54 ], [ 655, 55 ], [ 656, 56 ], [ 657, 57 ], [ 658, 58 ], [ 659, 59 ], [ 660, 60 ], [ 661, 61 ], [ 662, 62 ], [ 663, 63 ], [ 664, 64 ], [ 665, 65 ], [ 666, 66 ], [ 667, 67 ], [ 668, 68 ], [ 669, 69 ], [ 670, 70 ], [ 671, 71 ], [ 672, 72 ], [ 673, 73 ], [ 674, 74 ], [ 675, 75 ], [ 676, 76 ], [ 677, 77 ], [ 678, 78 ], [ 679, 79 ], [ 680, 80 ], [ 681, 81 ], [ 682, 82 ], [ 683, 83 ], [ 684, 84 ], [ 685, 85 ], [ 686, 86 ], [ 687, 87 ], [ 688, 88 ], [ 689, 89 ], [ 690, 90 ], [ 691, 91 ], [ 692, 92 ], [ 693, 93 ], [ 694, 94 ], [ 695, 95 ], [ 696, 96 ], [ 697, 97 ], [ 698, 98 ], [ 699, 99 ], [ 700, 100 ], [ 721, 101 ], [ 722, 102 ], [ 723, 103 ], [ 724, 104 ], [ 725, 105 ], [ 726, 106 ], [ 727, 107 ], [ 728, 108 ], [ 729, 109 ], [ 730, 110 ], [ 731, 111 ], [ 732, 112 ], [ 733, 113 ], [ 734, 114 ], [ 735, 115 ], [ 736, 116 ], [ 737, 117 ], [ 738, 118 ], [ 739, 119 ], [ 740, 120 ], [ 741, 121 ], [ 742, 122 ], [ 743, 123 ], [ 744, 124 ], [ 745, 125 ], [ 746, 126 ], [ 747, 127 ], [ 748, 128 ], [ 749, 129 ], [ 750, 130 ], [ 751, 131 ], [ 752, 132 ], [ 753, 133 ], [ 754, 134 ], [ 755, 135 ], [ 756, 136 ], [ 757, 137 ], [ 758, 138 ], [ 759, 139 ], [ 760, 140 ], [ 761, 141 ], [ 762, 142 ], [ 763, 143 ], [ 764, 144 ], [ 765, 145 ], [ 766, 146 ], [ 767, 147 ], [ 768, 148 ], [ 769, 149 ], [ 770, 150 ], [ 771, 151 ], [ 772, 152 ], [ 773, 153 ], [ 774, 154 ], [ 775, 155 ], [ 776, 156 ], [ 777, 157 ], [ 778, 158 ], [ 779, 159 ], [ 780, 160 ] ], "uniquePlacement": true, "placementNotDetermined": false, "noCommonColumn": false, "hull": { "refStart": 601, "refEnd": 780, "crossesOrigin": false, "wholeCircle": false }, "selected": { "coordinates": [ [ 0, 600, 700, 720, 780, 1500 ], [ 0, 0, 100, 100, 160, 160 ] ], "gappedReference": "GTCGCATTGGGTCACCAGCAAATCGCGCTGTTAGCGGGCCCATTAAGTTCTGTCTCGGCGCGTCTGCGTCTGGCTGGCTGGCATAAATATCTCACTCGCAATCAAATTCAGCCGATAGCGGAACGGGAAGGCGACTGGAGTGCCATGTCCGGTTTTCAACAAACCATGCAAATGCTGAAT", "gappedRead": "GTCGCATTGGGTCACCAGCAAATCGCGCTGTTAGCGGGCCCATTAAGTTCTGTCTCGGCGCGTCTGCGTCTGGCTGGCTGGCATAAATATCTCACTCGCA--------------------GAACTGGAAGGCGAGTGGAGTGCCCTGTCCGGTTATCAACAAACGATGCAAATGGTGAAT", "columns": 180, "identical": 154, "mismatches": 6, "ambiguousColumns": 0, "gapColumns": 20, "gapOpens": 1, "identity": { "numerator": 154, "denominator": 180 }, "readAligned": { "bases": 160, "of": 160 }, "referenceCovered": { "bases": 180, "of": 1500 }, "placement": { "refStart": 601, "refEnd": 780, "readStart": 1, "readEnd": 160, "crossesOrigin": false }, "overhang": [], "differences": [ { "kind": "deletion", "refStart": 701, "refEnd": 720, "length": 20, "bases": "ATCAAATTCAGCCGATAGCG", "readAfter": 100, "common": true }, { "kind": "substitution", "ref": 725, "refBase": "G", "readBase": "T", "read": 105, "common": true }, { "kind": "substitution", "ref": 735, "refBase": "C", "readBase": "G", "read": 115, "common": true }, { "kind": "substitution", "ref": 745, "refBase": "A", "readBase": "C", "read": 125, "common": true }, { "kind": "substitution", "ref": 755, "refBase": "T", "readBase": "A", "read": 135, "common": true }, { "kind": "substitution", "ref": 765, "refBase": "C", "readBase": "G", "read": 145, "common": true }, { "kind": "substitution", "ref": 775, "refBase": "C", "readBase": "G", "read": 155, "common": true } ] }, "band": { "diagonalMin": 600, "diagonalMax": 620, "cellsNeeded": 3703, "unionBandLimited": false, "scope": "every optimal path", "gridCells": 241661, "searchedBanded": true, "sharedWords": 89, "sharedWordsOverCap": false, "seedGuarantee": { "differencesUpTo": 36, "guaranteed": false } }, "enumeration": "listed", "alignments": [ [ [ 0, 600, 700, 720, 780, 1500 ], [ 0, 0, 100, 100, 160, 160 ] ] ], "tuples": [ [ 154, 0, 180, 6, 20, 1, 160, 180 ] ], "tupleFields": [ "identical", "ambiguousColumns", "columns", "mismatches", "gapColumns", "gapOpens", "readAligned", "referenceCovered" ], "variation": { "readAligned": { "shared": true, "min": 160, "max": 160 }, "referenceCovered": { "shared": true, "min": 180, "max": 180 }, "identity": { "shared": true, "min": { "numerator": 77, "denominator": 90 }, "max": { "numerator": 77, "denominator": 90 } }, "overhangStart": { "shared": true, "min": 0, "max": 0 }, "overhangEnd": { "shared": true, "min": 0, "max": 0 } }, "placements": [ { "refStart": 601, "refEnd": 780, "crossesOrigin": false, "wholeCircle": false, "readStart": 1, "readEnd": 160, "alignments": 1, "band": { "diagonalMin": 600, "diagonalMax": 620, "cellsNeeded": 3703, "bandLimited": false } } ] }, "minus": { "score": -55, "count": 2304, "overCap": true, "state": "aligned", "biopython": { "score": -55, "count": 2304 }, "uniquePairs": [ [ 1300, 1 ], [ 1301, 2 ], [ 1302, 3 ], [ 1303, 4 ], [ 1304, 5 ], [ 1305, 6 ], [ 1306, 10 ], [ 1307, 11 ], [ 1308, 12 ], [ 1312, 15 ], [ 1313, 16 ], [ 1314, 17 ], [ 1315, 18 ], [ 1316, 19 ], [ 1319, 25 ], [ 1320, 26 ], [ 1321, 27 ], [ 1322, 28 ], [ 1323, 29 ], [ 1326, 30 ], [ 1327, 31 ], [ 1329, 32 ], [ 1330, 33 ], [ 1331, 34 ], [ 1332, 35 ], [ 1333, 36 ], [ 1334, 37 ], [ 1335, 38 ], [ 1336, 39 ], [ 1337, 40 ], [ 1338, 41 ], [ 1339, 42 ], [ 1340, 43 ], [ 1341, 44 ], [ 1342, 46 ], [ 1343, 47 ], [ 1344, 48 ], [ 1345, 49 ], [ 1346, 50 ], [ 1347, 51 ], [ 1348, 52 ], [ 1349, 53 ], [ 1357, 58 ], [ 1358, 59 ], [ 1359, 60 ], [ 1360, 61 ], [ 1361, 62 ], [ 1362, 63 ], [ 1363, 64 ], [ 1368, 68 ], [ 1370, 69 ], [ 1371, 70 ], [ 1373, 71 ], [ 1374, 72 ], [ 1375, 73 ], [ 1376, 74 ], [ 1382, 75 ], [ 1383, 76 ], [ 1384, 77 ], [ 1385, 78 ], [ 1386, 79 ], [ 1387, 80 ], [ 1388, 81 ], [ 1389, 82 ], [ 1390, 83 ], [ 1391, 84 ], [ 1392, 85 ], [ 1393, 86 ], [ 1394, 87 ], [ 1395, 88 ], [ 1399, 90 ], [ 1400, 91 ], [ 1401, 92 ], [ 1403, 93 ], [ 1404, 94 ], [ 1405, 95 ], [ 1406, 96 ], [ 1407, 97 ], [ 1408, 98 ], [ 1409, 99 ], [ 1410, 100 ], [ 1411, 101 ], [ 1412, 103 ], [ 1413, 104 ], [ 1414, 105 ], [ 1416, 108 ], [ 1417, 109 ], [ 1418, 110 ], [ 1419, 111 ], [ 1420, 112 ], [ 1421, 113 ], [ 1422, 114 ], [ 1423, 122 ], [ 1424, 123 ], [ 1425, 124 ], [ 1426, 125 ], [ 1430, 127 ], [ 1431, 128 ], [ 1432, 129 ], [ 1433, 130 ], [ 1434, 131 ], [ 1435, 132 ], [ 1436, 133 ], [ 1437, 140 ], [ 1438, 141 ], [ 1439, 142 ], [ 1440, 143 ], [ 1441, 145 ], [ 1442, 146 ], [ 1443, 147 ], [ 1444, 148 ], [ 1445, 149 ], [ 1446, 150 ], [ 1447, 151 ], [ 1448, 152 ], [ 1449, 153 ], [ 1450, 154 ], [ 1451, 155 ], [ 1454, 157 ], [ 1455, 158 ], [ 1456, 159 ], [ 1457, 160 ] ], "uniquePlacement": true, "placementNotDetermined": false, "noCommonColumn": false, "hull": { "refStart": 1300, "refEnd": 1457, "crossesOrigin": false, "wholeCircle": false }, "selected": { "coordinates": [ [ 0, 1299, 1305, 1305, 1308, 1309, 1317, 1317, 1318, 1318, 1323, 1325, 1327, 1328, 1341, 1341, 1349, 1350, 1352, 1354, 1363, 1364, 1368, 1369, 1371, 1372, 1376, 1381, 1395, 1397, 1401, 1402, 1411, 1411, 1414, 1414, 1422, 1422, 1426, 1428, 1436, 1436, 1440, 1440, 1451, 1452, 1457, 1500 ], [ 0, 0, 6, 9, 12, 12, 20, 21, 22, 24, 29, 29, 31, 31, 44, 45, 53, 53, 55, 55, 64, 64, 68, 68, 70, 70, 74, 74, 88, 88, 92, 92, 101, 102, 105, 106, 114, 121, 125, 125, 133, 139, 143, 144, 155, 155, 160, 160 ] ], "gappedReference": "ATTCAC---TGGCCGTCGTTT-T--ACAACGTCGTGACTGGGAAAACC-CTGGCGTTACCCAACTTAATCGCCTTGCAGCACATCCCCCTTTCGCCAGCTGGCGTAATAGCGAAGAGGC-CCG-CACCGATC-------GCCCTTCCCAACAG------TTGC-GCAGCCTGAATGGCGAA", "gappedRead": "ATTCACCATTTG-CATCGTTTGTTGATAAC--CG-GACAGGGCACTCCACTCGCCTT-CC--AGTTCTGCG-AGTG-AG-ATAT-----TTATGCCAGCCAGC--CAGA-CGCAGACGCGCCGAGACAGAACTTAATGGGCCC--GCTAACAGCGCGATTTGCTGGTGACCCAAT-GCGAC", "columns": 181, "identical": 102, "mismatches": 35, "ambiguousColumns": 0, "gapColumns": 44, "gapOpens": 22, "identity": { "numerator": 102, "denominator": 181 }, "readAligned": { "bases": 160, "of": 160 }, "referenceCovered": { "bases": 158, "of": 1500 }, "placement": { "refStart": 1300, "refEnd": 1457, "readStart": 1, "readEnd": 160, "crossesOrigin": false, "asSupplied": { "readStart": 1, "readEnd": 160 } }, "overhang": [], "differences": [ { "kind": "insertion", "refAfter": 1305, "length": 3, "bases": "CAT", "readStart": 7, "readEnd": 9, "asSupplied": { "readStart": 152, "readEnd": 154, "bases": "ATG" }, "common": true }, { "kind": "substitution", "ref": 1307, "refBase": "G", "readBase": "T", "read": 11, "common": true, "asSupplied": { "read": 150, "readBase": "A" } }, { "kind": "deletion", "refStart": 1309, "refEnd": 1309, "length": 1, "bases": "C", "readAfter": 12, "asSupplied": { "readBetween": [ 148, 149 ] }, "common": false, "notFixed": { "from": { "ref": 1308, "read": 12, "readAsSupplied": 149 }, "to": { "ref": 1312, "read": 15, "readAsSupplied": 146 } } }, { "kind": "substitution", "ref": 1311, "refBase": "G", "readBase": "A", "read": 14, "common": false, "notFixed": { "from": { "ref": 1308, "read": 12, "readAsSupplied": 149 }, "to": { "ref": 1312, "read": 15, "readAsSupplied": 146 } }, "asSupplied": { "read": 147, "readBase": "T" } }, { "kind": "insertion", "refAfter": 1317, "length": 1, "bases": "G", "readStart": 21, "readEnd": 21, "asSupplied": { "readStart": 140, "readEnd": 140, "bases": "C" }, "common": false, "notFixed": { "from": { "ref": 1316, "read": 19, "readAsSupplied": 142 }, "to": { "ref": 1319, "read": 25, "readAsSupplied": 136 } } }, { "kind": "insertion", "refAfter": 1318, "length": 2, "bases": "TG", "readStart": 23, "readEnd": 24, "asSupplied": { "readStart": 137, "readEnd": 138, "bases": "CA" }, "common": false, "notFixed": { "from": { "ref": 1316, "read": 19, "readAsSupplied": 142 }, "to": { "ref": 1319, "read": 25, "readAsSupplied": 136 } } }, { "kind": "substitution", "ref": 1320, "refBase": "C", "readBase": "T", "read": 26, "common": true, "asSupplied": { "read": 135, "readBase": "A" } }, { "kind": "deletion", "refStart": 1324, "refEnd": 1325, "length": 2, "bases": "GT", "readAfter": 29, "asSupplied": { "readBetween": [ 131, 132 ] }, "common": true }, { "kind": "deletion", "refStart": 1328, "refEnd": 1328, "length": 1, "bases": "T", "readAfter": 31, "asSupplied": { "readBetween": [ 129, 130 ] }, "common": true }, { "kind": "substitution", "ref": 1332, "refBase": "T", "readBase": "A", "read": 35, "common": true, "asSupplied": { "read": 126, "readBase": "T" } }, { "kind": "substitution", "ref": 1336, "refBase": "A", "readBase": "C", "read": 39, "common": true, "asSupplied": { "read": 122, "readBase": "G" } }, { "kind": "substitution", "ref": 1338, "refBase": "A", "readBase": "C", "read": 41, "common": true, "asSupplied": { "read": 120, "readBase": "G" } }, { "kind": "substitution", "ref": 1339, "refBase": "A", "readBase": "T", "read": 42, "common": true, "asSupplied": { "read": 119, "readBase": "A" } }, { "kind": "insertion", "refAfter": 1341, "length": 1, "bases": "A", "readStart": 45, "readEnd": 45, "asSupplied": { "readStart": 116, "readEnd": 116, "bases": "T" }, "common": true }, { "kind": "substitution", "ref": 1344, "refBase": "G", "readBase": "C", "read": 48, "common": true, "asSupplied": { "read": 113, "readBase": "G" } }, { "kind": "substitution", "ref": 1347, "refBase": "G", "readBase": "C", "read": 51, "common": true, "asSupplied": { "read": 110, "readBase": "G" } }, { "kind": "deletion", "refStart": 1350, "refEnd": 1350, "length": 1, "bases": "A", "readAfter": 53, "asSupplied": { "readBetween": [ 107, 108 ] }, "common": false, "notFixed": { "from": { "ref": 1349, "read": 53, "readAsSupplied": 108 }, "to": { "ref": 1357, "read": 58, "readAsSupplied": 103 } } }, { "kind": "deletion", "refStart": 1353, "refEnd": 1354, "length": 2, "bases": "CA", "readAfter": 55, "asSupplied": { "readBetween": [ 105, 106 ] }, "common": false, "notFixed": { "from": { "ref": 1349, "read": 53, "readAsSupplied": 108 }, "to": { "ref": 1357, "read": 58, "readAsSupplied": 103 } } }, { "kind": "substitution", "ref": 1356, "refBase": "C", "readBase": "G", "read": 57, "common": false, "notFixed": { "from": { "ref": 1349, "read": 53, "readAsSupplied": 108 }, "to": { "ref": 1357, "read": 58, "readAsSupplied": 103 } }, "asSupplied": { "read": 104, "readBase": "C" } }, { "kind": "substitution", "ref": 1359, "refBase": "A", "readBase": "C", "read": 60, "common": true, "asSupplied": { "read": 101, "readBase": "G" } }, { "kind": "substitution", "ref": 1360, "refBase": "A", "readBase": "T", "read": 61, "common": true, "asSupplied": { "read": 100, "readBase": "A" } }, { "kind": "substitution", "ref": 1361, "refBase": "T", "readBase": "G", "read": 62, "common": true, "asSupplied": { "read": 99, "readBase": "C" } }, { "kind": "deletion", "refStart": 1364, "refEnd": 1364, "length": 1, "bases": "C", "readAfter": 64, "asSupplied": { "readBetween": [ 96, 97 ] }, "common": false, "notFixed": { "from": { "ref": 1363, "read": 64, "readAsSupplied": 97 }, "to": { "ref": 1368, "read": 68, "readAsSupplied": 93 } } }, { "kind": "substitution", "ref": 1365, "refBase": "C", "readBase": "A", "read": 65, "common": false, "notFixed": { "from": { "ref": 1363, "read": 64, "readAsSupplied": 97 }, "to": { "ref": 1368, "read": 68, "readAsSupplied": 93 } }, "asSupplied": { "read": 96, "readBase": "T" } }, { "kind": "substitution", "ref": 1366, "refBase": "T", "readBase": "G", "read": 66, "common": false, "notFixed": { "from": { "ref": 1363, "read": 64, "readAsSupplied": 97 }, "to": { "ref": 1368, "read": 68, "readAsSupplied": 93 } }, "asSupplied": { "read": 95, "readBase": "C" } }, { "kind": "deletion", "refStart": 1369, "refEnd": 1369, "length": 1, "bases": "C", "readAfter": 68, "asSupplied": { "readBetween": [ 92, 93 ] }, "common": true }, { "kind": "deletion", "refStart": 1372, "refEnd": 1372, "length": 1, "bases": "C", "readAfter": 70, "asSupplied": { "readBetween": [ 90, 91 ] }, "common": true }, { "kind": "substitution", "ref": 1374, "refBase": "C", "readBase": "T", "read": 72, "common": true, "asSupplied": { "read": 89, "readBase": "A" } }, { "kind": "deletion", "refStart": 1377, "refEnd": 1381, "length": 5, "bases": "CCCCC", "readAfter": 74, "asSupplied": { "readBetween": [ 86, 87 ] }, "common": true }, { "kind": "substitution", "ref": 1384, "refBase": "T", "readBase": "A", "read": 77, "common": true, "asSupplied": { "read": 84, "readBase": "T" } }, { "kind": "substitution", "ref": 1385, "refBase": "C", "readBase": "T", "read": 78, "common": true, "asSupplied": { "read": 83, "readBase": "A" } }, { "kind": "substitution", "ref": 1392, "refBase": "T", "readBase": "C", "read": 85, "common": true, "asSupplied": { "read": 76, "readBase": "G" } }, { "kind": "substitution", "ref": 1393, "refBase": "G", "readBase": "A", "read": 86, "common": true, "asSupplied": { "read": 75, "readBase": "T" } }, { "kind": "deletion", "refStart": 1396, "refEnd": 1397, "length": 2, "bases": "GT", "readAfter": 88, "asSupplied": { "readBetween": [ 72, 73 ] }, "common": false, "notFixed": { "from": { "ref": 1395, "read": 88, "readAsSupplied": 73 }, "to": { "ref": 1399, "read": 90, "readAsSupplied": 71 } } }, { "kind": "substitution", "ref": 1398, "refBase": "A", "readBase": "C", "read": 89, "common": false, "notFixed": { "from": { "ref": 1395, "read": 88, "readAsSupplied": 73 }, "to": { "ref": 1399, "read": 90, "readAsSupplied": 71 } }, "asSupplied": { "read": 72, "readBase": "G" } }, { "kind": "substitution", "ref": 1400, "refBase": "T", "readBase": "G", "read": 91, "common": true, "asSupplied": { "read": 70, "readBase": "C" } }, { "kind": "deletion", "refStart": 1402, "refEnd": 1402, "length": 1, "bases": "G", "readAfter": 92, "asSupplied": { "readBetween": [ 68, 69 ] }, "common": true }, { "kind": "substitution", "ref": 1405, "refBase": "A", "readBase": "C", "read": 95, "common": true, "asSupplied": { "read": 66, "readBase": "G" } }, { "kind": "substitution", "ref": 1409, "refBase": "G", "readBase": "C", "read": 99, "common": true, "asSupplied": { "read": 62, "readBase": "G" } }, { "kind": "insertion", "refAfter": 1411, "length": 1, "bases": "G", "readStart": 102, "readEnd": 102, "asSupplied": { "readStart": 59, "readEnd": 59, "bases": "C" }, "common": true }, { "kind": "insertion", "refAfter": 1414, "length": 1, "bases": "A", "readStart": 106, "readEnd": 106, "asSupplied": { "readStart": 55, "readEnd": 55, "bases": "T" }, "common": false, "notFixed": { "from": { "ref": 1414, "read": 105, "readAsSupplied": 56 }, "to": { "ref": 1416, "read": 108, "readAsSupplied": 53 } } }, { "kind": "substitution", "ref": 1415, "refBase": "C", "readBase": "G", "read": 107, "common": false, "notFixed": { "from": { "ref": 1414, "read": 105, "readAsSupplied": 56 }, "to": { "ref": 1416, "read": 108, "readAsSupplied": 53 } }, "asSupplied": { "read": 54, "readBase": "C" } }, { "kind": "substitution", "ref": 1418, "refBase": "C", "readBase": "A", "read": 110, "common": true, "asSupplied": { "read": 51, "readBase": "T" } }, { "kind": "substitution", "ref": 1421, "refBase": "T", "readBase": "A", "read": 113, "common": true, "asSupplied": { "read": 48, "readBase": "T" } }, { "kind": "insertion", "refAfter": 1422, "length": 7, "bases": "TTAATGG", "readStart": 115, "readEnd": 121, "asSupplied": { "readStart": 40, "readEnd": 46, "bases": "CCATTAA" }, "common": true }, { "kind": "deletion", "refStart": 1427, "refEnd": 1428, "length": 2, "bases": "TT", "readAfter": 125, "asSupplied": { "readBetween": [ 35, 36 ] }, "common": false, "notFixed": { "from": { "ref": 1426, "read": 125, "readAsSupplied": 36 }, "to": { "ref": 1430, "read": 127, "readAsSupplied": 34 } } }, { "kind": "substitution", "ref": 1429, "refBase": "C", "readBase": "G", "read": 126, "common": false, "notFixed": { "from": { "ref": 1426, "read": 125, "readAsSupplied": 36 }, "to": { "ref": 1430, "read": 127, "readAsSupplied": 34 } }, "asSupplied": { "read": 35, "readBase": "C" } }, { "kind": "substitution", "ref": 1431, "refBase": "C", "readBase": "T", "read": 128, "common": true, "asSupplied": { "read": 33, "readBase": "A" } }, { "kind": "insertion", "refAfter": 1436, "length": 6, "bases": "CGCGAT", "readStart": 134, "readEnd": 139, "asSupplied": { "readStart": 22, "readEnd": 27, "bases": "ATCGCG" }, "common": true }, { "kind": "insertion", "refAfter": 1440, "length": 1, "bases": "T", "readStart": 144, "readEnd": 144, "asSupplied": { "readStart": 17, "readEnd": 17, "bases": "A" }, "common": true }, { "kind": "substitution", "ref": 1442, "refBase": "C", "readBase": "G", "read": 146, "common": true, "asSupplied": { "read": 15, "readBase": "C" } }, { "kind": "substitution", "ref": 1443, "refBase": "A", "readBase": "T", "read": 147, "common": true, "asSupplied": { "read": 14, "readBase": "A" } }, { "kind": "substitution", "ref": 1445, "refBase": "C", "readBase": "A", "read": 149, "common": true, "asSupplied": { "read": 12, "readBase": "T" } }, { "kind": "substitution", "ref": 1447, "refBase": "T", "readBase": "C", "read": 151, "common": true, "asSupplied": { "read": 10, "readBase": "G" } }, { "kind": "substitution", "ref": 1448, "refBase": "G", "readBase": "C", "read": 152, "common": true, "asSupplied": { "read": 9, "readBase": "G" } }, { "kind": "deletion", "refStart": 1452, "refEnd": 1452, "length": 1, "bases": "G", "readAfter": 155, "asSupplied": { "readBetween": [ 5, 6 ] }, "common": false, "notFixed": { "from": { "ref": 1451, "read": 155, "readAsSupplied": 6 }, "to": { "ref": 1454, "read": 157, "readAsSupplied": 4 } } }, { "kind": "substitution", "ref": 1457, "refBase": "A", "readBase": "C", "read": 160, "common": true, "asSupplied": { "read": 1, "readBase": "G" } } ] }, "band": { "diagonalMin": 1294, "diagonalMax": 1310, "cellsNeeded": 3059, "unionBandLimited": false, "scope": "every optimal path", "gridCells": 241661, "searchedBanded": true, "sharedWords": 0, "sharedWordsOverCap": false, "seedGuarantee": { "differencesUpTo": 187, "guaranteed": false } }, "enumeration": "checked", "tuples": [ [ 102, 0, 181, 35, 44, 22, 160, 158 ] ], "tupleFields": [ "identical", "ambiguousColumns", "columns", "mismatches", "gapColumns", "gapOpens", "readAligned", "referenceCovered" ], "variation": { "readAligned": { "shared": true, "min": 160, "max": 160 }, "referenceCovered": { "shared": true, "min": 158, "max": 158 }, "identity": { "shared": true, "min": { "numerator": 102, "denominator": 181 }, "max": { "numerator": 102, "denominator": 181 } }, "overhangStart": { "shared": true, "min": 0, "max": 0 }, "overhangEnd": { "shared": true, "min": 0, "max": 0 } }, "placements": [ { "refStart": 1300, "refEnd": 1457, "crossesOrigin": false, "wholeCircle": false, "readStart": 1, "readEnd": 160, "asSupplied": { "readStart": 1, "readEnd": 160 }, "alignments": 2304, "band": { "diagonalMin": 1294, "diagonalMax": 1310, "cellsNeeded": 3059, "bandLimited": false } } ] } }, { "mode": "local", "region": null, "strand": "+", "strandUndetermined": false, "plus": { "score": 247, "count": 1, "overCap": false, "state": "aligned", "biopython": { "score": 247, "count": 1 }, "uniquePairs": [ [ 601, 1 ], [ 602, 2 ], [ 603, 3 ], [ 604, 4 ], [ 605, 5 ], [ 606, 6 ], [ 607, 7 ], [ 608, 8 ], [ 609, 9 ], [ 610, 10 ], [ 611, 11 ], [ 612, 12 ], [ 613, 13 ], [ 614, 14 ], [ 615, 15 ], [ 616, 16 ], [ 617, 17 ], [ 618, 18 ], [ 619, 19 ], [ 620, 20 ], [ 621, 21 ], [ 622, 22 ], [ 623, 23 ], [ 624, 24 ], [ 625, 25 ], [ 626, 26 ], [ 627, 27 ], [ 628, 28 ], [ 629, 29 ], [ 630, 30 ], [ 631, 31 ], [ 632, 32 ], [ 633, 33 ], [ 634, 34 ], [ 635, 35 ], [ 636, 36 ], [ 637, 37 ], [ 638, 38 ], [ 639, 39 ], [ 640, 40 ], [ 641, 41 ], [ 642, 42 ], [ 643, 43 ], [ 644, 44 ], [ 645, 45 ], [ 646, 46 ], [ 647, 47 ], [ 648, 48 ], [ 649, 49 ], [ 650, 50 ], [ 651, 51 ], [ 652, 52 ], [ 653, 53 ], [ 654, 54 ], [ 655, 55 ], [ 656, 56 ], [ 657, 57 ], [ 658, 58 ], [ 659, 59 ], [ 660, 60 ], [ 661, 61 ], [ 662, 62 ], [ 663, 63 ], [ 664, 64 ], [ 665, 65 ], [ 666, 66 ], [ 667, 67 ], [ 668, 68 ], [ 669, 69 ], [ 670, 70 ], [ 671, 71 ], [ 672, 72 ], [ 673, 73 ], [ 674, 74 ], [ 675, 75 ], [ 676, 76 ], [ 677, 77 ], [ 678, 78 ], [ 679, 79 ], [ 680, 80 ], [ 681, 81 ], [ 682, 82 ], [ 683, 83 ], [ 684, 84 ], [ 685, 85 ], [ 686, 86 ], [ 687, 87 ], [ 688, 88 ], [ 689, 89 ], [ 690, 90 ], [ 691, 91 ], [ 692, 92 ], [ 693, 93 ], [ 694, 94 ], [ 695, 95 ], [ 696, 96 ], [ 697, 97 ], [ 698, 98 ], [ 699, 99 ], [ 700, 100 ], [ 721, 101 ], [ 722, 102 ], [ 723, 103 ], [ 724, 104 ], [ 725, 105 ], [ 726, 106 ], [ 727, 107 ], [ 728, 108 ], [ 729, 109 ], [ 730, 110 ], [ 731, 111 ], [ 732, 112 ], [ 733, 113 ], [ 734, 114 ], [ 735, 115 ], [ 736, 116 ], [ 737, 117 ], [ 738, 118 ], [ 739, 119 ], [ 740, 120 ], [ 741, 121 ], [ 742, 122 ], [ 743, 123 ], [ 744, 124 ], [ 745, 125 ], [ 746, 126 ], [ 747, 127 ], [ 748, 128 ], [ 749, 129 ], [ 750, 130 ], [ 751, 131 ], [ 752, 132 ], [ 753, 133 ], [ 754, 134 ], [ 755, 135 ], [ 756, 136 ], [ 757, 137 ], [ 758, 138 ], [ 759, 139 ], [ 760, 140 ], [ 761, 141 ], [ 762, 142 ], [ 763, 143 ], [ 764, 144 ], [ 765, 145 ], [ 766, 146 ], [ 767, 147 ], [ 768, 148 ], [ 769, 149 ], [ 770, 150 ], [ 771, 151 ], [ 772, 152 ], [ 773, 153 ], [ 774, 154 ], [ 775, 155 ], [ 776, 156 ], [ 777, 157 ], [ 778, 158 ], [ 779, 159 ], [ 780, 160 ] ], "uniquePlacement": true, "placementNotDetermined": false, "noCommonColumn": false, "hull": { "refStart": 601, "refEnd": 780, "crossesOrigin": false, "wholeCircle": false }, "selected": { "coordinates": [ [ 600, 700, 720, 780 ], [ 0, 100, 100, 160 ] ], "gappedReference": "GTCGCATTGGGTCACCAGCAAATCGCGCTGTTAGCGGGCCCATTAAGTTCTGTCTCGGCGCGTCTGCGTCTGGCTGGCTGGCATAAATATCTCACTCGCAATCAAATTCAGCCGATAGCGGAACGGGAAGGCGACTGGAGTGCCATGTCCGGTTTTCAACAAACCATGCAAATGCTGAAT", "gappedRead": "GTCGCATTGGGTCACCAGCAAATCGCGCTGTTAGCGGGCCCATTAAGTTCTGTCTCGGCGCGTCTGCGTCTGGCTGGCTGGCATAAATATCTCACTCGCA--------------------GAACTGGAAGGCGAGTGGAGTGCCCTGTCCGGTTATCAACAAACGATGCAAATGGTGAAT", "columns": 180, "identical": 154, "mismatches": 6, "ambiguousColumns": 0, "gapColumns": 20, "gapOpens": 1, "identity": { "numerator": 154, "denominator": 180 }, "readAligned": { "bases": 160, "of": 160 }, "referenceCovered": { "bases": 180, "of": 1500 }, "placement": { "refStart": 601, "refEnd": 780, "readStart": 1, "readEnd": 160, "crossesOrigin": false }, "overhang": [], "differences": [ { "kind": "deletion", "refStart": 701, "refEnd": 720, "length": 20, "bases": "ATCAAATTCAGCCGATAGCG", "readAfter": 100, "common": true }, { "kind": "substitution", "ref": 725, "refBase": "G", "readBase": "T", "read": 105, "common": true }, { "kind": "substitution", "ref": 735, "refBase": "C", "readBase": "G", "read": 115, "common": true }, { "kind": "substitution", "ref": 745, "refBase": "A", "readBase": "C", "read": 125, "common": true }, { "kind": "substitution", "ref": 755, "refBase": "T", "readBase": "A", "read": 135, "common": true }, { "kind": "substitution", "ref": 765, "refBase": "C", "readBase": "G", "read": 145, "common": true }, { "kind": "substitution", "ref": 775, "refBase": "C", "readBase": "G", "read": 155, "common": true } ] }, "band": { "diagonalMin": 600, "diagonalMax": 620, "cellsNeeded": 3703, "unionBandLimited": false, "scope": "every optimal path", "gridCells": 241661, "searchedBanded": true, "sharedWords": 89, "sharedWordsOverCap": false, "seedGuarantee": { "differencesUpTo": 36, "guaranteed": false } }, "enumeration": "listed", "alignments": [ [ [ 600, 700, 720, 780 ], [ 0, 100, 100, 160 ] ] ], "tuples": [ [ 154, 0, 180, 6, 20, 1, 160, 180 ] ], "tupleFields": [ "identical", "ambiguousColumns", "columns", "mismatches", "gapColumns", "gapOpens", "readAligned", "referenceCovered" ], "variation": { "readAligned": { "shared": true, "min": 160, "max": 160 }, "referenceCovered": { "shared": true, "min": 180, "max": 180 }, "identity": { "shared": true, "min": { "numerator": 77, "denominator": 90 }, "max": { "numerator": 77, "denominator": 90 } }, "overhangStart": { "shared": true, "min": 0, "max": 0 }, "overhangEnd": { "shared": true, "min": 0, "max": 0 } }, "placements": [ { "refStart": 601, "refEnd": 780, "crossesOrigin": false, "wholeCircle": false, "readStart": 1, "readEnd": 160, "alignments": 1, "band": { "diagonalMin": 600, "diagonalMax": 620, "cellsNeeded": 3703, "bandLimited": false } } ] }, "minus": { "score": 17, "count": 3, "overCap": false, "state": "aligned", "biopython": { "score": 17, "count": 3 }, "uniquePairs": [], "uniquePlacement": false, "placementNotDetermined": false, "noCommonColumn": false, "hull": { "refStart": 153, "refEnd": 1371, "crossesOrigin": false, "wholeCircle": false }, "selected": { "coordinates": [ [ 152, 155, 156, 164 ], [ 79, 82, 82, 90 ] ], "gappedReference": "CCAGGCCAGCCA", "gappedRead": "CCA-GCCAGCCA", "columns": 12, "identical": 11, "mismatches": 0, "ambiguousColumns": 0, "gapColumns": 1, "gapOpens": 1, "identity": { "numerator": 11, "denominator": 12 }, "readAligned": { "bases": 11, "of": 160 }, "referenceCovered": { "bases": 12, "of": 1500 }, "placement": { "refStart": 153, "refEnd": 164, "readStart": 80, "readEnd": 90, "crossesOrigin": false, "asSupplied": { "readStart": 71, "readEnd": 81 } }, "overhang": [], "differences": [ { "kind": "deletion", "refStart": 156, "refEnd": 156, "length": 1, "bases": "G", "readAfter": 82, "asSupplied": { "readBetween": [ 78, 79 ] }, "common": false, "notFixed": { "from": null, "to": null } } ] }, "band": { "diagonalMin": 73, "diagonalMax": 1314, "cellsNeeded": 200284, "unionBandLimited": true, "scope": "every optimal path", "gridCells": 241661, "searchedBanded": true, "sharedWords": 0, "sharedWordsOverCap": false, "seedGuarantee": { "differencesUpTo": 151, "guaranteed": false } }, "enumeration": "listed", "alignments": [ [ [ 152, 155, 156, 164 ], [ 79, 82, 82, 90 ] ], [ [ 152, 156, 157, 164 ], [ 79, 83, 83, 90 ] ], [ [ 1360, 1371 ], [ 46, 57 ] ] ], "tuples": [ [ 10, 0, 11, 1, 0, 0, 11, 11 ], [ 11, 0, 12, 0, 1, 1, 11, 12 ] ], "tupleFields": [ "identical", "ambiguousColumns", "columns", "mismatches", "gapColumns", "gapOpens", "readAligned", "referenceCovered" ], "variation": { "readAligned": { "shared": true, "min": 11, "max": 11 }, "referenceCovered": { "shared": false, "min": 11, "max": 12 }, "identity": { "shared": false, "min": { "numerator": 10, "denominator": 11 }, "max": { "numerator": 11, "denominator": 12 } }, "overhangStart": { "shared": true, "min": 0, "max": 0 }, "overhangEnd": { "shared": true, "min": 0, "max": 0 } }, "placements": [ { "refStart": 153, "refEnd": 164, "crossesOrigin": false, "wholeCircle": false, "readStart": 80, "readEnd": 90, "asSupplied": { "readStart": 71, "readEnd": 81 }, "alignments": 2, "band": { "diagonalMin": 73, "diagonalMax": 74, "cellsNeeded": 644, "bandLimited": false } }, { "refStart": 1361, "refEnd": 1371, "crossesOrigin": false, "wholeCircle": false, "readStart": 47, "readEnd": 57, "asSupplied": { "readStart": 104, "readEnd": 114 }, "alignments": 1, "band": { "diagonalMin": 1314, "diagonalMax": 1314, "cellsNeeded": 483, "bandLimited": false } } ] } } ] } }, { "id": "origin-deletion", "note": "7a: a circular reference (J01636.1 1201-1280) and a read starting 20 bases before the origin, 18 of them read, with a 22-base deletion that itself spans the origin; a reference extended by the read's length minus one cannot hold it.", "input": { "reference": { "residues": "ACCCCAGGCTTTACACTTTATGCTTCCGGCTCGTATGTTGTGTGGAATTGTGAGCGGATAACAATTTCACACAGGAAACA", "topology": "circular", "source": "J01636.1 1201-1280, circular" }, "read": { "residues": "ACAATTTCACACAGGAAATGCTTCCGGCTCGTATGTTGTGTGGAATTGTG", "source": "reference bases 61-78 then 21-52" }, "modes": [ "semiglobal-read", "local" ] }, "expected": { "results": [ { "mode": "semiglobal-read", "region": null, "strand": "+", "strandUndetermined": false, "plus": { "score": 53, "count": 2, "overCap": false, "state": "aligned", "biopython": { "score": 53, "count": 2, "tailScore": 52, "tailCountSubtracted": 0, "certifiedText": { "extension": 50, "textLength": 179, "reruns": 0, "differencesUpTo": 23 } }, "uniquePairs": [ [ 61, 1 ], [ 62, 2 ], [ 63, 3 ], [ 64, 4 ], [ 65, 5 ], [ 66, 6 ], [ 67, 7 ], [ 68, 8 ], [ 69, 9 ], [ 70, 10 ], [ 71, 11 ], [ 72, 12 ], [ 73, 13 ], [ 74, 14 ], [ 75, 15 ], [ 76, 16 ], [ 77, 17 ], [ 21, 19 ], [ 22, 20 ], [ 23, 21 ], [ 24, 22 ], [ 25, 23 ], [ 26, 24 ], [ 27, 25 ], [ 28, 26 ], [ 29, 27 ], [ 30, 28 ], [ 31, 29 ], [ 32, 30 ], [ 33, 31 ], [ 34, 32 ], [ 35, 33 ], [ 36, 34 ], [ 37, 35 ], [ 38, 36 ], [ 39, 37 ], [ 40, 38 ], [ 41, 39 ], [ 42, 40 ], [ 43, 41 ], [ 44, 42 ], [ 45, 43 ], [ 46, 44 ], [ 47, 45 ], [ 48, 46 ], [ 49, 47 ], [ 50, 48 ], [ 51, 49 ], [ 52, 50 ] ], "uniquePlacement": true, "placementNotDetermined": false, "noCommonColumn": false, "hull": { "refStart": 61, "refEnd": 52, "crossesOrigin": true, "wholeCircle": false }, "selected": { "coordinates": [ [ 0, 60, 77, 99, 132 ], [ 0, 0, 17, 17, 50 ] ], "gappedReference": "ACAATTTCACACAGGAAACAACCCCAGGCTTTACACTTTATGCTTCCGGCTCGTATGTTGTGTGGAATTGTG", "gappedRead": "ACAATTTCACACAGGAA----------------------ATGCTTCCGGCTCGTATGTTGTGTGGAATTGTG", "columns": 72, "identical": 50, "mismatches": 0, "ambiguousColumns": 0, "gapColumns": 22, "gapOpens": 1, "identity": { "numerator": 50, "denominator": 72 }, "readAligned": { "bases": 50, "of": 50 }, "referenceCovered": { "bases": 72, "of": 80 }, "placement": { "refStart": 61, "refEnd": 52, "readStart": 1, "readEnd": 50, "crossesOrigin": true }, "overhang": [], "differences": [ { "kind": "deletion", "refStart": 78, "refEnd": 19, "length": 22, "bases": "ACAACCCCAGGCTTTACACTTT", "readAfter": 17, "crossesOrigin": true, "common": false, "notFixed": { "from": { "ref": 77, "read": 17 }, "to": { "ref": 21, "read": 19 } } } ] }, "band": { "diagonalMin": 60, "diagonalMax": 82, "cellsNeeded": 1275, "unionBandLimited": false, "scope": "every optimal path", "gridCells": 9180, "searchedBanded": false, "sharedWords": 29, "sharedWordsOverCap": false, "seedGuarantee": { "differencesUpTo": 23, "guaranteed": false } }, "enumeration": "listed", "alignments": [ [ [ 0, 60, 77, 99, 132 ], [ 0, 0, 17, 17, 50 ] ], [ [ 0, 60, 78, 100, 132 ], [ 0, 0, 18, 18, 50 ] ] ], "tuples": [ [ 50, 0, 72, 0, 22, 1, 50, 72 ] ], "tupleFields": [ "identical", "ambiguousColumns", "columns", "mismatches", "gapColumns", "gapOpens", "readAligned", "referenceCovered" ], "variation": { "readAligned": { "shared": true, "min": 50, "max": 50 }, "referenceCovered": { "shared": true, "min": 72, "max": 72 }, "identity": { "shared": true, "min": { "numerator": 25, "denominator": 36 }, "max": { "numerator": 25, "denominator": 36 } }, "overhangStart": { "shared": true, "min": 0, "max": 0 }, "overhangEnd": { "shared": true, "min": 0, "max": 0 } }, "placements": [ { "refStart": 61, "refEnd": 52, "crossesOrigin": true, "wholeCircle": false, "readStart": 1, "readEnd": 50, "alignments": 2, "band": { "diagonalMin": 60, "diagonalMax": 82, "cellsNeeded": 1275, "bandLimited": false } } ] }, "minus": { "score": -3, "count": 8, "overCap": false, "state": "aligned", "biopython": { "score": -3, "count": 8, "tailScore": -5, "tailCountSubtracted": 0, "certifiedText": { "extension": 51, "textLength": 180, "reruns": 1, "differencesUpTo": 51 } }, "uniquePairs": [ [ 60, 1 ], [ 61, 2 ], [ 62, 3 ], [ 63, 4 ], [ 64, 5 ], [ 65, 6 ], [ 66, 7 ], [ 67, 8 ], [ 68, 9 ], [ 69, 10 ], [ 70, 11 ], [ 71, 12 ], [ 72, 13 ], [ 73, 14 ], [ 74, 15 ], [ 75, 16 ], [ 76, 17 ], [ 77, 18 ], [ 78, 19 ], [ 79, 20 ], [ 6, 28 ], [ 7, 29 ], [ 8, 30 ], [ 9, 31 ], [ 10, 32 ], [ 11, 33 ], [ 12, 34 ], [ 13, 35 ], [ 14, 36 ], [ 16, 37 ], [ 17, 38 ], [ 18, 39 ], [ 19, 40 ], [ 20, 41 ], [ 21, 42 ], [ 22, 43 ], [ 24, 47 ], [ 25, 48 ], [ 26, 49 ], [ 27, 50 ] ], "uniquePlacement": true, "placementNotDetermined": false, "noCommonColumn": false, "hull": { "refStart": 60, "refEnd": 27, "crossesOrigin": true, "wholeCircle": false }, "selected": { "coordinates": [ [ 0, 59, 79, 79, 94, 95, 102, 102, 107 ], [ 0, 0, 20, 21, 36, 36, 43, 45, 50 ] ], "gappedReference": "AACAATTTCACACAGGAAAC-AACCCCAGGCTTTACACTTTATG--CTTCC", "gappedRead": "CACAATTCCACACAACATACGAGCCGGAAGCATTTC-CTGTGTGAAATTGT", "columns": 51, "identical": 31, "mismatches": 16, "ambiguousColumns": 0, "gapColumns": 4, "gapOpens": 3, "identity": { "numerator": 31, "denominator": 51 }, "readAligned": { "bases": 50, "of": 50 }, "referenceCovered": { "bases": 48, "of": 80 }, "placement": { "refStart": 60, "refEnd": 27, "readStart": 1, "readEnd": 50, "crossesOrigin": true, "asSupplied": { "readStart": 1, "readEnd": 50 } }, "overhang": [], "differences": [ { "kind": "substitution", "ref": 60, "refBase": "A", "readBase": "C", "read": 1, "common": true, "asSupplied": { "read": 50, "readBase": "G" } }, { "kind": "substitution", "ref": 67, "refBase": "T", "readBase": "C", "read": 8, "common": true, "asSupplied": { "read": 43, "readBase": "G" } }, { "kind": "substitution", "ref": 74, "refBase": "G", "readBase": "A", "read": 15, "common": true, "asSupplied": { "read": 36, "readBase": "T" } }, { "kind": "substitution", "ref": 75, "refBase": "G", "readBase": "C", "read": 16, "common": true, "asSupplied": { "read": 35, "readBase": "G" } }, { "kind": "substitution", "ref": 77, "refBase": "A", "readBase": "T", "read": 18, "common": true, "asSupplied": { "read": 33, "readBase": "A" } }, { "kind": "insertion", "refAfter": 79, "length": 1, "bases": "G", "readStart": 21, "readEnd": 21, "asSupplied": { "readStart": 30, "readEnd": 30, "bases": "C" }, "common": false, "notFixed": { "from": { "ref": 79, "read": 20, "readAsSupplied": 31 }, "to": { "ref": 6, "read": 28, "readAsSupplied": 23 } } }, { "kind": "substitution", "ref": 1, "refBase": "A", "readBase": "G", "read": 23, "common": false, "notFixed": { "from": { "ref": 79, "read": 20, "readAsSupplied": 31 }, "to": { "ref": 6, "read": 28, "readAsSupplied": 23 } }, "asSupplied": { "read": 28, "readBase": "C" } }, { "kind": "substitution", "ref": 4, "refBase": "C", "readBase": "G", "read": 26, "common": false, "notFixed": { "from": { "ref": 79, "read": 20, "readAsSupplied": 31 }, "to": { "ref": 6, "read": 28, "readAsSupplied": 23 } }, "asSupplied": { "read": 25, "readBase": "C" } }, { "kind": "substitution", "ref": 5, "refBase": "C", "readBase": "G", "read": 27, "common": false, "notFixed": { "from": { "ref": 79, "read": 20, "readAsSupplied": 31 }, "to": { "ref": 6, "read": 28, "readAsSupplied": 23 } }, "asSupplied": { "read": 24, "readBase": "C" } }, { "kind": "substitution", "ref": 7, "refBase": "G", "readBase": "A", "read": 29, "common": true, "asSupplied": { "read": 22, "readBase": "T" } }, { "kind": "substitution", "ref": 10, "refBase": "T", "readBase": "A", "read": 32, "common": true, "asSupplied": { "read": 19, "readBase": "T" } }, { "kind": "substitution", "ref": 13, "refBase": "A", "readBase": "T", "read": 35, "common": true, "asSupplied": { "read": 16, "readBase": "A" } }, { "kind": "deletion", "refStart": 15, "refEnd": 15, "length": 1, "bases": "A", "readAfter": 36, "asSupplied": { "readBetween": [ 14, 15 ] }, "common": true }, { "kind": "substitution", "ref": 18, "refBase": "T", "readBase": "G", "read": 39, "common": true, "asSupplied": { "read": 12, "readBase": "C" } }, { "kind": "substitution", "ref": 20, "refBase": "A", "readBase": "G", "read": 41, "common": true, "asSupplied": { "read": 10, "readBase": "C" } }, { "kind": "insertion", "refAfter": 22, "length": 2, "bases": "AA", "readStart": 44, "readEnd": 45, "asSupplied": { "readStart": 6, "readEnd": 7, "bases": "TT" }, "common": false, "notFixed": { "from": { "ref": 22, "read": 43, "readAsSupplied": 8 }, "to": { "ref": 24, "read": 47, "readAsSupplied": 4 } } }, { "kind": "substitution", "ref": 23, "refBase": "C", "readBase": "A", "read": 46, "common": false, "notFixed": { "from": { "ref": 22, "read": 43, "readAsSupplied": 8 }, "to": { "ref": 24, "read": 47, "readAsSupplied": 4 } }, "asSupplied": { "read": 5, "readBase": "T" } }, { "kind": "substitution", "ref": 26, "refBase": "C", "readBase": "G", "read": 49, "common": true, "asSupplied": { "read": 2, "readBase": "C" } }, { "kind": "substitution", "ref": 27, "refBase": "C", "readBase": "T", "read": 50, "common": true, "asSupplied": { "read": 1, "readBase": "A" } } ] }, "band": { "diagonalMin": 57, "diagonalMax": 59, "cellsNeeded": 255, "unionBandLimited": false, "scope": "every optimal path", "gridCells": 9231, "searchedBanded": false, "sharedWords": 0, "sharedWordsOverCap": false, "seedGuarantee": { "differencesUpTo": 51, "guaranteed": false } }, "enumeration": "listed", "alignments": [ [ [ 0, 59, 79, 79, 94, 95, 102, 102, 107 ], [ 0, 0, 20, 21, 36, 36, 43, 45, 50 ] ], [ [ 0, 59, 81, 81, 94, 95, 102, 102, 107 ], [ 0, 0, 22, 23, 36, 36, 43, 45, 50 ] ], [ [ 0, 59, 84, 84, 94, 95, 102, 102, 107 ], [ 0, 0, 25, 26, 36, 36, 43, 45, 50 ] ], [ [ 0, 59, 85, 85, 94, 95, 102, 102, 107 ], [ 0, 0, 26, 27, 36, 36, 43, 45, 50 ] ], [ [ 0, 59, 79, 79, 94, 95, 103, 103, 107 ], [ 0, 0, 20, 21, 36, 36, 44, 46, 50 ] ], [ [ 0, 59, 81, 81, 94, 95, 103, 103, 107 ], [ 0, 0, 22, 23, 36, 36, 44, 46, 50 ] ], [ [ 0, 59, 84, 84, 94, 95, 103, 103, 107 ], [ 0, 0, 25, 26, 36, 36, 44, 46, 50 ] ], [ [ 0, 59, 85, 85, 94, 95, 103, 103, 107 ], [ 0, 0, 26, 27, 36, 36, 44, 46, 50 ] ] ], "tuples": [ [ 31, 0, 51, 16, 4, 3, 50, 48 ] ], "tupleFields": [ "identical", "ambiguousColumns", "columns", "mismatches", "gapColumns", "gapOpens", "readAligned", "referenceCovered" ], "variation": { "readAligned": { "shared": true, "min": 50, "max": 50 }, "referenceCovered": { "shared": true, "min": 48, "max": 48 }, "identity": { "shared": true, "min": { "numerator": 31, "denominator": 51 }, "max": { "numerator": 31, "denominator": 51 } }, "overhangStart": { "shared": true, "min": 0, "max": 0 }, "overhangEnd": { "shared": true, "min": 0, "max": 0 } }, "placements": [ { "refStart": 60, "refEnd": 27, "crossesOrigin": true, "wholeCircle": false, "readStart": 1, "readEnd": 50, "asSupplied": { "readStart": 1, "readEnd": 50 }, "alignments": 8, "band": { "diagonalMin": 57, "diagonalMax": 59, "cellsNeeded": 255, "bandLimited": false } } ] } }, { "mode": "local", "region": null, "strand": "+", "strandUndetermined": false, "plus": { "score": 66, "count": 1, "overCap": false, "state": "aligned", "biopython": { "score": 66, "count": 2, "tailScore": 66, "tailCountSubtracted": 1, "certifiedText": { "extension": 50, "textLength": 179, "reruns": 0, "differencesUpTo": 17 } }, "uniquePairs": [ [ 20, 18 ], [ 21, 19 ], [ 22, 20 ], [ 23, 21 ], [ 24, 22 ], [ 25, 23 ], [ 26, 24 ], [ 27, 25 ], [ 28, 26 ], [ 29, 27 ], [ 30, 28 ], [ 31, 29 ], [ 32, 30 ], [ 33, 31 ], [ 34, 32 ], [ 35, 33 ], [ 36, 34 ], [ 37, 35 ], [ 38, 36 ], [ 39, 37 ], [ 40, 38 ], [ 41, 39 ], [ 42, 40 ], [ 43, 41 ], [ 44, 42 ], [ 45, 43 ], [ 46, 44 ], [ 47, 45 ], [ 48, 46 ], [ 49, 47 ], [ 50, 48 ], [ 51, 49 ], [ 52, 50 ] ], "uniquePlacement": true, "placementNotDetermined": false, "noCommonColumn": false, "hull": { "refStart": 20, "refEnd": 52, "crossesOrigin": false, "wholeCircle": false }, "selected": { "coordinates": [ [ 19, 52 ], [ 17, 50 ] ], "gappedReference": "ATGCTTCCGGCTCGTATGTTGTGTGGAATTGTG", "gappedRead": "ATGCTTCCGGCTCGTATGTTGTGTGGAATTGTG", "columns": 33, "identical": 33, "mismatches": 0, "ambiguousColumns": 0, "gapColumns": 0, "gapOpens": 0, "identity": { "numerator": 33, "denominator": 33 }, "readAligned": { "bases": 33, "of": 50 }, "referenceCovered": { "bases": 33, "of": 80 }, "placement": { "refStart": 20, "refEnd": 52, "readStart": 18, "readEnd": 50, "crossesOrigin": false }, "overhang": [], "differences": [] }, "band": { "diagonalMin": 2, "diagonalMax": 2, "cellsNeeded": 153, "unionBandLimited": false, "scope": "every optimal path", "gridCells": 9180, "searchedBanded": false, "sharedWords": 29, "sharedWordsOverCap": false, "seedGuarantee": { "differencesUpTo": 17, "guaranteed": false } }, "enumeration": "listed", "alignments": [ [ [ 19, 52 ], [ 17, 50 ] ] ], "tuples": [ [ 33, 0, 33, 0, 0, 0, 33, 33 ] ], "tupleFields": [ "identical", "ambiguousColumns", "columns", "mismatches", "gapColumns", "gapOpens", "readAligned", "referenceCovered" ], "variation": { "readAligned": { "shared": true, "min": 33, "max": 33 }, "referenceCovered": { "shared": true, "min": 33, "max": 33 }, "identity": { "shared": true, "min": { "numerator": 1, "denominator": 1 }, "max": { "numerator": 1, "denominator": 1 } }, "overhangStart": { "shared": true, "min": 0, "max": 0 }, "overhangEnd": { "shared": true, "min": 0, "max": 0 } }, "placements": [ { "refStart": 20, "refEnd": 52, "crossesOrigin": false, "wholeCircle": false, "readStart": 18, "readEnd": 50, "alignments": 1, "band": { "diagonalMin": 2, "diagonalMax": 2, "cellsNeeded": 153, "bandLimited": false } } ] }, "minus": { "score": 21, "count": 2, "overCap": false, "state": "aligned", "biopython": { "score": 21, "count": 4, "tailScore": 21, "tailCountSubtracted": 2, "certifiedText": { "extension": 50, "textLength": 179, "reruns": 0, "differencesUpTo": 39 } }, "uniquePairs": [], "uniquePlacement": false, "placementNotDetermined": false, "noCommonColumn": false, "hull": { "refStart": 39, "refEnd": 73, "crossesOrigin": false, "wholeCircle": false }, "selected": { "coordinates": [ [ 38, 51 ], [ 37, 50 ] ], "gappedReference": "TGTGTGGAATTGT", "gappedRead": "TGTGTGAAATTGT", "columns": 13, "identical": 12, "mismatches": 1, "ambiguousColumns": 0, "gapColumns": 0, "gapOpens": 0, "identity": { "numerator": 12, "denominator": 13 }, "readAligned": { "bases": 13, "of": 50 }, "referenceCovered": { "bases": 13, "of": 80 }, "placement": { "refStart": 39, "refEnd": 51, "readStart": 38, "readEnd": 50, "crossesOrigin": false, "asSupplied": { "readStart": 1, "readEnd": 13 } }, "overhang": [], "differences": [ { "kind": "substitution", "ref": 45, "refBase": "G", "readBase": "A", "read": 44, "common": false, "notFixed": { "from": null, "to": null }, "asSupplied": { "read": 7, "readBase": "T" } } ] }, "band": { "diagonalMin": 1, "diagonalMax": 59, "cellsNeeded": 3111, "unionBandLimited": false, "scope": "every optimal path", "gridCells": 9180, "searchedBanded": false, "sharedWords": 0, "sharedWordsOverCap": false, "seedGuarantee": { "differencesUpTo": 39, "guaranteed": false } }, "enumeration": "listed", "alignments": [ [ [ 38, 51 ], [ 37, 50 ] ], [ [ 60, 73 ], [ 1, 14 ] ] ], "tuples": [ [ 12, 0, 13, 1, 0, 0, 13, 13 ] ], "tupleFields": [ "identical", "ambiguousColumns", "columns", "mismatches", "gapColumns", "gapOpens", "readAligned", "referenceCovered" ], "variation": { "readAligned": { "shared": true, "min": 13, "max": 13 }, "referenceCovered": { "shared": true, "min": 13, "max": 13 }, "identity": { "shared": true, "min": { "numerator": 12, "denominator": 13 }, "max": { "numerator": 12, "denominator": 13 } }, "overhangStart": { "shared": true, "min": 0, "max": 0 }, "overhangEnd": { "shared": true, "min": 0, "max": 0 } }, "placements": [ { "refStart": 39, "refEnd": 51, "crossesOrigin": false, "wholeCircle": false, "readStart": 38, "readEnd": 50, "asSupplied": { "readStart": 1, "readEnd": 13 }, "alignments": 1, "band": { "diagonalMin": 1, "diagonalMax": 1, "cellsNeeded": 153, "bandLimited": false } }, { "refStart": 61, "refEnd": 73, "crossesOrigin": false, "wholeCircle": false, "readStart": 2, "readEnd": 14, "asSupplied": { "readStart": 37, "readEnd": 49 }, "alignments": 1, "band": { "diagonalMin": 59, "diagonalMax": 59, "cellsNeeded": 153, "bandLimited": false } } ] } } ] } }, { "id": "origin-insertion", "note": "7a: an insertion of two bases between the reference's last and first base.", "input": { "reference": { "residues": "ACCCCAGGCTTTACACTTTATGCTTCCGGCTCGTATGTTGTGTGGAATTGTGAGCGGATAACAATTTCACACAGGAAACA", "topology": "circular", "source": "J01636.1 1201-1280, circular" }, "read": { "residues": "ACAATTTCACACAGGAAACACCACCCCAGGCTTTACACTTTA", "source": "reference bases 61-80, CC, then 1-20 (a letter matching neither neighbour, so the insertion cannot slide)" }, "modes": [ "semiglobal-read", "local" ] }, "expected": { "results": [ { "mode": "semiglobal-read", "region": null, "strand": "+", "strandUndetermined": false, "plus": { "score": 73, "count": 1, "overCap": false, "state": "aligned", "biopython": { "score": 73, "count": 1, "tailScore": 2, "tailCountSubtracted": 0, "certifiedText": { "extension": 42, "textLength": 163, "reruns": 0, "differencesUpTo": 5 } }, "uniquePairs": [ [ 61, 1 ], [ 62, 2 ], [ 63, 3 ], [ 64, 4 ], [ 65, 5 ], [ 66, 6 ], [ 67, 7 ], [ 68, 8 ], [ 69, 9 ], [ 70, 10 ], [ 71, 11 ], [ 72, 12 ], [ 73, 13 ], [ 74, 14 ], [ 75, 15 ], [ 76, 16 ], [ 77, 17 ], [ 78, 18 ], [ 79, 19 ], [ 80, 20 ], [ 1, 23 ], [ 2, 24 ], [ 3, 25 ], [ 4, 26 ], [ 5, 27 ], [ 6, 28 ], [ 7, 29 ], [ 8, 30 ], [ 9, 31 ], [ 10, 32 ], [ 11, 33 ], [ 12, 34 ], [ 13, 35 ], [ 14, 36 ], [ 15, 37 ], [ 16, 38 ], [ 17, 39 ], [ 18, 40 ], [ 19, 41 ], [ 20, 42 ] ], "uniquePlacement": true, "placementNotDetermined": false, "noCommonColumn": false, "hull": { "refStart": 61, "refEnd": 20, "crossesOrigin": true, "wholeCircle": false }, "selected": { "coordinates": [ [ 0, 60, 80, 80, 100 ], [ 0, 0, 20, 22, 42 ] ], "gappedReference": "ACAATTTCACACAGGAAACA--ACCCCAGGCTTTACACTTTA", "gappedRead": "ACAATTTCACACAGGAAACACCACCCCAGGCTTTACACTTTA", "columns": 42, "identical": 40, "mismatches": 0, "ambiguousColumns": 0, "gapColumns": 2, "gapOpens": 1, "identity": { "numerator": 40, "denominator": 42 }, "readAligned": { "bases": 42, "of": 42 }, "referenceCovered": { "bases": 40, "of": 80 }, "placement": { "refStart": 61, "refEnd": 20, "readStart": 1, "readEnd": 42, "crossesOrigin": true }, "overhang": [], "differences": [ { "kind": "insertion", "refAfter": 80, "length": 2, "bases": "CC", "readStart": 21, "readEnd": 22, "crossesOrigin": true, "common": true } ] }, "band": { "diagonalMin": 58, "diagonalMax": 60, "cellsNeeded": 215, "unionBandLimited": false, "scope": "every optimal path", "gridCells": 7052, "searchedBanded": false, "sharedWords": 18, "sharedWordsOverCap": false, "seedGuarantee": { "differencesUpTo": 5, "guaranteed": false } }, "enumeration": "listed", "alignments": [ [ [ 0, 60, 80, 80, 100 ], [ 0, 0, 20, 22, 42 ] ] ], "tuples": [ [ 40, 0, 42, 0, 2, 1, 42, 40 ] ], "tupleFields": [ "identical", "ambiguousColumns", "columns", "mismatches", "gapColumns", "gapOpens", "readAligned", "referenceCovered" ], "variation": { "readAligned": { "shared": true, "min": 42, "max": 42 }, "referenceCovered": { "shared": true, "min": 40, "max": 40 }, "identity": { "shared": true, "min": { "numerator": 20, "denominator": 21 }, "max": { "numerator": 20, "denominator": 21 } }, "overhangStart": { "shared": true, "min": 0, "max": 0 }, "overhangEnd": { "shared": true, "min": 0, "max": 0 } }, "placements": [ { "refStart": 61, "refEnd": 20, "crossesOrigin": true, "wholeCircle": false, "readStart": 1, "readEnd": 42, "alignments": 1, "band": { "diagonalMin": 58, "diagonalMax": 60, "cellsNeeded": 215, "bandLimited": false } } ] }, "minus": { "score": 6, "count": 12, "overCap": false, "state": "aligned", "biopython": { "score": 6, "count": 24, "tailScore": 6, "tailCountSubtracted": 12, "certifiedText": { "extension": 42, "textLength": 163, "reruns": 0, "differencesUpTo": 39 } }, "uniquePairs": [ [ 12, 1 ], [ 13, 2 ], [ 14, 3 ], [ 15, 4 ], [ 16, 5 ], [ 17, 6 ], [ 22, 12 ], [ 23, 13 ], [ 24, 14 ], [ 25, 15 ], [ 31, 20 ], [ 32, 21 ], [ 33, 22 ], [ 34, 23 ], [ 35, 24 ], [ 36, 25 ], [ 37, 26 ], [ 38, 27 ], [ 39, 30 ], [ 40, 31 ], [ 41, 32 ], [ 42, 33 ], [ 43, 34 ], [ 44, 35 ], [ 45, 36 ], [ 46, 37 ], [ 47, 38 ], [ 48, 39 ], [ 49, 40 ], [ 50, 41 ], [ 51, 42 ] ], "uniquePlacement": true, "placementNotDetermined": false, "noCommonColumn": false, "hull": { "refStart": 12, "refEnd": 51, "crossesOrigin": false, "wholeCircle": false }, "selected": { "coordinates": [ [ 0, 11, 17, 17, 25, 26, 38, 38, 51 ], [ 0, 0, 6, 7, 15, 15, 27, 29, 42 ] ], "gappedReference": "TACACT-TTATGCTTCCGGCTCGTATGT--TGTGTGGAATTGT", "gappedRead": "TAAAGTGTAAAGCCT-GGGGTGGTGTTTCCTGTGTGAAATTGT", "columns": 43, "identical": 28, "mismatches": 11, "ambiguousColumns": 0, "gapColumns": 4, "gapOpens": 3, "identity": { "numerator": 28, "denominator": 43 }, "readAligned": { "bases": 42, "of": 42 }, "referenceCovered": { "bases": 40, "of": 80 }, "placement": { "refStart": 12, "refEnd": 51, "readStart": 1, "readEnd": 42, "crossesOrigin": false, "asSupplied": { "readStart": 1, "readEnd": 42 } }, "overhang": [], "differences": [ { "kind": "substitution", "ref": 14, "refBase": "C", "readBase": "A", "read": 3, "common": true, "asSupplied": { "read": 40, "readBase": "T" } }, { "kind": "substitution", "ref": 16, "refBase": "C", "readBase": "G", "read": 5, "common": true, "asSupplied": { "read": 38, "readBase": "C" } }, { "kind": "insertion", "refAfter": 17, "length": 1, "bases": "G", "readStart": 7, "readEnd": 7, "asSupplied": { "readStart": 36, "readEnd": 36, "bases": "C" }, "common": false, "notFixed": { "from": { "ref": 17, "read": 6, "readAsSupplied": 37 }, "to": { "ref": 22, "read": 12, "readAsSupplied": 31 } } }, { "kind": "substitution", "ref": 19, "refBase": "T", "readBase": "A", "read": 9, "common": false, "notFixed": { "from": { "ref": 17, "read": 6, "readAsSupplied": 37 }, "to": { "ref": 22, "read": 12, "readAsSupplied": 31 } }, "asSupplied": { "read": 34, "readBase": "T" } }, { "kind": "substitution", "ref": 21, "refBase": "T", "readBase": "A", "read": 11, "common": false, "notFixed": { "from": { "ref": 17, "read": 6, "readAsSupplied": 37 }, "to": { "ref": 22, "read": 12, "readAsSupplied": 31 } }, "asSupplied": { "read": 32, "readBase": "T" } }, { "kind": "substitution", "ref": 24, "refBase": "T", "readBase": "C", "read": 14, "common": true, "asSupplied": { "read": 29, "readBase": "G" } }, { "kind": "deletion", "refStart": 26, "refEnd": 26, "length": 1, "bases": "C", "readAfter": 15, "asSupplied": { "readBetween": [ 27, 28 ] }, "common": false, "notFixed": { "from": { "ref": 25, "read": 15, "readAsSupplied": 28 }, "to": { "ref": 31, "read": 20, "readAsSupplied": 23 } } }, { "kind": "substitution", "ref": 27, "refBase": "C", "readBase": "G", "read": 16, "common": false, "notFixed": { "from": { "ref": 25, "read": 15, "readAsSupplied": 28 }, "to": { "ref": 31, "read": 20, "readAsSupplied": 23 } }, "asSupplied": { "read": 27, "readBase": "C" } }, { "kind": "substitution", "ref": 30, "refBase": "C", "readBase": "G", "read": 19, "common": false, "notFixed": { "from": { "ref": 25, "read": 15, "readAsSupplied": 28 }, "to": { "ref": 31, "read": 20, "readAsSupplied": 23 } }, "asSupplied": { "read": 24, "readBase": "C" } }, { "kind": "substitution", "ref": 32, "refBase": "C", "readBase": "G", "read": 21, "common": true, "asSupplied": { "read": 22, "readBase": "C" } }, { "kind": "substitution", "ref": 35, "refBase": "A", "readBase": "G", "read": 24, "common": true, "asSupplied": { "read": 19, "readBase": "C" } }, { "kind": "substitution", "ref": 37, "refBase": "G", "readBase": "T", "read": 26, "common": true, "asSupplied": { "read": 17, "readBase": "A" } }, { "kind": "insertion", "refAfter": 38, "length": 2, "bases": "CC", "readStart": 28, "readEnd": 29, "asSupplied": { "readStart": 14, "readEnd": 15, "bases": "GG" }, "common": true }, { "kind": "substitution", "ref": 45, "refBase": "G", "readBase": "A", "read": 36, "common": true, "asSupplied": { "read": 7, "readBase": "T" } } ] }, "band": { "diagonalMin": 9, "diagonalMax": 11, "cellsNeeded": 215, "unionBandLimited": false, "scope": "every optimal path", "gridCells": 7052, "searchedBanded": false, "sharedWords": 0, "sharedWordsOverCap": false, "seedGuarantee": { "differencesUpTo": 39, "guaranteed": false } }, "enumeration": "listed", "alignments": [ [ [ 0, 11, 17, 17, 25, 26, 38, 38, 51 ], [ 0, 0, 6, 7, 15, 15, 27, 29, 42 ] ], [ [ 0, 11, 19, 19, 25, 26, 38, 38, 51 ], [ 0, 0, 8, 9, 15, 15, 27, 29, 42 ] ], [ [ 0, 11, 20, 20, 25, 26, 38, 38, 51 ], [ 0, 0, 9, 10, 15, 15, 27, 29, 42 ] ], [ [ 0, 11, 21, 21, 25, 26, 38, 38, 51 ], [ 0, 0, 10, 11, 15, 15, 27, 29, 42 ] ], [ [ 0, 11, 17, 17, 26, 27, 38, 38, 51 ], [ 0, 0, 6, 7, 16, 16, 27, 29, 42 ] ], [ [ 0, 11, 19, 19, 26, 27, 38, 38, 51 ], [ 0, 0, 8, 9, 16, 16, 27, 29, 42 ] ], [ [ 0, 11, 20, 20, 26, 27, 38, 38, 51 ], [ 0, 0, 9, 10, 16, 16, 27, 29, 42 ] ], [ [ 0, 11, 21, 21, 26, 27, 38, 38, 51 ], [ 0, 0, 10, 11, 16, 16, 27, 29, 42 ] ], [ [ 0, 11, 17, 17, 29, 30, 38, 38, 51 ], [ 0, 0, 6, 7, 19, 19, 27, 29, 42 ] ], [ [ 0, 11, 19, 19, 29, 30, 38, 38, 51 ], [ 0, 0, 8, 9, 19, 19, 27, 29, 42 ] ], [ [ 0, 11, 20, 20, 29, 30, 38, 38, 51 ], [ 0, 0, 9, 10, 19, 19, 27, 29, 42 ] ], [ [ 0, 11, 21, 21, 29, 30, 38, 38, 51 ], [ 0, 0, 10, 11, 19, 19, 27, 29, 42 ] ] ], "tuples": [ [ 28, 0, 43, 11, 4, 3, 42, 40 ] ], "tupleFields": [ "identical", "ambiguousColumns", "columns", "mismatches", "gapColumns", "gapOpens", "readAligned", "referenceCovered" ], "variation": { "readAligned": { "shared": true, "min": 42, "max": 42 }, "referenceCovered": { "shared": true, "min": 40, "max": 40 }, "identity": { "shared": true, "min": { "numerator": 28, "denominator": 43 }, "max": { "numerator": 28, "denominator": 43 } }, "overhangStart": { "shared": true, "min": 0, "max": 0 }, "overhangEnd": { "shared": true, "min": 0, "max": 0 } }, "placements": [ { "refStart": 12, "refEnd": 51, "crossesOrigin": false, "wholeCircle": false, "readStart": 1, "readEnd": 42, "asSupplied": { "readStart": 1, "readEnd": 42 }, "alignments": 12, "band": { "diagonalMin": 9, "diagonalMax": 11, "cellsNeeded": 215, "bandLimited": false } } ] } }, { "mode": "local", "region": null, "strand": "+", "strandUndetermined": false, "plus": { "score": 73, "count": 1, "overCap": false, "state": "aligned", "biopython": { "score": 73, "count": 1, "tailScore": 40, "tailCountSubtracted": 0, "certifiedText": { "extension": 42, "textLength": 163, "reruns": 0, "differencesUpTo": 5 } }, "uniquePairs": [ [ 61, 1 ], [ 62, 2 ], [ 63, 3 ], [ 64, 4 ], [ 65, 5 ], [ 66, 6 ], [ 67, 7 ], [ 68, 8 ], [ 69, 9 ], [ 70, 10 ], [ 71, 11 ], [ 72, 12 ], [ 73, 13 ], [ 74, 14 ], [ 75, 15 ], [ 76, 16 ], [ 77, 17 ], [ 78, 18 ], [ 79, 19 ], [ 80, 20 ], [ 1, 23 ], [ 2, 24 ], [ 3, 25 ], [ 4, 26 ], [ 5, 27 ], [ 6, 28 ], [ 7, 29 ], [ 8, 30 ], [ 9, 31 ], [ 10, 32 ], [ 11, 33 ], [ 12, 34 ], [ 13, 35 ], [ 14, 36 ], [ 15, 37 ], [ 16, 38 ], [ 17, 39 ], [ 18, 40 ], [ 19, 41 ], [ 20, 42 ] ], "uniquePlacement": true, "placementNotDetermined": false, "noCommonColumn": false, "hull": { "refStart": 61, "refEnd": 20, "crossesOrigin": true, "wholeCircle": false }, "selected": { "coordinates": [ [ 60, 80, 80, 100 ], [ 0, 20, 22, 42 ] ], "gappedReference": "ACAATTTCACACAGGAAACA--ACCCCAGGCTTTACACTTTA", "gappedRead": "ACAATTTCACACAGGAAACACCACCCCAGGCTTTACACTTTA", "columns": 42, "identical": 40, "mismatches": 0, "ambiguousColumns": 0, "gapColumns": 2, "gapOpens": 1, "identity": { "numerator": 40, "denominator": 42 }, "readAligned": { "bases": 42, "of": 42 }, "referenceCovered": { "bases": 40, "of": 80 }, "placement": { "refStart": 61, "refEnd": 20, "readStart": 1, "readEnd": 42, "crossesOrigin": true }, "overhang": [], "differences": [ { "kind": "insertion", "refAfter": 80, "length": 2, "bases": "CC", "readStart": 21, "readEnd": 22, "crossesOrigin": true, "common": true } ] }, "band": { "diagonalMin": 58, "diagonalMax": 60, "cellsNeeded": 215, "unionBandLimited": false, "scope": "every optimal path", "gridCells": 7052, "searchedBanded": false, "sharedWords": 18, "sharedWordsOverCap": false, "seedGuarantee": { "differencesUpTo": 5, "guaranteed": false } }, "enumeration": "listed", "alignments": [ [ [ 60, 80, 80, 100 ], [ 0, 20, 22, 42 ] ] ], "tuples": [ [ 40, 0, 42, 0, 2, 1, 42, 40 ] ], "tupleFields": [ "identical", "ambiguousColumns", "columns", "mismatches", "gapColumns", "gapOpens", "readAligned", "referenceCovered" ], "variation": { "readAligned": { "shared": true, "min": 42, "max": 42 }, "referenceCovered": { "shared": true, "min": 40, "max": 40 }, "identity": { "shared": true, "min": { "numerator": 20, "denominator": 21 }, "max": { "numerator": 20, "denominator": 21 } }, "overhangStart": { "shared": true, "min": 0, "max": 0 }, "overhangEnd": { "shared": true, "min": 0, "max": 0 } }, "placements": [ { "refStart": 61, "refEnd": 20, "crossesOrigin": true, "wholeCircle": false, "readStart": 1, "readEnd": 42, "alignments": 1, "band": { "diagonalMin": 58, "diagonalMax": 60, "cellsNeeded": 215, "bandLimited": false } } ] }, "minus": { "score": 21, "count": 1, "overCap": false, "state": "aligned", "biopython": { "score": 21, "count": 2, "tailScore": 21, "tailCountSubtracted": 1, "certifiedText": { "extension": 42, "textLength": 163, "reruns": 0, "differencesUpTo": 31 } }, "uniquePairs": [ [ 39, 30 ], [ 40, 31 ], [ 41, 32 ], [ 42, 33 ], [ 43, 34 ], [ 44, 35 ], [ 45, 36 ], [ 46, 37 ], [ 47, 38 ], [ 48, 39 ], [ 49, 40 ], [ 50, 41 ], [ 51, 42 ] ], "uniquePlacement": true, "placementNotDetermined": false, "noCommonColumn": false, "hull": { "refStart": 39, "refEnd": 51, "crossesOrigin": false, "wholeCircle": false }, "selected": { "coordinates": [ [ 38, 51 ], [ 29, 42 ] ], "gappedReference": "TGTGTGGAATTGT", "gappedRead": "TGTGTGAAATTGT", "columns": 13, "identical": 12, "mismatches": 1, "ambiguousColumns": 0, "gapColumns": 0, "gapOpens": 0, "identity": { "numerator": 12, "denominator": 13 }, "readAligned": { "bases": 13, "of": 42 }, "referenceCovered": { "bases": 13, "of": 80 }, "placement": { "refStart": 39, "refEnd": 51, "readStart": 30, "readEnd": 42, "crossesOrigin": false, "asSupplied": { "readStart": 1, "readEnd": 13 } }, "overhang": [], "differences": [ { "kind": "substitution", "ref": 45, "refBase": "G", "readBase": "A", "read": 36, "common": true, "asSupplied": { "read": 7, "readBase": "T" } } ] }, "band": { "diagonalMin": 9, "diagonalMax": 9, "cellsNeeded": 129, "unionBandLimited": false, "scope": "every optimal path", "gridCells": 7052, "searchedBanded": false, "sharedWords": 0, "sharedWordsOverCap": false, "seedGuarantee": { "differencesUpTo": 31, "guaranteed": false } }, "enumeration": "listed", "alignments": [ [ [ 38, 51 ], [ 29, 42 ] ] ], "tuples": [ [ 12, 0, 13, 1, 0, 0, 13, 13 ] ], "tupleFields": [ "identical", "ambiguousColumns", "columns", "mismatches", "gapColumns", "gapOpens", "readAligned", "referenceCovered" ], "variation": { "readAligned": { "shared": true, "min": 13, "max": 13 }, "referenceCovered": { "shared": true, "min": 13, "max": 13 }, "identity": { "shared": true, "min": { "numerator": 12, "denominator": 13 }, "max": { "numerator": 12, "denominator": 13 } }, "overhangStart": { "shared": true, "min": 0, "max": 0 }, "overhangEnd": { "shared": true, "min": 0, "max": 0 } }, "placements": [ { "refStart": 39, "refEnd": 51, "crossesOrigin": false, "wholeCircle": false, "readStart": 30, "readEnd": 42, "asSupplied": { "readStart": 1, "readEnd": 13 }, "alignments": 1, "band": { "diagonalMin": 9, "diagonalMax": 9, "cellsNeeded": 129, "bandLimited": false } } ] } } ] } }, { "id": "circular-inside", "note": "7b: a read wholly inside a circular reference (J01636.1 1301-1380), on the winning strand; its twin one turn on in the certified text is dropped.", "input": { "reference": { "residues": "TTCACTGGCCGTCGTTTTACAACGTCGTGACTGGGAAAACCCTGGCGTTACCCAACTTAATCGCCTTGCAGCACATCCCC", "topology": "circular", "source": "J01636.1 1301-1380, circular" }, "read": { "residues": "AACGTCGTGACTGGGAAAACCCTGGCGTTA", "source": "reference bases 21-50" }, "modes": [ "semiglobal-read", "local" ] }, "expected": { "results": [ { "mode": "semiglobal-read", "region": null, "strand": "+", "strandUndetermined": false, "plus": { "score": 60, "count": 1, "overCap": false, "state": "aligned", "biopython": { "score": 60, "count": 2, "tailScore": 60, "tailCountSubtracted": 1, "certifiedText": { "extension": 30, "textLength": 139, "reruns": 0, "differencesUpTo": 0 } }, "uniquePairs": [ [ 21, 1 ], [ 22, 2 ], [ 23, 3 ], [ 24, 4 ], [ 25, 5 ], [ 26, 6 ], [ 27, 7 ], [ 28, 8 ], [ 29, 9 ], [ 30, 10 ], [ 31, 11 ], [ 32, 12 ], [ 33, 13 ], [ 34, 14 ], [ 35, 15 ], [ 36, 16 ], [ 37, 17 ], [ 38, 18 ], [ 39, 19 ], [ 40, 20 ], [ 41, 21 ], [ 42, 22 ], [ 43, 23 ], [ 44, 24 ], [ 45, 25 ], [ 46, 26 ], [ 47, 27 ], [ 48, 28 ], [ 49, 29 ], [ 50, 30 ] ], "uniquePlacement": true, "placementNotDetermined": false, "noCommonColumn": false, "hull": { "refStart": 21, "refEnd": 50, "crossesOrigin": false, "wholeCircle": false }, "selected": { "coordinates": [ [ 0, 20, 50 ], [ 0, 0, 30 ] ], "gappedReference": "AACGTCGTGACTGGGAAAACCCTGGCGTTA", "gappedRead": "AACGTCGTGACTGGGAAAACCCTGGCGTTA", "columns": 30, "identical": 30, "mismatches": 0, "ambiguousColumns": 0, "gapColumns": 0, "gapOpens": 0, "identity": { "numerator": 30, "denominator": 30 }, "readAligned": { "bases": 30, "of": 30 }, "referenceCovered": { "bases": 30, "of": 80 }, "placement": { "refStart": 21, "refEnd": 50, "readStart": 1, "readEnd": 30, "crossesOrigin": false }, "overhang": [], "differences": [] }, "band": { "diagonalMin": 20, "diagonalMax": 20, "cellsNeeded": 93, "unionBandLimited": false, "scope": "every optimal path", "gridCells": 4340, "searchedBanded": false, "sharedWords": 19, "sharedWordsOverCap": false, "seedGuarantee": { "differencesUpTo": 0, "guaranteed": true } }, "enumeration": "listed", "alignments": [ [ [ 0, 20, 50 ], [ 0, 0, 30 ] ] ], "tuples": [ [ 30, 0, 30, 0, 0, 0, 30, 30 ] ], "tupleFields": [ "identical", "ambiguousColumns", "columns", "mismatches", "gapColumns", "gapOpens", "readAligned", "referenceCovered" ], "variation": { "readAligned": { "shared": true, "min": 30, "max": 30 }, "referenceCovered": { "shared": true, "min": 30, "max": 30 }, "identity": { "shared": true, "min": { "numerator": 1, "denominator": 1 }, "max": { "numerator": 1, "denominator": 1 } }, "overhangStart": { "shared": true, "min": 0, "max": 0 }, "overhangEnd": { "shared": true, "min": 0, "max": 0 } }, "placements": [ { "refStart": 21, "refEnd": 50, "crossesOrigin": false, "wholeCircle": false, "readStart": 1, "readEnd": 30, "alignments": 1, "band": { "diagonalMin": 20, "diagonalMax": 20, "cellsNeeded": 93, "bandLimited": false } } ] }, "minus": { "score": -3, "count": 1, "overCap": false, "state": "aligned", "biopython": { "score": -3, "count": 2, "tailScore": -3, "tailCountSubtracted": 1, "certifiedText": { "extension": 31, "textLength": 140, "reruns": 1, "differencesUpTo": 31 } }, "uniquePairs": [ [ 2, 1 ], [ 3, 2 ], [ 4, 3 ], [ 5, 4 ], [ 8, 5 ], [ 9, 6 ], [ 10, 7 ], [ 11, 8 ], [ 12, 9 ], [ 13, 10 ], [ 14, 11 ], [ 15, 12 ], [ 16, 13 ], [ 17, 14 ], [ 18, 15 ], [ 19, 16 ], [ 20, 17 ], [ 21, 18 ], [ 22, 19 ], [ 24, 20 ], [ 25, 21 ], [ 26, 22 ], [ 27, 23 ], [ 28, 24 ], [ 29, 25 ], [ 30, 26 ], [ 31, 27 ], [ 32, 30 ] ], "uniquePlacement": true, "placementNotDetermined": false, "noCommonColumn": false, "hull": { "refStart": 2, "refEnd": 32, "crossesOrigin": false, "wholeCircle": false }, "selected": { "coordinates": [ [ 0, 1, 5, 7, 22, 23, 31, 31, 32 ], [ 0, 0, 4, 4, 19, 19, 27, 29, 30 ] ], "gappedReference": "TCACTGGCCGTCGTTTTACAACGTCGTGAC--T", "gappedRead": "TAAC--GCCAGGGTTTTCCCA-GTCACGACGTT", "columns": 33, "identical": 20, "mismatches": 8, "ambiguousColumns": 0, "gapColumns": 5, "gapOpens": 3, "identity": { "numerator": 20, "denominator": 33 }, "readAligned": { "bases": 30, "of": 30 }, "referenceCovered": { "bases": 31, "of": 80 }, "placement": { "refStart": 2, "refEnd": 32, "readStart": 1, "readEnd": 30, "crossesOrigin": false, "asSupplied": { "readStart": 1, "readEnd": 30 } }, "overhang": [], "differences": [ { "kind": "substitution", "ref": 3, "refBase": "C", "readBase": "A", "read": 2, "common": true, "asSupplied": { "read": 29, "readBase": "T" } }, { "kind": "deletion", "refStart": 6, "refEnd": 7, "length": 2, "bases": "TG", "readAfter": 4, "asSupplied": { "readBetween": [ 26, 27 ] }, "common": true }, { "kind": "substitution", "ref": 11, "refBase": "G", "readBase": "A", "read": 8, "common": true, "asSupplied": { "read": 23, "readBase": "T" } }, { "kind": "substitution", "ref": 12, "refBase": "T", "readBase": "G", "read": 9, "common": true, "asSupplied": { "read": 22, "readBase": "C" } }, { "kind": "substitution", "ref": 13, "refBase": "C", "readBase": "G", "read": 10, "common": true, "asSupplied": { "read": 21, "readBase": "C" } }, { "kind": "substitution", "ref": 19, "refBase": "A", "readBase": "C", "read": 16, "common": true, "asSupplied": { "read": 15, "readBase": "G" } }, { "kind": "substitution", "ref": 21, "refBase": "A", "readBase": "C", "read": 18, "common": true, "asSupplied": { "read": 13, "readBase": "G" } }, { "kind": "deletion", "refStart": 23, "refEnd": 23, "length": 1, "bases": "C", "readAfter": 19, "asSupplied": { "readBetween": [ 11, 12 ] }, "common": true }, { "kind": "substitution", "ref": 27, "refBase": "G", "readBase": "A", "read": 23, "common": true, "asSupplied": { "read": 8, "readBase": "T" } }, { "kind": "substitution", "ref": 28, "refBase": "T", "readBase": "C", "read": 24, "common": true, "asSupplied": { "read": 7, "readBase": "G" } }, { "kind": "insertion", "refAfter": 31, "length": 2, "bases": "GT", "readStart": 28, "readEnd": 29, "asSupplied": { "readStart": 2, "readEnd": 3, "bases": "AC" }, "common": true } ] }, "band": { "diagonalMin": 1, "diagonalMax": 4, "cellsNeeded": 186, "unionBandLimited": false, "scope": "every optimal path", "gridCells": 4371, "searchedBanded": false, "sharedWords": 0, "sharedWordsOverCap": false, "seedGuarantee": { "differencesUpTo": 31, "guaranteed": false } }, "enumeration": "listed", "alignments": [ [ [ 0, 1, 5, 7, 22, 23, 31, 31, 32 ], [ 0, 0, 4, 4, 19, 19, 27, 29, 30 ] ] ], "tuples": [ [ 20, 0, 33, 8, 5, 3, 30, 31 ] ], "tupleFields": [ "identical", "ambiguousColumns", "columns", "mismatches", "gapColumns", "gapOpens", "readAligned", "referenceCovered" ], "variation": { "readAligned": { "shared": true, "min": 30, "max": 30 }, "referenceCovered": { "shared": true, "min": 31, "max": 31 }, "identity": { "shared": true, "min": { "numerator": 20, "denominator": 33 }, "max": { "numerator": 20, "denominator": 33 } }, "overhangStart": { "shared": true, "min": 0, "max": 0 }, "overhangEnd": { "shared": true, "min": 0, "max": 0 } }, "placements": [ { "refStart": 2, "refEnd": 32, "crossesOrigin": false, "wholeCircle": false, "readStart": 1, "readEnd": 30, "asSupplied": { "readStart": 1, "readEnd": 30 }, "alignments": 1, "band": { "diagonalMin": 1, "diagonalMax": 4, "cellsNeeded": 186, "bandLimited": false } } ] } }, { "mode": "local", "region": null, "strand": "+", "strandUndetermined": false, "plus": { "score": 60, "count": 1, "overCap": false, "state": "aligned", "biopython": { "score": 60, "count": 2, "tailScore": 60, "tailCountSubtracted": 1, "certifiedText": { "extension": 30, "textLength": 139, "reruns": 0, "differencesUpTo": 0 } }, "uniquePairs": [ [ 21, 1 ], [ 22, 2 ], [ 23, 3 ], [ 24, 4 ], [ 25, 5 ], [ 26, 6 ], [ 27, 7 ], [ 28, 8 ], [ 29, 9 ], [ 30, 10 ], [ 31, 11 ], [ 32, 12 ], [ 33, 13 ], [ 34, 14 ], [ 35, 15 ], [ 36, 16 ], [ 37, 17 ], [ 38, 18 ], [ 39, 19 ], [ 40, 20 ], [ 41, 21 ], [ 42, 22 ], [ 43, 23 ], [ 44, 24 ], [ 45, 25 ], [ 46, 26 ], [ 47, 27 ], [ 48, 28 ], [ 49, 29 ], [ 50, 30 ] ], "uniquePlacement": true, "placementNotDetermined": false, "noCommonColumn": false, "hull": { "refStart": 21, "refEnd": 50, "crossesOrigin": false, "wholeCircle": false }, "selected": { "coordinates": [ [ 20, 50 ], [ 0, 30 ] ], "gappedReference": "AACGTCGTGACTGGGAAAACCCTGGCGTTA", "gappedRead": "AACGTCGTGACTGGGAAAACCCTGGCGTTA", "columns": 30, "identical": 30, "mismatches": 0, "ambiguousColumns": 0, "gapColumns": 0, "gapOpens": 0, "identity": { "numerator": 30, "denominator": 30 }, "readAligned": { "bases": 30, "of": 30 }, "referenceCovered": { "bases": 30, "of": 80 }, "placement": { "refStart": 21, "refEnd": 50, "readStart": 1, "readEnd": 30, "crossesOrigin": false }, "overhang": [], "differences": [] }, "band": { "diagonalMin": 20, "diagonalMax": 20, "cellsNeeded": 93, "unionBandLimited": false, "scope": "every optimal path", "gridCells": 4340, "searchedBanded": false, "sharedWords": 19, "sharedWordsOverCap": false, "seedGuarantee": { "differencesUpTo": 0, "guaranteed": true } }, "enumeration": "listed", "alignments": [ [ [ 20, 50 ], [ 0, 30 ] ] ], "tuples": [ [ 30, 0, 30, 0, 0, 0, 30, 30 ] ], "tupleFields": [ "identical", "ambiguousColumns", "columns", "mismatches", "gapColumns", "gapOpens", "readAligned", "referenceCovered" ], "variation": { "readAligned": { "shared": true, "min": 30, "max": 30 }, "referenceCovered": { "shared": true, "min": 30, "max": 30 }, "identity": { "shared": true, "min": { "numerator": 1, "denominator": 1 }, "max": { "numerator": 1, "denominator": 1 } }, "overhangStart": { "shared": true, "min": 0, "max": 0 }, "overhangEnd": { "shared": true, "min": 0, "max": 0 } }, "placements": [ { "refStart": 21, "refEnd": 50, "crossesOrigin": false, "wholeCircle": false, "readStart": 1, "readEnd": 30, "alignments": 1, "band": { "diagonalMin": 20, "diagonalMax": 20, "cellsNeeded": 93, "bandLimited": false } } ] }, "minus": { "score": 10, "count": 2, "overCap": false, "state": "aligned", "biopython": { "score": 10, "count": 3, "tailScore": 10, "tailCountSubtracted": 1, "certifiedText": { "extension": 30, "textLength": 139, "reruns": 0, "differencesUpTo": 25 } }, "uniquePairs": [], "uniquePlacement": false, "placementNotDetermined": false, "noCommonColumn": false, "hull": { "refStart": 76, "refEnd": 18, "crossesOrigin": true, "wholeCircle": false }, "selected": { "coordinates": [ [ 13, 18 ], [ 10, 15 ] ], "gappedReference": "GTTTT", "gappedRead": "GTTTT", "columns": 5, "identical": 5, "mismatches": 0, "ambiguousColumns": 0, "gapColumns": 0, "gapOpens": 0, "identity": { "numerator": 5, "denominator": 5 }, "readAligned": { "bases": 5, "of": 30 }, "referenceCovered": { "bases": 5, "of": 80 }, "placement": { "refStart": 14, "refEnd": 18, "readStart": 11, "readEnd": 15, "crossesOrigin": false, "asSupplied": { "readStart": 16, "readEnd": 20 } }, "overhang": [], "differences": [] }, "band": { "diagonalMin": 3, "diagonalMax": 61, "cellsNeeded": 1891, "unionBandLimited": false, "scope": "every optimal path", "gridCells": 4340, "searchedBanded": false, "sharedWords": 0, "sharedWordsOverCap": false, "seedGuarantee": { "differencesUpTo": 25, "guaranteed": false } }, "enumeration": "listed", "alignments": [ [ [ 13, 18 ], [ 10, 15 ] ], [ [ 75, 85 ], [ 14, 24 ] ] ], "tuples": [ [ 5, 0, 5, 0, 0, 0, 5, 5 ], [ 8, 0, 10, 2, 0, 0, 10, 10 ] ], "tupleFields": [ "identical", "ambiguousColumns", "columns", "mismatches", "gapColumns", "gapOpens", "readAligned", "referenceCovered" ], "variation": { "readAligned": { "shared": false, "min": 5, "max": 10 }, "referenceCovered": { "shared": false, "min": 5, "max": 10 }, "identity": { "shared": false, "min": { "numerator": 4, "denominator": 5 }, "max": { "numerator": 1, "denominator": 1 } }, "overhangStart": { "shared": true, "min": 0, "max": 0 }, "overhangEnd": { "shared": true, "min": 0, "max": 0 } }, "placements": [ { "refStart": 14, "refEnd": 18, "crossesOrigin": false, "wholeCircle": false, "readStart": 11, "readEnd": 15, "asSupplied": { "readStart": 16, "readEnd": 20 }, "alignments": 1, "band": { "diagonalMin": 3, "diagonalMax": 3, "cellsNeeded": 93, "bandLimited": false } }, { "refStart": 76, "refEnd": 5, "crossesOrigin": true, "wholeCircle": false, "readStart": 15, "readEnd": 24, "asSupplied": { "readStart": 7, "readEnd": 16 }, "alignments": 1, "band": { "diagonalMin": 61, "diagonalMax": 61, "cellsNeeded": 93, "bandLimited": false } } ] } } ] } }, { "id": "overhang-end", "note": "7c: a read running five bases past the end of a linear reference: overhang, not an insertion, and outside identity and both coverages.", "input": { "reference": { "residues": "AGCGAAGAGGCCCGCACCGATCGCCCTTCCCAACAGTTGCGCAGCCTGAATGGCGAATGG", "topology": "linear", "source": "J01636.1 1401-1460" }, "read": { "residues": "GCAGCCTGAATGGCGAATGGCGCTT", "source": "J01636.1 1441-1465" }, "modes": [ "semiglobal-read" ] }, "expected": { "results": [ { "mode": "semiglobal-read", "region": null, "strand": "+", "strandUndetermined": false, "plus": { "score": 27, "count": 1, "overCap": false, "state": "aligned", "biopython": { "score": 27, "count": 1 }, "uniquePairs": [ [ 41, 1 ], [ 42, 2 ], [ 43, 3 ], [ 44, 4 ], [ 45, 5 ], [ 46, 6 ], [ 47, 7 ], [ 48, 8 ], [ 49, 9 ], [ 50, 10 ], [ 51, 11 ], [ 52, 12 ], [ 53, 13 ], [ 54, 14 ], [ 55, 15 ], [ 56, 16 ], [ 57, 17 ], [ 58, 18 ], [ 59, 19 ], [ 60, 20 ] ], "uniquePlacement": true, "placementNotDetermined": false, "noCommonColumn": false, "hull": { "refStart": 41, "refEnd": 60, "crossesOrigin": false, "wholeCircle": false }, "selected": { "coordinates": [ [ 0, 40, 60, 60 ], [ 0, 0, 20, 25 ] ], "gappedReference": "GCAGCCTGAATGGCGAATGG", "gappedRead": "GCAGCCTGAATGGCGAATGG", "columns": 20, "identical": 20, "mismatches": 0, "ambiguousColumns": 0, "gapColumns": 0, "gapOpens": 0, "identity": { "numerator": 20, "denominator": 20 }, "readAligned": { "bases": 20, "of": 25 }, "referenceCovered": { "bases": 20, "of": 60 }, "placement": { "refStart": 41, "refEnd": 60, "readStart": 1, "readEnd": 20, "crossesOrigin": false }, "overhang": [ { "side": "end", "at": "reference-end", "length": 5, "bases": "CGCTT", "readStart": 21, "readEnd": 25 } ], "differences": [] }, "band": { "diagonalMin": 35, "diagonalMax": 40, "cellsNeeded": 187, "unionBandLimited": false, "scope": "every optimal path", "gridCells": 1586, "searchedBanded": false, "sharedWords": 9, "sharedWordsOverCap": false, "seedGuarantee": { "differencesUpTo": 11, "guaranteed": false } }, "enumeration": "listed", "alignments": [ [ [ 0, 40, 60, 60 ], [ 0, 0, 20, 25 ] ] ], "tuples": [ [ 20, 0, 20, 0, 0, 0, 20, 20 ] ], "tupleFields": [ "identical", "ambiguousColumns", "columns", "mismatches", "gapColumns", "gapOpens", "readAligned", "referenceCovered" ], "variation": { "readAligned": { "shared": true, "min": 20, "max": 20 }, "referenceCovered": { "shared": true, "min": 20, "max": 20 }, "identity": { "shared": true, "min": { "numerator": 1, "denominator": 1 }, "max": { "numerator": 1, "denominator": 1 } }, "overhangStart": { "shared": true, "min": 0, "max": 0 }, "overhangEnd": { "shared": true, "min": 5, "max": 5 } }, "placements": [ { "refStart": 41, "refEnd": 60, "crossesOrigin": false, "wholeCircle": false, "readStart": 1, "readEnd": 20, "alignments": 1, "band": { "diagonalMin": 35, "diagonalMax": 40, "cellsNeeded": 187, "bandLimited": false } } ] }, "minus": { "score": 4, "count": 6, "overCap": false, "state": "aligned", "biopython": { "score": 4, "count": 6 }, "uniquePairs": [ [ 19, 1 ], [ 20, 2 ], [ 21, 3 ], [ 22, 4 ], [ 23, 5 ], [ 24, 6 ], [ 25, 7 ], [ 26, 8 ], [ 27, 9 ], [ 28, 10 ], [ 29, 11 ], [ 30, 13 ], [ 31, 14 ], [ 32, 15 ], [ 34, 18 ], [ 35, 19 ], [ 38, 23 ], [ 39, 24 ], [ 40, 25 ] ], "uniquePlacement": true, "placementNotDetermined": false, "noCommonColumn": false, "hull": { "refStart": 19, "refEnd": 40, "crossesOrigin": false, "wholeCircle": false }, "selected": { "coordinates": [ [ 0, 18, 29, 29, 32, 32, 35, 35, 40, 60 ], [ 0, 0, 11, 12, 15, 16, 19, 20, 25, 25 ] ], "gappedReference": "GATCGCCCTTC-CCA-ACA-GTTGC", "gappedRead": "AAGCGCCATTCGCCATTCAGGCTGC", "columns": 25, "identical": 17, "mismatches": 5, "ambiguousColumns": 0, "gapColumns": 3, "gapOpens": 3, "identity": { "numerator": 17, "denominator": 25 }, "readAligned": { "bases": 25, "of": 25 }, "referenceCovered": { "bases": 22, "of": 60 }, "placement": { "refStart": 19, "refEnd": 40, "readStart": 1, "readEnd": 25, "crossesOrigin": false, "asSupplied": { "readStart": 1, "readEnd": 25 } }, "overhang": [], "differences": [ { "kind": "substitution", "ref": 19, "refBase": "G", "readBase": "A", "read": 1, "common": true, "asSupplied": { "read": 25, "readBase": "T" } }, { "kind": "substitution", "ref": 21, "refBase": "T", "readBase": "G", "read": 3, "common": true, "asSupplied": { "read": 23, "readBase": "C" } }, { "kind": "substitution", "ref": 26, "refBase": "C", "readBase": "A", "read": 8, "common": true, "asSupplied": { "read": 18, "readBase": "T" } }, { "kind": "insertion", "refAfter": 29, "length": 1, "bases": "G", "readStart": 12, "readEnd": 12, "asSupplied": { "readStart": 14, "readEnd": 14, "bases": "C" }, "common": true }, { "kind": "insertion", "refAfter": 32, "length": 1, "bases": "T", "readStart": 16, "readEnd": 16, "asSupplied": { "readStart": 10, "readEnd": 10, "bases": "A" }, "common": false, "notFixed": { "from": { "ref": 32, "read": 15, "readAsSupplied": 11 }, "to": { "ref": 34, "read": 18, "readAsSupplied": 8 } } }, { "kind": "substitution", "ref": 33, "refBase": "A", "readBase": "T", "read": 17, "common": false, "notFixed": { "from": { "ref": 32, "read": 15, "readAsSupplied": 11 }, "to": { "ref": 34, "read": 18, "readAsSupplied": 8 } }, "asSupplied": { "read": 9, "readBase": "A" } }, { "kind": "insertion", "refAfter": 35, "length": 1, "bases": "G", "readStart": 20, "readEnd": 20, "asSupplied": { "readStart": 6, "readEnd": 6, "bases": "C" }, "common": false, "notFixed": { "from": { "ref": 35, "read": 19, "readAsSupplied": 7 }, "to": { "ref": 38, "read": 23, "readAsSupplied": 3 } } }, { "kind": "substitution", "ref": 37, "refBase": "T", "readBase": "C", "read": 22, "common": false, "notFixed": { "from": { "ref": 35, "read": 19, "readAsSupplied": 7 }, "to": { "ref": 38, "read": 23, "readAsSupplied": 3 } }, "asSupplied": { "read": 4, "readBase": "G" } } ] }, "band": { "diagonalMin": 15, "diagonalMax": 18, "cellsNeeded": 156, "unionBandLimited": false, "scope": "every optimal path", "gridCells": 1586, "searchedBanded": false, "sharedWords": 0, "sharedWordsOverCap": false, "seedGuarantee": { "differencesUpTo": 23, "guaranteed": false } }, "enumeration": "listed", "alignments": [ [ [ 0, 18, 29, 29, 32, 32, 35, 35, 40, 60 ], [ 0, 0, 11, 12, 15, 16, 19, 20, 25, 25 ] ], [ [ 0, 18, 29, 29, 33, 33, 35, 35, 40, 60 ], [ 0, 0, 11, 12, 16, 17, 19, 20, 25, 25 ] ], [ [ 0, 18, 29, 29, 32, 32, 36, 36, 40, 60 ], [ 0, 0, 11, 12, 15, 16, 20, 21, 25, 25 ] ], [ [ 0, 18, 29, 29, 33, 33, 36, 36, 40, 60 ], [ 0, 0, 11, 12, 16, 17, 20, 21, 25, 25 ] ], [ [ 0, 18, 29, 29, 32, 32, 37, 37, 40, 60 ], [ 0, 0, 11, 12, 15, 16, 21, 22, 25, 25 ] ], [ [ 0, 18, 29, 29, 33, 33, 37, 37, 40, 60 ], [ 0, 0, 11, 12, 16, 17, 21, 22, 25, 25 ] ] ], "tuples": [ [ 17, 0, 25, 5, 3, 3, 25, 22 ] ], "tupleFields": [ "identical", "ambiguousColumns", "columns", "mismatches", "gapColumns", "gapOpens", "readAligned", "referenceCovered" ], "variation": { "readAligned": { "shared": true, "min": 25, "max": 25 }, "referenceCovered": { "shared": true, "min": 22, "max": 22 }, "identity": { "shared": true, "min": { "numerator": 17, "denominator": 25 }, "max": { "numerator": 17, "denominator": 25 } }, "overhangStart": { "shared": true, "min": 0, "max": 0 }, "overhangEnd": { "shared": true, "min": 0, "max": 0 } }, "placements": [ { "refStart": 19, "refEnd": 40, "crossesOrigin": false, "wholeCircle": false, "readStart": 1, "readEnd": 25, "asSupplied": { "readStart": 1, "readEnd": 25 }, "alignments": 6, "band": { "diagonalMin": 15, "diagonalMax": 18, "cellsNeeded": 156, "bandLimited": false } } ] } } ] } }, { "id": "overhang-start", "note": "7c: a read running five bases past the start of a linear reference.", "input": { "reference": { "residues": "AGAGGCCCGCACCGATCGCCCTTCCCAACAGTTGCGCAGCCTGAATGGCGAATGGCGCTT", "topology": "linear", "source": "J01636.1 1406-1465" }, "read": { "residues": "AGCGAAGAGGCCCGCACCGATCGCC", "source": "J01636.1 1401-1425" }, "modes": [ "semiglobal-read" ] }, "expected": { "results": [ { "mode": "semiglobal-read", "region": null, "strand": "+", "strandUndetermined": false, "plus": { "score": 27, "count": 3, "overCap": false, "state": "aligned", "biopython": { "score": 27, "count": 3 }, "uniquePairs": [ [ 3, 8 ], [ 4, 9 ], [ 5, 10 ], [ 6, 11 ], [ 7, 12 ], [ 8, 13 ], [ 9, 14 ], [ 10, 15 ], [ 11, 16 ], [ 12, 17 ], [ 13, 18 ], [ 14, 19 ], [ 15, 20 ], [ 16, 21 ], [ 17, 22 ], [ 18, 23 ], [ 19, 24 ], [ 20, 25 ] ], "uniquePlacement": true, "placementNotDetermined": false, "noCommonColumn": false, "hull": { "refStart": 1, "refEnd": 20, "crossesOrigin": false, "wholeCircle": false }, "selected": { "coordinates": [ [ 0, 0, 20, 60 ], [ 0, 5, 25, 25 ] ], "gappedReference": "AGAGGCCCGCACCGATCGCC", "gappedRead": "AGAGGCCCGCACCGATCGCC", "columns": 20, "identical": 20, "mismatches": 0, "ambiguousColumns": 0, "gapColumns": 0, "gapOpens": 0, "identity": { "numerator": 20, "denominator": 20 }, "readAligned": { "bases": 20, "of": 25 }, "referenceCovered": { "bases": 20, "of": 60 }, "placement": { "refStart": 1, "refEnd": 20, "readStart": 6, "readEnd": 25, "crossesOrigin": false }, "overhang": [ { "side": "start", "at": "reference-end", "length": 5, "bases": "AGCGA", "readStart": 1, "readEnd": 5 } ], "differences": [] }, "band": { "diagonalMin": -5, "diagonalMax": 0, "cellsNeeded": 187, "unionBandLimited": false, "scope": "every optimal path", "gridCells": 1586, "searchedBanded": false, "sharedWords": 9, "sharedWordsOverCap": false, "seedGuarantee": { "differencesUpTo": 11, "guaranteed": false } }, "enumeration": "listed", "alignments": [ [ [ 0, 0, 20, 60 ], [ 0, 5, 25, 25 ] ], [ [ 0, 1, 1, 20, 60 ], [ 0, 1, 6, 25, 25 ] ], [ [ 0, 2, 2, 20, 60 ], [ 0, 2, 7, 25, 25 ] ] ], "tuples": [ [ 20, 0, 20, 0, 0, 0, 20, 20 ], [ 20, 0, 25, 0, 5, 1, 25, 20 ] ], "tupleFields": [ "identical", "ambiguousColumns", "columns", "mismatches", "gapColumns", "gapOpens", "readAligned", "referenceCovered" ], "variation": { "readAligned": { "shared": false, "min": 20, "max": 25 }, "referenceCovered": { "shared": true, "min": 20, "max": 20 }, "identity": { "shared": false, "min": { "numerator": 4, "denominator": 5 }, "max": { "numerator": 1, "denominator": 1 } }, "overhangStart": { "shared": false, "min": 0, "max": 5 }, "overhangEnd": { "shared": true, "min": 0, "max": 0 } }, "placements": [ { "refStart": 1, "refEnd": 20, "crossesOrigin": false, "wholeCircle": false, "readStart": 1, "readEnd": 25, "alignments": 3, "band": { "diagonalMin": -5, "diagonalMax": 0, "cellsNeeded": 187, "bandLimited": false } } ] }, "minus": { "score": -7, "count": 6, "overCap": false, "state": "aligned", "biopython": { "score": -7, "count": 6 }, "uniquePairs": [ [ 11, 5 ], [ 12, 6 ], [ 13, 7 ], [ 14, 8 ], [ 15, 9 ], [ 16, 10 ], [ 17, 12 ], [ 19, 16 ], [ 20, 17 ], [ 21, 19 ], [ 22, 20 ], [ 23, 21 ], [ 24, 22 ], [ 25, 23 ], [ 26, 24 ], [ 27, 25 ] ], "uniquePlacement": true, "placementNotDetermined": false, "noCommonColumn": false, "hull": { "refStart": 4, "refEnd": 27, "crossesOrigin": false, "wholeCircle": false }, "selected": { "coordinates": [ [ 0, 3, 5, 7, 9, 10, 16, 16, 17, 17, 20, 20, 27, 60 ], [ 0, 0, 2, 2, 4, 4, 10, 11, 12, 14, 17, 18, 25, 25 ] ], "gappedReference": "GGCCCGCACCGAT-C--GCC-CTTCCCA", "gappedRead": "GG--CG-ATCGGTGCGGGCCTCTTCGCT", "columns": 28, "identical": 17, "mismatches": 4, "ambiguousColumns": 0, "gapColumns": 7, "gapOpens": 5, "identity": { "numerator": 17, "denominator": 28 }, "readAligned": { "bases": 25, "of": 25 }, "referenceCovered": { "bases": 24, "of": 60 }, "placement": { "refStart": 4, "refEnd": 27, "readStart": 1, "readEnd": 25, "crossesOrigin": false, "asSupplied": { "readStart": 1, "readEnd": 25 } }, "overhang": [], "differences": [ { "kind": "deletion", "refStart": 6, "refEnd": 7, "length": 2, "bases": "CC", "readAfter": 2, "asSupplied": { "readBetween": [ 23, 24 ] }, "common": false, "notFixed": { "from": null, "to": { "ref": 11, "read": 5, "readAsSupplied": 21 } } }, { "kind": "deletion", "refStart": 10, "refEnd": 10, "length": 1, "bases": "C", "readAfter": 4, "asSupplied": { "readBetween": [ 21, 22 ] }, "common": false, "notFixed": { "from": null, "to": { "ref": 11, "read": 5, "readAsSupplied": 21 } } }, { "kind": "substitution", "ref": 12, "refBase": "C", "readBase": "T", "read": 6, "common": true, "asSupplied": { "read": 20, "readBase": "A" } }, { "kind": "substitution", "ref": 15, "refBase": "A", "readBase": "G", "read": 9, "common": true, "asSupplied": { "read": 17, "readBase": "C" } }, { "kind": "insertion", "refAfter": 16, "length": 1, "bases": "G", "readStart": 11, "readEnd": 11, "asSupplied": { "readStart": 15, "readEnd": 15, "bases": "C" }, "common": true }, { "kind": "insertion", "refAfter": 17, "length": 2, "bases": "GG", "readStart": 13, "readEnd": 14, "asSupplied": { "readStart": 12, "readEnd": 13, "bases": "CC" }, "common": false, "notFixed": { "from": { "ref": 17, "read": 12, "readAsSupplied": 14 }, "to": { "ref": 19, "read": 16, "readAsSupplied": 10 } } }, { "kind": "insertion", "refAfter": 20, "length": 1, "bases": "T", "readStart": 18, "readEnd": 18, "asSupplied": { "readStart": 8, "readEnd": 8, "bases": "A" }, "common": true }, { "kind": "substitution", "ref": 25, "refBase": "C", "readBase": "G", "read": 23, "common": true, "asSupplied": { "read": 3, "readBase": "C" } }, { "kind": "substitution", "ref": 27, "refBase": "A", "readBase": "T", "read": 25, "common": true, "asSupplied": { "read": 1, "readBase": "A" } } ] }, "band": { "diagonalMin": 2, "diagonalMax": 7, "cellsNeeded": 208, "unionBandLimited": false, "scope": "every optimal path", "gridCells": 1586, "searchedBanded": false, "sharedWords": 0, "sharedWordsOverCap": false, "seedGuarantee": { "differencesUpTo": 28, "guaranteed": false } }, "enumeration": "listed", "alignments": [ [ [ 0, 3, 5, 7, 9, 10, 16, 16, 17, 17, 20, 20, 27, 60 ], [ 0, 0, 2, 2, 4, 4, 10, 11, 12, 14, 17, 18, 25, 25 ] ], [ [ 0, 3, 6, 8, 9, 10, 16, 16, 17, 17, 20, 20, 27, 60 ], [ 0, 0, 3, 3, 4, 4, 10, 11, 12, 14, 17, 18, 25, 25 ] ], [ [ 0, 7, 10, 10, 16, 16, 17, 17, 20, 20, 27, 60 ], [ 0, 0, 3, 4, 10, 11, 12, 14, 17, 18, 25, 25 ] ], [ [ 0, 3, 5, 7, 9, 10, 16, 16, 18, 18, 20, 20, 27, 60 ], [ 0, 0, 2, 2, 4, 4, 10, 11, 13, 15, 17, 18, 25, 25 ] ], [ [ 0, 3, 6, 8, 9, 10, 16, 16, 18, 18, 20, 20, 27, 60 ], [ 0, 0, 3, 3, 4, 4, 10, 11, 13, 15, 17, 18, 25, 25 ] ], [ [ 0, 7, 10, 10, 16, 16, 18, 18, 20, 20, 27, 60 ], [ 0, 0, 3, 4, 10, 11, 13, 15, 17, 18, 25, 25 ] ] ], "tuples": [ [ 15, 0, 25, 5, 5, 4, 25, 20 ], [ 17, 0, 28, 4, 7, 5, 25, 24 ] ], "tupleFields": [ "identical", "ambiguousColumns", "columns", "mismatches", "gapColumns", "gapOpens", "readAligned", "referenceCovered" ], "variation": { "readAligned": { "shared": true, "min": 25, "max": 25 }, "referenceCovered": { "shared": false, "min": 20, "max": 24 }, "identity": { "shared": false, "min": { "numerator": 3, "denominator": 5 }, "max": { "numerator": 17, "denominator": 28 } }, "overhangStart": { "shared": true, "min": 0, "max": 0 }, "overhangEnd": { "shared": true, "min": 0, "max": 0 } }, "placements": [ { "refStart": 4, "refEnd": 27, "crossesOrigin": false, "wholeCircle": false, "readStart": 1, "readEnd": 25, "asSupplied": { "readStart": 1, "readEnd": 25 }, "alignments": 6, "band": { "diagonalMin": 2, "diagonalMax": 7, "cellsNeeded": 208, "bandLimited": false } } ] } } ] } }, { "id": "minus-ambiguity", "note": "7d: a minus-strand read carrying R, K, B and D: its differences show Y, M, V and H in reference orientation, and the read's own letters as supplied.", "input": { "reference": { "residues": "GTTGGCCGATTCATTAATGCAGCTGGCACGACAGGTTTCCCGACTGGAAAGCGGGCAGTG", "topology": "linear", "source": "J01636.1 1101-1160" }, "read": { "residues": "TTTCRAGTCGGGAAKCCTGTCGTGBCAGCTGCATDAATGA", "source": "the reverse complement of J01636.1 1111-1150, supplied bases 5, 15, 25 and 35 set to R, K, B and D" }, "modes": [ "semiglobal-read" ] }, "expected": { "results": [ { "mode": "semiglobal-read", "region": null, "strand": "-", "strandUndetermined": false, "plus": { "score": -16, "count": 2, "overCap": false, "state": "aligned", "biopython": { "score": -16, "count": 2 }, "uniquePairs": [ [ 36, 1 ], [ 37, 2 ], [ 38, 3 ], [ 39, 4 ], [ 40, 5 ], [ 41, 6 ], [ 42, 7 ], [ 43, 8 ], [ 44, 9 ], [ 45, 10 ], [ 46, 11 ], [ 47, 12 ], [ 48, 13 ], [ 49, 14 ], [ 50, 15 ], [ 51, 19 ], [ 52, 21 ], [ 53, 22 ], [ 54, 24 ], [ 55, 25 ], [ 56, 26 ], [ 57, 27 ], [ 58, 28 ] ], "uniquePlacement": true, "placementNotDetermined": false, "noCommonColumn": false, "hull": { "refStart": 36, "refEnd": 60, "crossesOrigin": false, "wholeCircle": false }, "selected": { "coordinates": [ [ 0, 35, 50, 50, 51, 51, 53, 53, 58, 58, 60, 60 ], [ 0, 0, 15, 18, 19, 20, 22, 23, 28, 29, 31, 40 ] ], "gappedReference": "TTTCCCGACTGGAAA---G-CG-GGCAG-TG", "gappedRead": "TTTCRAGTCGGGAAKCCTGTCGTGBCAGCTG", "columns": 31, "identical": 19, "mismatches": 3, "ambiguousColumns": 3, "gapColumns": 6, "gapOpens": 4, "identity": { "numerator": 19, "denominator": 28 }, "readAligned": { "bases": 31, "of": 40 }, "referenceCovered": { "bases": 25, "of": 60 }, "placement": { "refStart": 36, "refEnd": 60, "readStart": 1, "readEnd": 31, "crossesOrigin": false }, "overhang": [ { "side": "end", "at": "reference-end", "length": 9, "bases": "CATDAATGA", "readStart": 32, "readEnd": 40 } ], "differences": [ { "kind": "ambiguous", "ref": 40, "refBase": "C", "readBase": "R", "read": 5, "lettersCanAgree": false, "common": true }, { "kind": "substitution", "ref": 41, "refBase": "C", "readBase": "A", "read": 6, "common": true }, { "kind": "substitution", "ref": 43, "refBase": "A", "readBase": "T", "read": 8, "common": true }, { "kind": "substitution", "ref": 45, "refBase": "T", "readBase": "G", "read": 10, "common": true }, { "kind": "ambiguous", "ref": 50, "refBase": "A", "readBase": "K", "read": 15, "lettersCanAgree": false, "common": true }, { "kind": "insertion", "refAfter": 50, "length": 3, "bases": "CCT", "readStart": 16, "readEnd": 18, "common": true }, { "kind": "insertion", "refAfter": 51, "length": 1, "bases": "T", "readStart": 20, "readEnd": 20, "common": true }, { "kind": "insertion", "refAfter": 53, "length": 1, "bases": "T", "readStart": 23, "readEnd": 23, "common": true }, { "kind": "ambiguous", "ref": 55, "refBase": "G", "readBase": "B", "read": 25, "lettersCanAgree": true, "common": true }, { "kind": "insertion", "refAfter": 58, "length": 1, "bases": "C", "readStart": 29, "readEnd": 29, "common": false, "notFixed": { "from": { "ref": 58, "read": 28 }, "to": null } } ] }, "band": { "diagonalMin": 20, "diagonalMax": 35, "cellsNeeded": 602, "unionBandLimited": false, "scope": "every optimal path", "gridCells": 2501, "searchedBanded": false, "sharedWords": 0, "sharedWordsOverCap": false, "seedGuarantee": { "differencesUpTo": 48, "guaranteed": false } }, "enumeration": "listed", "alignments": [ [ [ 0, 35, 50, 50, 51, 51, 53, 53, 58, 58, 60, 60 ], [ 0, 0, 15, 18, 19, 20, 22, 23, 28, 29, 31, 40 ] ], [ [ 0, 35, 50, 50, 51, 51, 53, 53, 58, 58, 60, 60 ], [ 0, 0, 15, 18, 19, 20, 22, 23, 28, 37, 39, 40 ] ] ], "tuples": [ [ 19, 3, 31, 3, 6, 4, 31, 25 ], [ 19, 3, 39, 3, 14, 4, 39, 25 ] ], "tupleFields": [ "identical", "ambiguousColumns", "columns", "mismatches", "gapColumns", "gapOpens", "readAligned", "referenceCovered" ], "variation": { "readAligned": { "shared": false, "min": 31, "max": 39 }, "referenceCovered": { "shared": true, "min": 25, "max": 25 }, "identity": { "shared": false, "min": { "numerator": 19, "denominator": 36 }, "max": { "numerator": 19, "denominator": 28 } }, "overhangStart": { "shared": true, "min": 0, "max": 0 }, "overhangEnd": { "shared": false, "min": 1, "max": 9 } }, "placements": [ { "refStart": 36, "refEnd": 60, "crossesOrigin": false, "wholeCircle": false, "readStart": 1, "readEnd": 39, "alignments": 2, "band": { "diagonalMin": 20, "diagonalMax": 35, "cellsNeeded": 602, "bandLimited": false } } ] }, "minus": { "score": 72, "count": 1, "overCap": false, "state": "aligned", "biopython": { "score": 72, "count": 1 }, "uniquePairs": [ [ 11, 1 ], [ 12, 2 ], [ 13, 3 ], [ 14, 4 ], [ 15, 5 ], [ 16, 6 ], [ 17, 7 ], [ 18, 8 ], [ 19, 9 ], [ 20, 10 ], [ 21, 11 ], [ 22, 12 ], [ 23, 13 ], [ 24, 14 ], [ 25, 15 ], [ 26, 16 ], [ 27, 17 ], [ 28, 18 ], [ 29, 19 ], [ 30, 20 ], [ 31, 21 ], [ 32, 22 ], [ 33, 23 ], [ 34, 24 ], [ 35, 25 ], [ 36, 26 ], [ 37, 27 ], [ 38, 28 ], [ 39, 29 ], [ 40, 30 ], [ 41, 31 ], [ 42, 32 ], [ 43, 33 ], [ 44, 34 ], [ 45, 35 ], [ 46, 36 ], [ 47, 37 ], [ 48, 38 ], [ 49, 39 ], [ 50, 40 ] ], "uniquePlacement": true, "placementNotDetermined": false, "noCommonColumn": false, "hull": { "refStart": 11, "refEnd": 50, "crossesOrigin": false, "wholeCircle": false }, "selected": { "coordinates": [ [ 0, 10, 50, 60 ], [ 0, 0, 40, 40 ] ], "gappedReference": "TCATTAATGCAGCTGGCACGACAGGTTTCCCGACTGGAAA", "gappedRead": "TCATTHATGCAGCTGVCACGACAGGMTTCCCGACTYGAAA", "columns": 40, "identical": 36, "mismatches": 0, "ambiguousColumns": 4, "gapColumns": 0, "gapOpens": 0, "identity": { "numerator": 36, "denominator": 36 }, "readAligned": { "bases": 40, "of": 40 }, "referenceCovered": { "bases": 40, "of": 60 }, "placement": { "refStart": 11, "refEnd": 50, "readStart": 1, "readEnd": 40, "crossesOrigin": false, "asSupplied": { "readStart": 1, "readEnd": 40 } }, "overhang": [], "differences": [ { "kind": "ambiguous", "ref": 16, "refBase": "A", "readBase": "H", "read": 6, "lettersCanAgree": true, "common": true, "asSupplied": { "read": 35, "readBase": "D" } }, { "kind": "ambiguous", "ref": 26, "refBase": "G", "readBase": "V", "read": 16, "lettersCanAgree": true, "common": true, "asSupplied": { "read": 25, "readBase": "B" } }, { "kind": "ambiguous", "ref": 36, "refBase": "T", "readBase": "M", "read": 26, "lettersCanAgree": false, "common": true, "asSupplied": { "read": 15, "readBase": "K" } }, { "kind": "ambiguous", "ref": 46, "refBase": "G", "readBase": "Y", "read": 36, "lettersCanAgree": false, "common": true, "asSupplied": { "read": 5, "readBase": "R" } } ] }, "band": { "diagonalMin": 10, "diagonalMax": 10, "cellsNeeded": 123, "unionBandLimited": false, "scope": "every optimal path", "gridCells": 2501, "searchedBanded": false, "sharedWords": 0, "sharedWordsOverCap": false, "seedGuarantee": { "differencesUpTo": 4, "guaranteed": false } }, "enumeration": "listed", "alignments": [ [ [ 0, 10, 50, 60 ], [ 0, 0, 40, 40 ] ] ], "tuples": [ [ 36, 4, 40, 0, 0, 0, 40, 40 ] ], "tupleFields": [ "identical", "ambiguousColumns", "columns", "mismatches", "gapColumns", "gapOpens", "readAligned", "referenceCovered" ], "variation": { "readAligned": { "shared": true, "min": 40, "max": 40 }, "referenceCovered": { "shared": true, "min": 40, "max": 40 }, "identity": { "shared": true, "min": { "numerator": 1, "denominator": 1 }, "max": { "numerator": 1, "denominator": 1 } }, "overhangStart": { "shared": true, "min": 0, "max": 0 }, "overhangEnd": { "shared": true, "min": 0, "max": 0 } }, "placements": [ { "refStart": 11, "refEnd": 50, "crossesOrigin": false, "wholeCircle": false, "readStart": 1, "readEnd": 40, "asSupplied": { "readStart": 1, "readEnd": 40 }, "alignments": 1, "band": { "diagonalMin": 10, "diagonalMax": 10, "cellsNeeded": 123, "bandLimited": false } } ] } } ] } }, { "id": "homopolymer-deletion-plus", "note": "7e: a deletion of two in a run of ten A, read on the plus strand.", "input": { "reference": { "residues": "GACACCATCGAATGGCGCAAAACCTTTCGCAAAAAAAAAAGGTATGGCATGATAGCGCCCGGAAGAGAGT", "topology": "linear", "source": "J01636.1 1-30, ten A, 31-60" }, "read": { "residues": "AATGGCGCAAAACCTTTCGCAAAAAAAAGGTATGGCATGATAGCGCCC", "source": "J01636.1 11-30, eight A, 31-50" }, "modes": [ "semiglobal-read" ] }, "expected": { "results": [ { "mode": "semiglobal-read", "region": null, "strand": "+", "strandUndetermined": false, "plus": { "score": 89, "count": 9, "overCap": false, "state": "aligned", "biopython": { "score": 89, "count": 9 }, "uniquePairs": [ [ 11, 1 ], [ 12, 2 ], [ 13, 3 ], [ 14, 4 ], [ 15, 5 ], [ 16, 6 ], [ 17, 7 ], [ 18, 8 ], [ 19, 9 ], [ 20, 10 ], [ 21, 11 ], [ 22, 12 ], [ 23, 13 ], [ 24, 14 ], [ 25, 15 ], [ 26, 16 ], [ 27, 17 ], [ 28, 18 ], [ 29, 19 ], [ 30, 20 ], [ 41, 29 ], [ 42, 30 ], [ 43, 31 ], [ 44, 32 ], [ 45, 33 ], [ 46, 34 ], [ 47, 35 ], [ 48, 36 ], [ 49, 37 ], [ 50, 38 ], [ 51, 39 ], [ 52, 40 ], [ 53, 41 ], [ 54, 42 ], [ 55, 43 ], [ 56, 44 ], [ 57, 45 ], [ 58, 46 ], [ 59, 47 ], [ 60, 48 ] ], "uniquePlacement": true, "placementNotDetermined": false, "noCommonColumn": false, "hull": { "refStart": 11, "refEnd": 60, "crossesOrigin": false, "wholeCircle": false }, "selected": { "coordinates": [ [ 0, 10, 30, 32, 60, 70 ], [ 0, 0, 20, 20, 48, 48 ] ], "gappedReference": "AATGGCGCAAAACCTTTCGCAAAAAAAAAAGGTATGGCATGATAGCGCCC", "gappedRead": "AATGGCGCAAAACCTTTCGC--AAAAAAAAGGTATGGCATGATAGCGCCC", "columns": 50, "identical": 48, "mismatches": 0, "ambiguousColumns": 0, "gapColumns": 2, "gapOpens": 1, "identity": { "numerator": 48, "denominator": 50 }, "readAligned": { "bases": 48, "of": 48 }, "referenceCovered": { "bases": 50, "of": 70 }, "placement": { "refStart": 11, "refEnd": 60, "readStart": 1, "readEnd": 48, "crossesOrigin": false }, "overhang": [], "differences": [ { "kind": "deletion", "refStart": 31, "refEnd": 32, "length": 2, "bases": "AA", "readAfter": 20, "common": false, "notFixed": { "from": { "ref": 30, "read": 20 }, "to": { "ref": 41, "read": 29 } } } ] }, "band": { "diagonalMin": 10, "diagonalMax": 12, "cellsNeeded": 245, "unionBandLimited": false, "scope": "every optimal path", "gridCells": 3479, "searchedBanded": false, "sharedWords": 34, "sharedWordsOverCap": false, "seedGuarantee": { "differencesUpTo": 3, "guaranteed": true } }, "enumeration": "listed", "alignments": [ [ [ 0, 10, 30, 32, 60, 70 ], [ 0, 0, 20, 20, 48, 48 ] ], [ [ 0, 10, 31, 33, 60, 70 ], [ 0, 0, 21, 21, 48, 48 ] ], [ [ 0, 10, 32, 34, 60, 70 ], [ 0, 0, 22, 22, 48, 48 ] ], [ [ 0, 10, 33, 35, 60, 70 ], [ 0, 0, 23, 23, 48, 48 ] ], [ [ 0, 10, 34, 36, 60, 70 ], [ 0, 0, 24, 24, 48, 48 ] ], [ [ 0, 10, 35, 37, 60, 70 ], [ 0, 0, 25, 25, 48, 48 ] ], [ [ 0, 10, 36, 38, 60, 70 ], [ 0, 0, 26, 26, 48, 48 ] ], [ [ 0, 10, 37, 39, 60, 70 ], [ 0, 0, 27, 27, 48, 48 ] ], [ [ 0, 10, 38, 40, 60, 70 ], [ 0, 0, 28, 28, 48, 48 ] ] ], "tuples": [ [ 48, 0, 50, 0, 2, 1, 48, 50 ] ], "tupleFields": [ "identical", "ambiguousColumns", "columns", "mismatches", "gapColumns", "gapOpens", "readAligned", "referenceCovered" ], "variation": { "readAligned": { "shared": true, "min": 48, "max": 48 }, "referenceCovered": { "shared": true, "min": 50, "max": 50 }, "identity": { "shared": true, "min": { "numerator": 24, "denominator": 25 }, "max": { "numerator": 24, "denominator": 25 } }, "overhangStart": { "shared": true, "min": 0, "max": 0 }, "overhangEnd": { "shared": true, "min": 0, "max": 0 } }, "placements": [ { "refStart": 11, "refEnd": 60, "crossesOrigin": false, "wholeCircle": false, "readStart": 1, "readEnd": 48, "alignments": 9, "band": { "diagonalMin": 10, "diagonalMax": 12, "cellsNeeded": 245, "bandLimited": false } } ] }, "minus": { "score": -26, "count": 1400, "overCap": true, "state": "aligned", "biopython": { "score": -26, "count": 1400 }, "uniquePairs": [ [ 22, 18 ], [ 23, 19 ], [ 24, 20 ], [ 29, 29 ], [ 30, 30 ], [ 41, 35 ], [ 42, 36 ], [ 43, 37 ], [ 44, 38 ], [ 45, 39 ] ], "uniquePlacement": true, "placementNotDetermined": false, "noCommonColumn": false, "hull": { "refStart": 1, "refEnd": 54, "crossesOrigin": false, "wholeCircle": false }, "selected": { "coordinates": [ [ 0, 0, 9, 11, 13, 16, 24, 24, 30, 36, 45, 45, 51, 70 ], [ 0, 1, 10, 10, 12, 12, 20, 24, 30, 30, 39, 42, 48, 48 ] ], "gappedReference": "GACACCATCGAATGGCGCAAAACC----TTTCGCAAAAAAAAAAGGTAT---GGCATG", "gappedRead": "GGCGCTATC--AT---GCCATACCTTTTTTTTGC------GAAAGGTTTTGCGCCATT", "columns": 58, "identical": 30, "mismatches": 10, "ambiguousColumns": 0, "gapColumns": 18, "gapOpens": 5, "identity": { "numerator": 30, "denominator": 58 }, "readAligned": { "bases": 47, "of": 48 }, "referenceCovered": { "bases": 51, "of": 70 }, "placement": { "refStart": 1, "refEnd": 51, "readStart": 2, "readEnd": 48, "crossesOrigin": false, "asSupplied": { "readStart": 1, "readEnd": 47 } }, "overhang": [ { "side": "start", "at": "reference-end", "length": 1, "bases": "G", "readStart": 1, "readEnd": 1, "asSupplied": { "readStart": 48, "readEnd": 48, "bases": "C" } } ], "differences": [ { "kind": "substitution", "ref": 2, "refBase": "A", "readBase": "G", "read": 3, "common": false, "notFixed": { "from": null, "to": { "ref": 22, "read": 18, "readAsSupplied": 31 } }, "asSupplied": { "read": 46, "readBase": "C" } }, { "kind": "substitution", "ref": 4, "refBase": "A", "readBase": "G", "read": 5, "common": false, "notFixed": { "from": null, "to": { "ref": 22, "read": 18, "readAsSupplied": 31 } }, "asSupplied": { "read": 44, "readBase": "C" } }, { "kind": "substitution", "ref": 6, "refBase": "C", "readBase": "T", "read": 7, "common": false, "notFixed": { "from": null, "to": { "ref": 22, "read": 18, "readAsSupplied": 31 } }, "asSupplied": { "read": 42, "readBase": "A" } }, { "kind": "deletion", "refStart": 10, "refEnd": 11, "length": 2, "bases": "GA", "readAfter": 10, "asSupplied": { "readBetween": [ 38, 39 ] }, "common": false, "notFixed": { "from": null, "to": { "ref": 22, "read": 18, "readAsSupplied": 31 } } }, { "kind": "deletion", "refStart": 14, "refEnd": 16, "length": 3, "bases": "GGC", "readAfter": 12, "asSupplied": { "readBetween": [ 36, 37 ] }, "common": false, "notFixed": { "from": null, "to": { "ref": 22, "read": 18, "readAsSupplied": 31 } } }, { "kind": "substitution", "ref": 19, "refBase": "A", "readBase": "C", "read": 15, "common": false, "notFixed": { "from": null, "to": { "ref": 22, "read": 18, "readAsSupplied": 31 } }, "asSupplied": { "read": 34, "readBase": "G" } }, { "kind": "substitution", "ref": 21, "refBase": "A", "readBase": "T", "read": 17, "common": false, "notFixed": { "from": null, "to": { "ref": 22, "read": 18, "readAsSupplied": 31 } }, "asSupplied": { "read": 32, "readBase": "A" } }, { "kind": "insertion", "refAfter": 24, "length": 4, "bases": "TTTT", "readStart": 21, "readEnd": 24, "asSupplied": { "readStart": 25, "readEnd": 28, "bases": "AAAA" }, "common": false, "notFixed": { "from": { "ref": 24, "read": 20, "readAsSupplied": 29 }, "to": { "ref": 29, "read": 29, "readAsSupplied": 20 } } }, { "kind": "substitution", "ref": 28, "refBase": "C", "readBase": "T", "read": 28, "common": false, "notFixed": { "from": { "ref": 24, "read": 20, "readAsSupplied": 29 }, "to": { "ref": 29, "read": 29, "readAsSupplied": 20 } }, "asSupplied": { "read": 21, "readBase": "A" } }, { "kind": "deletion", "refStart": 31, "refEnd": 36, "length": 6, "bases": "AAAAAA", "readAfter": 30, "asSupplied": { "readBetween": [ 18, 19 ] }, "common": false, "notFixed": { "from": { "ref": 30, "read": 30, "readAsSupplied": 19 }, "to": { "ref": 41, "read": 35, "readAsSupplied": 14 } } }, { "kind": "substitution", "ref": 37, "refBase": "A", "readBase": "G", "read": 31, "common": false, "notFixed": { "from": { "ref": 30, "read": 30, "readAsSupplied": 19 }, "to": { "ref": 41, "read": 35, "readAsSupplied": 14 } }, "asSupplied": { "read": 18, "readBase": "C" } }, { "kind": "substitution", "ref": 44, "refBase": "A", "readBase": "T", "read": 38, "common": true, "asSupplied": { "read": 11, "readBase": "A" } }, { "kind": "insertion", "refAfter": 45, "length": 3, "bases": "TGC", "readStart": 40, "readEnd": 42, "asSupplied": { "readStart": 7, "readEnd": 9, "bases": "GCA" }, "common": false, "notFixed": { "from": { "ref": 45, "read": 39, "readAsSupplied": 10 }, "to": null } }, { "kind": "substitution", "ref": 47, "refBase": "G", "readBase": "C", "read": 44, "common": false, "notFixed": { "from": { "ref": 45, "read": 39, "readAsSupplied": 10 }, "to": null }, "asSupplied": { "read": 5, "readBase": "G" } }, { "kind": "substitution", "ref": 51, "refBase": "G", "readBase": "T", "read": 48, "common": false, "notFixed": { "from": { "ref": 45, "read": 39, "readAsSupplied": 10 }, "to": null }, "asSupplied": { "read": 1, "readBase": "A" } } ] }, "band": { "diagonalMin": -1, "diagonalMax": 12, "cellsNeeded": 781, "unionBandLimited": false, "scope": "every optimal path", "gridCells": 3479, "searchedBanded": false, "sharedWords": 0, "sharedWordsOverCap": false, "seedGuarantee": { "differencesUpTo": 61, "guaranteed": false } }, "enumeration": "checked", "tuples": [ [ 26, 0, 54, 7, 21, 5, 48, 39 ], [ 26, 0, 54, 10, 18, 4, 48, 42 ], [ 30, 0, 58, 10, 18, 5, 47, 51 ], [ 30, 0, 58, 13, 15, 4, 47, 54 ], [ 30, 0, 59, 10, 19, 6, 48, 51 ], [ 30, 0, 59, 13, 16, 5, 48, 54 ] ], "tupleFields": [ "identical", "ambiguousColumns", "columns", "mismatches", "gapColumns", "gapOpens", "readAligned", "referenceCovered" ], "variation": { "readAligned": { "shared": false, "min": 47, "max": 48 }, "referenceCovered": { "shared": false, "min": 39, "max": 54 }, "identity": { "shared": false, "min": { "numerator": 13, "denominator": 27 }, "max": { "numerator": 15, "denominator": 29 } }, "overhangStart": { "shared": false, "min": 0, "max": 1 }, "overhangEnd": { "shared": true, "min": 0, "max": 0 } }, "placements": [ { "refStart": 1, "refEnd": 54, "crossesOrigin": false, "wholeCircle": false, "readStart": 1, "readEnd": 48, "asSupplied": { "readStart": 1, "readEnd": 48 }, "alignments": 1400, "band": { "diagonalMin": -1, "diagonalMax": 12, "cellsNeeded": 781, "bandLimited": false } } ] } } ] } }, { "id": "homopolymer-deletion-minus", "note": "7e: the same read supplied as its reverse complement: the deletion sits at the same leftmost reference position.", "input": { "reference": { "residues": "GACACCATCGAATGGCGCAAAACCTTTCGCAAAAAAAAAAGGTATGGCATGATAGCGCCCGGAAGAGAGT", "topology": "linear", "source": "J01636.1 1-30, ten A, 31-60" }, "read": { "residues": "GGGCGCTATCATGCCATACCTTTTTTTTGCGAAAGGTTTTGCGCCATT", "source": "the reverse complement of homopolymer-deletion-plus's read" }, "modes": [ "semiglobal-read" ] }, "expected": { "results": [ { "mode": "semiglobal-read", "region": null, "strand": "-", "strandUndetermined": false, "plus": { "score": -26, "count": 1400, "overCap": true, "state": "aligned", "biopython": { "score": -26, "count": 1400 }, "uniquePairs": [ [ 22, 18 ], [ 23, 19 ], [ 24, 20 ], [ 29, 29 ], [ 30, 30 ], [ 41, 35 ], [ 42, 36 ], [ 43, 37 ], [ 44, 38 ], [ 45, 39 ] ], "uniquePlacement": true, "placementNotDetermined": false, "noCommonColumn": false, "hull": { "refStart": 1, "refEnd": 54, "crossesOrigin": false, "wholeCircle": false }, "selected": { "coordinates": [ [ 0, 0, 9, 11, 13, 16, 24, 24, 30, 36, 45, 45, 51, 70 ], [ 0, 1, 10, 10, 12, 12, 20, 24, 30, 30, 39, 42, 48, 48 ] ], "gappedReference": "GACACCATCGAATGGCGCAAAACC----TTTCGCAAAAAAAAAAGGTAT---GGCATG", "gappedRead": "GGCGCTATC--AT---GCCATACCTTTTTTTTGC------GAAAGGTTTTGCGCCATT", "columns": 58, "identical": 30, "mismatches": 10, "ambiguousColumns": 0, "gapColumns": 18, "gapOpens": 5, "identity": { "numerator": 30, "denominator": 58 }, "readAligned": { "bases": 47, "of": 48 }, "referenceCovered": { "bases": 51, "of": 70 }, "placement": { "refStart": 1, "refEnd": 51, "readStart": 2, "readEnd": 48, "crossesOrigin": false }, "overhang": [ { "side": "start", "at": "reference-end", "length": 1, "bases": "G", "readStart": 1, "readEnd": 1 } ], "differences": [ { "kind": "substitution", "ref": 2, "refBase": "A", "readBase": "G", "read": 3, "common": false, "notFixed": { "from": null, "to": { "ref": 22, "read": 18 } } }, { "kind": "substitution", "ref": 4, "refBase": "A", "readBase": "G", "read": 5, "common": false, "notFixed": { "from": null, "to": { "ref": 22, "read": 18 } } }, { "kind": "substitution", "ref": 6, "refBase": "C", "readBase": "T", "read": 7, "common": false, "notFixed": { "from": null, "to": { "ref": 22, "read": 18 } } }, { "kind": "deletion", "refStart": 10, "refEnd": 11, "length": 2, "bases": "GA", "readAfter": 10, "common": false, "notFixed": { "from": null, "to": { "ref": 22, "read": 18 } } }, { "kind": "deletion", "refStart": 14, "refEnd": 16, "length": 3, "bases": "GGC", "readAfter": 12, "common": false, "notFixed": { "from": null, "to": { "ref": 22, "read": 18 } } }, { "kind": "substitution", "ref": 19, "refBase": "A", "readBase": "C", "read": 15, "common": false, "notFixed": { "from": null, "to": { "ref": 22, "read": 18 } } }, { "kind": "substitution", "ref": 21, "refBase": "A", "readBase": "T", "read": 17, "common": false, "notFixed": { "from": null, "to": { "ref": 22, "read": 18 } } }, { "kind": "insertion", "refAfter": 24, "length": 4, "bases": "TTTT", "readStart": 21, "readEnd": 24, "common": false, "notFixed": { "from": { "ref": 24, "read": 20 }, "to": { "ref": 29, "read": 29 } } }, { "kind": "substitution", "ref": 28, "refBase": "C", "readBase": "T", "read": 28, "common": false, "notFixed": { "from": { "ref": 24, "read": 20 }, "to": { "ref": 29, "read": 29 } } }, { "kind": "deletion", "refStart": 31, "refEnd": 36, "length": 6, "bases": "AAAAAA", "readAfter": 30, "common": false, "notFixed": { "from": { "ref": 30, "read": 30 }, "to": { "ref": 41, "read": 35 } } }, { "kind": "substitution", "ref": 37, "refBase": "A", "readBase": "G", "read": 31, "common": false, "notFixed": { "from": { "ref": 30, "read": 30 }, "to": { "ref": 41, "read": 35 } } }, { "kind": "substitution", "ref": 44, "refBase": "A", "readBase": "T", "read": 38, "common": true }, { "kind": "insertion", "refAfter": 45, "length": 3, "bases": "TGC", "readStart": 40, "readEnd": 42, "common": false, "notFixed": { "from": { "ref": 45, "read": 39 }, "to": null } }, { "kind": "substitution", "ref": 47, "refBase": "G", "readBase": "C", "read": 44, "common": false, "notFixed": { "from": { "ref": 45, "read": 39 }, "to": null } }, { "kind": "substitution", "ref": 51, "refBase": "G", "readBase": "T", "read": 48, "common": false, "notFixed": { "from": { "ref": 45, "read": 39 }, "to": null } } ] }, "band": { "diagonalMin": -1, "diagonalMax": 12, "cellsNeeded": 781, "unionBandLimited": false, "scope": "every optimal path", "gridCells": 3479, "searchedBanded": false, "sharedWords": 0, "sharedWordsOverCap": false, "seedGuarantee": { "differencesUpTo": 61, "guaranteed": false } }, "enumeration": "checked", "tuples": [ [ 26, 0, 54, 7, 21, 5, 48, 39 ], [ 26, 0, 54, 10, 18, 4, 48, 42 ], [ 30, 0, 58, 10, 18, 5, 47, 51 ], [ 30, 0, 58, 13, 15, 4, 47, 54 ], [ 30, 0, 59, 10, 19, 6, 48, 51 ], [ 30, 0, 59, 13, 16, 5, 48, 54 ] ], "tupleFields": [ "identical", "ambiguousColumns", "columns", "mismatches", "gapColumns", "gapOpens", "readAligned", "referenceCovered" ], "variation": { "readAligned": { "shared": false, "min": 47, "max": 48 }, "referenceCovered": { "shared": false, "min": 39, "max": 54 }, "identity": { "shared": false, "min": { "numerator": 13, "denominator": 27 }, "max": { "numerator": 15, "denominator": 29 } }, "overhangStart": { "shared": false, "min": 0, "max": 1 }, "overhangEnd": { "shared": true, "min": 0, "max": 0 } }, "placements": [ { "refStart": 1, "refEnd": 54, "crossesOrigin": false, "wholeCircle": false, "readStart": 1, "readEnd": 48, "alignments": 1400, "band": { "diagonalMin": -1, "diagonalMax": 12, "cellsNeeded": 781, "bandLimited": false } } ] }, "minus": { "score": 89, "count": 9, "overCap": false, "state": "aligned", "biopython": { "score": 89, "count": 9 }, "uniquePairs": [ [ 11, 1 ], [ 12, 2 ], [ 13, 3 ], [ 14, 4 ], [ 15, 5 ], [ 16, 6 ], [ 17, 7 ], [ 18, 8 ], [ 19, 9 ], [ 20, 10 ], [ 21, 11 ], [ 22, 12 ], [ 23, 13 ], [ 24, 14 ], [ 25, 15 ], [ 26, 16 ], [ 27, 17 ], [ 28, 18 ], [ 29, 19 ], [ 30, 20 ], [ 41, 29 ], [ 42, 30 ], [ 43, 31 ], [ 44, 32 ], [ 45, 33 ], [ 46, 34 ], [ 47, 35 ], [ 48, 36 ], [ 49, 37 ], [ 50, 38 ], [ 51, 39 ], [ 52, 40 ], [ 53, 41 ], [ 54, 42 ], [ 55, 43 ], [ 56, 44 ], [ 57, 45 ], [ 58, 46 ], [ 59, 47 ], [ 60, 48 ] ], "uniquePlacement": true, "placementNotDetermined": false, "noCommonColumn": false, "hull": { "refStart": 11, "refEnd": 60, "crossesOrigin": false, "wholeCircle": false }, "selected": { "coordinates": [ [ 0, 10, 30, 32, 60, 70 ], [ 0, 0, 20, 20, 48, 48 ] ], "gappedReference": "AATGGCGCAAAACCTTTCGCAAAAAAAAAAGGTATGGCATGATAGCGCCC", "gappedRead": "AATGGCGCAAAACCTTTCGC--AAAAAAAAGGTATGGCATGATAGCGCCC", "columns": 50, "identical": 48, "mismatches": 0, "ambiguousColumns": 0, "gapColumns": 2, "gapOpens": 1, "identity": { "numerator": 48, "denominator": 50 }, "readAligned": { "bases": 48, "of": 48 }, "referenceCovered": { "bases": 50, "of": 70 }, "placement": { "refStart": 11, "refEnd": 60, "readStart": 1, "readEnd": 48, "crossesOrigin": false, "asSupplied": { "readStart": 1, "readEnd": 48 } }, "overhang": [], "differences": [ { "kind": "deletion", "refStart": 31, "refEnd": 32, "length": 2, "bases": "AA", "readAfter": 20, "asSupplied": { "readBetween": [ 28, 29 ] }, "common": false, "notFixed": { "from": { "ref": 30, "read": 20, "readAsSupplied": 29 }, "to": { "ref": 41, "read": 29, "readAsSupplied": 20 } } } ] }, "band": { "diagonalMin": 10, "diagonalMax": 12, "cellsNeeded": 245, "unionBandLimited": false, "scope": "every optimal path", "gridCells": 3479, "searchedBanded": false, "sharedWords": 34, "sharedWordsOverCap": false, "seedGuarantee": { "differencesUpTo": 3, "guaranteed": true } }, "enumeration": "listed", "alignments": [ [ [ 0, 10, 30, 32, 60, 70 ], [ 0, 0, 20, 20, 48, 48 ] ], [ [ 0, 10, 31, 33, 60, 70 ], [ 0, 0, 21, 21, 48, 48 ] ], [ [ 0, 10, 32, 34, 60, 70 ], [ 0, 0, 22, 22, 48, 48 ] ], [ [ 0, 10, 33, 35, 60, 70 ], [ 0, 0, 23, 23, 48, 48 ] ], [ [ 0, 10, 34, 36, 60, 70 ], [ 0, 0, 24, 24, 48, 48 ] ], [ [ 0, 10, 35, 37, 60, 70 ], [ 0, 0, 25, 25, 48, 48 ] ], [ [ 0, 10, 36, 38, 60, 70 ], [ 0, 0, 26, 26, 48, 48 ] ], [ [ 0, 10, 37, 39, 60, 70 ], [ 0, 0, 27, 27, 48, 48 ] ], [ [ 0, 10, 38, 40, 60, 70 ], [ 0, 0, 28, 28, 48, 48 ] ] ], "tuples": [ [ 48, 0, 50, 0, 2, 1, 48, 50 ] ], "tupleFields": [ "identical", "ambiguousColumns", "columns", "mismatches", "gapColumns", "gapOpens", "readAligned", "referenceCovered" ], "variation": { "readAligned": { "shared": true, "min": 48, "max": 48 }, "referenceCovered": { "shared": true, "min": 50, "max": 50 }, "identity": { "shared": true, "min": { "numerator": 24, "denominator": 25 }, "max": { "numerator": 24, "denominator": 25 } }, "overhangStart": { "shared": true, "min": 0, "max": 0 }, "overhangEnd": { "shared": true, "min": 0, "max": 0 } }, "placements": [ { "refStart": 11, "refEnd": 60, "crossesOrigin": false, "wholeCircle": false, "readStart": 1, "readEnd": 48, "asSupplied": { "readStart": 1, "readEnd": 48 }, "alignments": 9, "band": { "diagonalMin": 10, "diagonalMax": 12, "cellsNeeded": 245, "bandLimited": false } } ] } } ] } }, { "id": "all-n-read", "note": "7f: a read of N only. semiglobal-read: every placement scores 0, identity is withheld and the placements are listed as ambiguous; local: no alignment.", "input": { "reference": { "residues": "GACACCATCGAATGGCGCAAAACCTTTCGCGGTATGGCATGATAGCGCCCGGAAGAGAGT", "topology": "linear", "source": "J01636.1 1-60" }, "read": { "residues": "NNNNNNNNNNNNNNNNNNNN" }, "modes": [ "semiglobal-read", "local" ] }, "expected": { "results": [ { "mode": "semiglobal-read", "region": null, "strand": "ambiguous", "strandUndetermined": false, "plus": { "score": 0, "count": 41, "overCap": false, "state": "aligned", "biopython": { "score": 0, "count": 41 }, "uniquePairs": [], "uniquePlacement": false, "placementNotDetermined": false, "noCommonColumn": false, "hull": { "refStart": 1, "refEnd": 60, "crossesOrigin": false, "wholeCircle": false }, "selected": { "coordinates": [ [ 0, 20, 60 ], [ 0, 20, 20 ] ], "gappedReference": "GACACCATCGAATGGCGCAA", "gappedRead": "NNNNNNNNNNNNNNNNNNNN", "columns": 20, "identical": 0, "mismatches": 0, "ambiguousColumns": 20, "gapColumns": 0, "gapOpens": 0, "identity": null, "readAligned": { "bases": 20, "of": 20 }, "referenceCovered": { "bases": 20, "of": 60 }, "identityWithheld": "no-determinable-column", "placement": { "refStart": 1, "refEnd": 20, "readStart": 1, "readEnd": 20, "crossesOrigin": false }, "overhang": [], "differences": [ { "kind": "ambiguous", "ref": 1, "refBase": "G", "readBase": "N", "read": 1, "lettersCanAgree": true, "common": false, "notFixed": { "from": null, "to": null } }, { "kind": "ambiguous", "ref": 2, "refBase": "A", "readBase": "N", "read": 2, "lettersCanAgree": true, "common": false, "notFixed": { "from": null, "to": null } }, { "kind": "ambiguous", "ref": 3, "refBase": "C", "readBase": "N", "read": 3, "lettersCanAgree": true, "common": false, "notFixed": { "from": null, "to": null } }, { "kind": "ambiguous", "ref": 4, "refBase": "A", "readBase": "N", "read": 4, "lettersCanAgree": true, "common": false, "notFixed": { "from": null, "to": null } }, { "kind": "ambiguous", "ref": 5, "refBase": "C", "readBase": "N", "read": 5, "lettersCanAgree": true, "common": false, "notFixed": { "from": null, "to": null } }, { "kind": "ambiguous", "ref": 6, "refBase": "C", "readBase": "N", "read": 6, "lettersCanAgree": true, "common": false, "notFixed": { "from": null, "to": null } }, { "kind": "ambiguous", "ref": 7, "refBase": "A", "readBase": "N", "read": 7, "lettersCanAgree": true, "common": false, "notFixed": { "from": null, "to": null } }, { "kind": "ambiguous", "ref": 8, "refBase": "T", "readBase": "N", "read": 8, "lettersCanAgree": true, "common": false, "notFixed": { "from": null, "to": null } }, { "kind": "ambiguous", "ref": 9, "refBase": "C", "readBase": "N", "read": 9, "lettersCanAgree": true, "common": false, "notFixed": { "from": null, "to": null } }, { "kind": "ambiguous", "ref": 10, "refBase": "G", "readBase": "N", "read": 10, "lettersCanAgree": true, "common": false, "notFixed": { "from": null, "to": null } }, { "kind": "ambiguous", "ref": 11, "refBase": "A", "readBase": "N", "read": 11, "lettersCanAgree": true, "common": false, "notFixed": { "from": null, "to": null } }, { "kind": "ambiguous", "ref": 12, "refBase": "A", "readBase": "N", "read": 12, "lettersCanAgree": true, "common": false, "notFixed": { "from": null, "to": null } }, { "kind": "ambiguous", "ref": 13, "refBase": "T", "readBase": "N", "read": 13, "lettersCanAgree": true, "common": false, "notFixed": { "from": null, "to": null } }, { "kind": "ambiguous", "ref": 14, "refBase": "G", "readBase": "N", "read": 14, "lettersCanAgree": true, "common": false, "notFixed": { "from": null, "to": null } }, { "kind": "ambiguous", "ref": 15, "refBase": "G", "readBase": "N", "read": 15, "lettersCanAgree": true, "common": false, "notFixed": { "from": null, "to": null } }, { "kind": "ambiguous", "ref": 16, "refBase": "C", "readBase": "N", "read": 16, "lettersCanAgree": true, "common": false, "notFixed": { "from": null, "to": null } }, { "kind": "ambiguous", "ref": 17, "refBase": "G", "readBase": "N", "read": 17, "lettersCanAgree": true, "common": false, "notFixed": { "from": null, "to": null } }, { "kind": "ambiguous", "ref": 18, "refBase": "C", "readBase": "N", "read": 18, "lettersCanAgree": true, "common": false, "notFixed": { "from": null, "to": null } }, { "kind": "ambiguous", "ref": 19, "refBase": "A", "readBase": "N", "read": 19, "lettersCanAgree": true, "common": false, "notFixed": { "from": null, "to": null } }, { "kind": "ambiguous", "ref": 20, "refBase": "A", "readBase": "N", "read": 20, "lettersCanAgree": true, "common": false, "notFixed": { "from": null, "to": null } } ] }, "band": { "diagonalMin": 0, "diagonalMax": 40, "cellsNeeded": 901, "unionBandLimited": false, "scope": "every optimal path", "gridCells": 1281, "searchedBanded": false, "sharedWords": 0, "sharedWordsOverCap": false, "seedGuarantee": { "differencesUpTo": 20, "guaranteed": false } }, "enumeration": "listed", "alignments": [ [ [ 0, 20, 60 ], [ 0, 20, 20 ] ], [ [ 0, 1, 21, 60 ], [ 0, 0, 20, 20 ] ], [ [ 0, 2, 22, 60 ], [ 0, 0, 20, 20 ] ], [ [ 0, 3, 23, 60 ], [ 0, 0, 20, 20 ] ], [ [ 0, 4, 24, 60 ], [ 0, 0, 20, 20 ] ], [ [ 0, 5, 25, 60 ], [ 0, 0, 20, 20 ] ], [ [ 0, 6, 26, 60 ], [ 0, 0, 20, 20 ] ], [ [ 0, 7, 27, 60 ], [ 0, 0, 20, 20 ] ], [ [ 0, 8, 28, 60 ], [ 0, 0, 20, 20 ] ], [ [ 0, 9, 29, 60 ], [ 0, 0, 20, 20 ] ], [ [ 0, 10, 30, 60 ], [ 0, 0, 20, 20 ] ], [ [ 0, 11, 31, 60 ], [ 0, 0, 20, 20 ] ], [ [ 0, 12, 32, 60 ], [ 0, 0, 20, 20 ] ], [ [ 0, 13, 33, 60 ], [ 0, 0, 20, 20 ] ], [ [ 0, 14, 34, 60 ], [ 0, 0, 20, 20 ] ], [ [ 0, 15, 35, 60 ], [ 0, 0, 20, 20 ] ], [ [ 0, 16, 36, 60 ], [ 0, 0, 20, 20 ] ], [ [ 0, 17, 37, 60 ], [ 0, 0, 20, 20 ] ], [ [ 0, 18, 38, 60 ], [ 0, 0, 20, 20 ] ], [ [ 0, 19, 39, 60 ], [ 0, 0, 20, 20 ] ], [ [ 0, 20, 40, 60 ], [ 0, 0, 20, 20 ] ], [ [ 0, 21, 41, 60 ], [ 0, 0, 20, 20 ] ], [ [ 0, 22, 42, 60 ], [ 0, 0, 20, 20 ] ], [ [ 0, 23, 43, 60 ], [ 0, 0, 20, 20 ] ], [ [ 0, 24, 44, 60 ], [ 0, 0, 20, 20 ] ], [ [ 0, 25, 45, 60 ], [ 0, 0, 20, 20 ] ], [ [ 0, 26, 46, 60 ], [ 0, 0, 20, 20 ] ], [ [ 0, 27, 47, 60 ], [ 0, 0, 20, 20 ] ], [ [ 0, 28, 48, 60 ], [ 0, 0, 20, 20 ] ], [ [ 0, 29, 49, 60 ], [ 0, 0, 20, 20 ] ], [ [ 0, 30, 50, 60 ], [ 0, 0, 20, 20 ] ], [ [ 0, 31, 51, 60 ], [ 0, 0, 20, 20 ] ], [ [ 0, 32, 52, 60 ], [ 0, 0, 20, 20 ] ], [ [ 0, 33, 53, 60 ], [ 0, 0, 20, 20 ] ], [ [ 0, 34, 54, 60 ], [ 0, 0, 20, 20 ] ], [ [ 0, 35, 55, 60 ], [ 0, 0, 20, 20 ] ], [ [ 0, 36, 56, 60 ], [ 0, 0, 20, 20 ] ], [ [ 0, 37, 57, 60 ], [ 0, 0, 20, 20 ] ], [ [ 0, 38, 58, 60 ], [ 0, 0, 20, 20 ] ], [ [ 0, 39, 59, 60 ], [ 0, 0, 20, 20 ] ], [ [ 0, 40, 60 ], [ 0, 0, 20 ] ] ], "tuples": [ [ 0, 20, 20, 0, 0, 0, 20, 20 ] ], "tupleFields": [ "identical", "ambiguousColumns", "columns", "mismatches", "gapColumns", "gapOpens", "readAligned", "referenceCovered" ], "variation": { "readAligned": { "shared": true, "min": 20, "max": 20 }, "referenceCovered": { "shared": true, "min": 20, "max": 20 }, "identity": { "shared": true, "withheldIn": 41 }, "overhangStart": { "shared": true, "min": 0, "max": 0 }, "overhangEnd": { "shared": true, "min": 0, "max": 0 } }, "placements": [ { "refStart": 1, "refEnd": 20, "crossesOrigin": false, "wholeCircle": false, "readStart": 1, "readEnd": 20, "alignments": 1, "band": { "diagonalMin": 0, "diagonalMax": 0, "cellsNeeded": 62, "bandLimited": false } }, { "refStart": 2, "refEnd": 21, "crossesOrigin": false, "wholeCircle": false, "readStart": 1, "readEnd": 20, "alignments": 1, "band": { "diagonalMin": 1, "diagonalMax": 1, "cellsNeeded": 63, "bandLimited": false } }, { "refStart": 3, "refEnd": 22, "crossesOrigin": false, "wholeCircle": false, "readStart": 1, "readEnd": 20, "alignments": 1, "band": { "diagonalMin": 2, "diagonalMax": 2, "cellsNeeded": 63, "bandLimited": false } }, { "refStart": 4, "refEnd": 23, "crossesOrigin": false, "wholeCircle": false, "readStart": 1, "readEnd": 20, "alignments": 1, "band": { "diagonalMin": 3, "diagonalMax": 3, "cellsNeeded": 63, "bandLimited": false } }, { "refStart": 5, "refEnd": 24, "crossesOrigin": false, "wholeCircle": false, "readStart": 1, "readEnd": 20, "alignments": 1, "band": { "diagonalMin": 4, "diagonalMax": 4, "cellsNeeded": 63, "bandLimited": false } }, { "refStart": 6, "refEnd": 25, "crossesOrigin": false, "wholeCircle": false, "readStart": 1, "readEnd": 20, "alignments": 1, "band": { "diagonalMin": 5, "diagonalMax": 5, "cellsNeeded": 63, "bandLimited": false } }, { "refStart": 7, "refEnd": 26, "crossesOrigin": false, "wholeCircle": false, "readStart": 1, "readEnd": 20, "alignments": 1, "band": { "diagonalMin": 6, "diagonalMax": 6, "cellsNeeded": 63, "bandLimited": false } }, { "refStart": 8, "refEnd": 27, "crossesOrigin": false, "wholeCircle": false, "readStart": 1, "readEnd": 20, "alignments": 1, "band": { "diagonalMin": 7, "diagonalMax": 7, "cellsNeeded": 63, "bandLimited": false } }, { "refStart": 9, "refEnd": 28, "crossesOrigin": false, "wholeCircle": false, "readStart": 1, "readEnd": 20, "alignments": 1, "band": { "diagonalMin": 8, "diagonalMax": 8, "cellsNeeded": 63, "bandLimited": false } }, { "refStart": 10, "refEnd": 29, "crossesOrigin": false, "wholeCircle": false, "readStart": 1, "readEnd": 20, "alignments": 1, "band": { "diagonalMin": 9, "diagonalMax": 9, "cellsNeeded": 63, "bandLimited": false } }, { "refStart": 11, "refEnd": 30, "crossesOrigin": false, "wholeCircle": false, "readStart": 1, "readEnd": 20, "alignments": 1, "band": { "diagonalMin": 10, "diagonalMax": 10, "cellsNeeded": 63, "bandLimited": false } }, { "refStart": 12, "refEnd": 31, "crossesOrigin": false, "wholeCircle": false, "readStart": 1, "readEnd": 20, "alignments": 1, "band": { "diagonalMin": 11, "diagonalMax": 11, "cellsNeeded": 63, "bandLimited": false } }, { "refStart": 13, "refEnd": 32, "crossesOrigin": false, "wholeCircle": false, "readStart": 1, "readEnd": 20, "alignments": 1, "band": { "diagonalMin": 12, "diagonalMax": 12, "cellsNeeded": 63, "bandLimited": false } }, { "refStart": 14, "refEnd": 33, "crossesOrigin": false, "wholeCircle": false, "readStart": 1, "readEnd": 20, "alignments": 1, "band": { "diagonalMin": 13, "diagonalMax": 13, "cellsNeeded": 63, "bandLimited": false } }, { "refStart": 15, "refEnd": 34, "crossesOrigin": false, "wholeCircle": false, "readStart": 1, "readEnd": 20, "alignments": 1, "band": { "diagonalMin": 14, "diagonalMax": 14, "cellsNeeded": 63, "bandLimited": false } }, { "refStart": 16, "refEnd": 35, "crossesOrigin": false, "wholeCircle": false, "readStart": 1, "readEnd": 20, "alignments": 1, "band": { "diagonalMin": 15, "diagonalMax": 15, "cellsNeeded": 63, "bandLimited": false } }, { "refStart": 17, "refEnd": 36, "crossesOrigin": false, "wholeCircle": false, "readStart": 1, "readEnd": 20, "alignments": 1, "band": { "diagonalMin": 16, "diagonalMax": 16, "cellsNeeded": 63, "bandLimited": false } }, { "refStart": 18, "refEnd": 37, "crossesOrigin": false, "wholeCircle": false, "readStart": 1, "readEnd": 20, "alignments": 1, "band": { "diagonalMin": 17, "diagonalMax": 17, "cellsNeeded": 63, "bandLimited": false } }, { "refStart": 19, "refEnd": 38, "crossesOrigin": false, "wholeCircle": false, "readStart": 1, "readEnd": 20, "alignments": 1, "band": { "diagonalMin": 18, "diagonalMax": 18, "cellsNeeded": 63, "bandLimited": false } }, { "refStart": 20, "refEnd": 39, "crossesOrigin": false, "wholeCircle": false, "readStart": 1, "readEnd": 20, "alignments": 1, "band": { "diagonalMin": 19, "diagonalMax": 19, "cellsNeeded": 63, "bandLimited": false } }, { "refStart": 21, "refEnd": 40, "crossesOrigin": false, "wholeCircle": false, "readStart": 1, "readEnd": 20, "alignments": 1, "band": { "diagonalMin": 20, "diagonalMax": 20, "cellsNeeded": 63, "bandLimited": false } }, { "refStart": 22, "refEnd": 41, "crossesOrigin": false, "wholeCircle": false, "readStart": 1, "readEnd": 20, "alignments": 1, "band": { "diagonalMin": 21, "diagonalMax": 21, "cellsNeeded": 63, "bandLimited": false } }, { "refStart": 23, "refEnd": 42, "crossesOrigin": false, "wholeCircle": false, "readStart": 1, "readEnd": 20, "alignments": 1, "band": { "diagonalMin": 22, "diagonalMax": 22, "cellsNeeded": 63, "bandLimited": false } }, { "refStart": 24, "refEnd": 43, "crossesOrigin": false, "wholeCircle": false, "readStart": 1, "readEnd": 20, "alignments": 1, "band": { "diagonalMin": 23, "diagonalMax": 23, "cellsNeeded": 63, "bandLimited": false } }, { "refStart": 25, "refEnd": 44, "crossesOrigin": false, "wholeCircle": false, "readStart": 1, "readEnd": 20, "alignments": 1, "band": { "diagonalMin": 24, "diagonalMax": 24, "cellsNeeded": 63, "bandLimited": false } }, { "refStart": 26, "refEnd": 45, "crossesOrigin": false, "wholeCircle": false, "readStart": 1, "readEnd": 20, "alignments": 1, "band": { "diagonalMin": 25, "diagonalMax": 25, "cellsNeeded": 63, "bandLimited": false } }, { "refStart": 27, "refEnd": 46, "crossesOrigin": false, "wholeCircle": false, "readStart": 1, "readEnd": 20, "alignments": 1, "band": { "diagonalMin": 26, "diagonalMax": 26, "cellsNeeded": 63, "bandLimited": false } }, { "refStart": 28, "refEnd": 47, "crossesOrigin": false, "wholeCircle": false, "readStart": 1, "readEnd": 20, "alignments": 1, "band": { "diagonalMin": 27, "diagonalMax": 27, "cellsNeeded": 63, "bandLimited": false } }, { "refStart": 29, "refEnd": 48, "crossesOrigin": false, "wholeCircle": false, "readStart": 1, "readEnd": 20, "alignments": 1, "band": { "diagonalMin": 28, "diagonalMax": 28, "cellsNeeded": 63, "bandLimited": false } }, { "refStart": 30, "refEnd": 49, "crossesOrigin": false, "wholeCircle": false, "readStart": 1, "readEnd": 20, "alignments": 1, "band": { "diagonalMin": 29, "diagonalMax": 29, "cellsNeeded": 63, "bandLimited": false } }, { "refStart": 31, "refEnd": 50, "crossesOrigin": false, "wholeCircle": false, "readStart": 1, "readEnd": 20, "alignments": 1, "band": { "diagonalMin": 30, "diagonalMax": 30, "cellsNeeded": 63, "bandLimited": false } }, { "refStart": 32, "refEnd": 51, "crossesOrigin": false, "wholeCircle": false, "readStart": 1, "readEnd": 20, "alignments": 1, "band": { "diagonalMin": 31, "diagonalMax": 31, "cellsNeeded": 63, "bandLimited": false } }, { "refStart": 33, "refEnd": 52, "crossesOrigin": false, "wholeCircle": false, "readStart": 1, "readEnd": 20, "alignments": 1, "band": { "diagonalMin": 32, "diagonalMax": 32, "cellsNeeded": 63, "bandLimited": false } }, { "refStart": 34, "refEnd": 53, "crossesOrigin": false, "wholeCircle": false, "readStart": 1, "readEnd": 20, "alignments": 1, "band": { "diagonalMin": 33, "diagonalMax": 33, "cellsNeeded": 63, "bandLimited": false } }, { "refStart": 35, "refEnd": 54, "crossesOrigin": false, "wholeCircle": false, "readStart": 1, "readEnd": 20, "alignments": 1, "band": { "diagonalMin": 34, "diagonalMax": 34, "cellsNeeded": 63, "bandLimited": false } }, { "refStart": 36, "refEnd": 55, "crossesOrigin": false, "wholeCircle": false, "readStart": 1, "readEnd": 20, "alignments": 1, "band": { "diagonalMin": 35, "diagonalMax": 35, "cellsNeeded": 63, "bandLimited": false } }, { "refStart": 37, "refEnd": 56, "crossesOrigin": false, "wholeCircle": false, "readStart": 1, "readEnd": 20, "alignments": 1, "band": { "diagonalMin": 36, "diagonalMax": 36, "cellsNeeded": 63, "bandLimited": false } }, { "refStart": 38, "refEnd": 57, "crossesOrigin": false, "wholeCircle": false, "readStart": 1, "readEnd": 20, "alignments": 1, "band": { "diagonalMin": 37, "diagonalMax": 37, "cellsNeeded": 63, "bandLimited": false } }, { "refStart": 39, "refEnd": 58, "crossesOrigin": false, "wholeCircle": false, "readStart": 1, "readEnd": 20, "alignments": 1, "band": { "diagonalMin": 38, "diagonalMax": 38, "cellsNeeded": 63, "bandLimited": false } }, { "refStart": 40, "refEnd": 59, "crossesOrigin": false, "wholeCircle": false, "readStart": 1, "readEnd": 20, "alignments": 1, "band": { "diagonalMin": 39, "diagonalMax": 39, "cellsNeeded": 63, "bandLimited": false } }, { "refStart": 41, "refEnd": 60, "crossesOrigin": false, "wholeCircle": false, "readStart": 1, "readEnd": 20, "alignments": 1, "band": { "diagonalMin": 40, "diagonalMax": 40, "cellsNeeded": 62, "bandLimited": false } } ] }, "minus": { "score": 0, "count": 41, "overCap": false, "state": "aligned", "biopython": { "score": 0, "count": 41 }, "uniquePairs": [], "uniquePlacement": false, "placementNotDetermined": false, "noCommonColumn": false, "hull": { "refStart": 1, "refEnd": 60, "crossesOrigin": false, "wholeCircle": false }, "selected": { "coordinates": [ [ 0, 20, 60 ], [ 0, 20, 20 ] ], "gappedReference": "GACACCATCGAATGGCGCAA", "gappedRead": "NNNNNNNNNNNNNNNNNNNN", "columns": 20, "identical": 0, "mismatches": 0, "ambiguousColumns": 20, "gapColumns": 0, "gapOpens": 0, "identity": null, "readAligned": { "bases": 20, "of": 20 }, "referenceCovered": { "bases": 20, "of": 60 }, "identityWithheld": "no-determinable-column", "placement": { "refStart": 1, "refEnd": 20, "readStart": 1, "readEnd": 20, "crossesOrigin": false, "asSupplied": { "readStart": 1, "readEnd": 20 } }, "overhang": [], "differences": [ { "kind": "ambiguous", "ref": 1, "refBase": "G", "readBase": "N", "read": 1, "lettersCanAgree": true, "common": false, "notFixed": { "from": null, "to": null }, "asSupplied": { "read": 20, "readBase": "N" } }, { "kind": "ambiguous", "ref": 2, "refBase": "A", "readBase": "N", "read": 2, "lettersCanAgree": true, "common": false, "notFixed": { "from": null, "to": null }, "asSupplied": { "read": 19, "readBase": "N" } }, { "kind": "ambiguous", "ref": 3, "refBase": "C", "readBase": "N", "read": 3, "lettersCanAgree": true, "common": false, "notFixed": { "from": null, "to": null }, "asSupplied": { "read": 18, "readBase": "N" } }, { "kind": "ambiguous", "ref": 4, "refBase": "A", "readBase": "N", "read": 4, "lettersCanAgree": true, "common": false, "notFixed": { "from": null, "to": null }, "asSupplied": { "read": 17, "readBase": "N" } }, { "kind": "ambiguous", "ref": 5, "refBase": "C", "readBase": "N", "read": 5, "lettersCanAgree": true, "common": false, "notFixed": { "from": null, "to": null }, "asSupplied": { "read": 16, "readBase": "N" } }, { "kind": "ambiguous", "ref": 6, "refBase": "C", "readBase": "N", "read": 6, "lettersCanAgree": true, "common": false, "notFixed": { "from": null, "to": null }, "asSupplied": { "read": 15, "readBase": "N" } }, { "kind": "ambiguous", "ref": 7, "refBase": "A", "readBase": "N", "read": 7, "lettersCanAgree": true, "common": false, "notFixed": { "from": null, "to": null }, "asSupplied": { "read": 14, "readBase": "N" } }, { "kind": "ambiguous", "ref": 8, "refBase": "T", "readBase": "N", "read": 8, "lettersCanAgree": true, "common": false, "notFixed": { "from": null, "to": null }, "asSupplied": { "read": 13, "readBase": "N" } }, { "kind": "ambiguous", "ref": 9, "refBase": "C", "readBase": "N", "read": 9, "lettersCanAgree": true, "common": false, "notFixed": { "from": null, "to": null }, "asSupplied": { "read": 12, "readBase": "N" } }, { "kind": "ambiguous", "ref": 10, "refBase": "G", "readBase": "N", "read": 10, "lettersCanAgree": true, "common": false, "notFixed": { "from": null, "to": null }, "asSupplied": { "read": 11, "readBase": "N" } }, { "kind": "ambiguous", "ref": 11, "refBase": "A", "readBase": "N", "read": 11, "lettersCanAgree": true, "common": false, "notFixed": { "from": null, "to": null }, "asSupplied": { "read": 10, "readBase": "N" } }, { "kind": "ambiguous", "ref": 12, "refBase": "A", "readBase": "N", "read": 12, "lettersCanAgree": true, "common": false, "notFixed": { "from": null, "to": null }, "asSupplied": { "read": 9, "readBase": "N" } }, { "kind": "ambiguous", "ref": 13, "refBase": "T", "readBase": "N", "read": 13, "lettersCanAgree": true, "common": false, "notFixed": { "from": null, "to": null }, "asSupplied": { "read": 8, "readBase": "N" } }, { "kind": "ambiguous", "ref": 14, "refBase": "G", "readBase": "N", "read": 14, "lettersCanAgree": true, "common": false, "notFixed": { "from": null, "to": null }, "asSupplied": { "read": 7, "readBase": "N" } }, { "kind": "ambiguous", "ref": 15, "refBase": "G", "readBase": "N", "read": 15, "lettersCanAgree": true, "common": false, "notFixed": { "from": null, "to": null }, "asSupplied": { "read": 6, "readBase": "N" } }, { "kind": "ambiguous", "ref": 16, "refBase": "C", "readBase": "N", "read": 16, "lettersCanAgree": true, "common": false, "notFixed": { "from": null, "to": null }, "asSupplied": { "read": 5, "readBase": "N" } }, { "kind": "ambiguous", "ref": 17, "refBase": "G", "readBase": "N", "read": 17, "lettersCanAgree": true, "common": false, "notFixed": { "from": null, "to": null }, "asSupplied": { "read": 4, "readBase": "N" } }, { "kind": "ambiguous", "ref": 18, "refBase": "C", "readBase": "N", "read": 18, "lettersCanAgree": true, "common": false, "notFixed": { "from": null, "to": null }, "asSupplied": { "read": 3, "readBase": "N" } }, { "kind": "ambiguous", "ref": 19, "refBase": "A", "readBase": "N", "read": 19, "lettersCanAgree": true, "common": false, "notFixed": { "from": null, "to": null }, "asSupplied": { "read": 2, "readBase": "N" } }, { "kind": "ambiguous", "ref": 20, "refBase": "A", "readBase": "N", "read": 20, "lettersCanAgree": true, "common": false, "notFixed": { "from": null, "to": null }, "asSupplied": { "read": 1, "readBase": "N" } } ] }, "band": { "diagonalMin": 0, "diagonalMax": 40, "cellsNeeded": 901, "unionBandLimited": false, "scope": "every optimal path", "gridCells": 1281, "searchedBanded": false, "sharedWords": 0, "sharedWordsOverCap": false, "seedGuarantee": { "differencesUpTo": 20, "guaranteed": false } }, "enumeration": "listed", "alignments": [ [ [ 0, 20, 60 ], [ 0, 20, 20 ] ], [ [ 0, 1, 21, 60 ], [ 0, 0, 20, 20 ] ], [ [ 0, 2, 22, 60 ], [ 0, 0, 20, 20 ] ], [ [ 0, 3, 23, 60 ], [ 0, 0, 20, 20 ] ], [ [ 0, 4, 24, 60 ], [ 0, 0, 20, 20 ] ], [ [ 0, 5, 25, 60 ], [ 0, 0, 20, 20 ] ], [ [ 0, 6, 26, 60 ], [ 0, 0, 20, 20 ] ], [ [ 0, 7, 27, 60 ], [ 0, 0, 20, 20 ] ], [ [ 0, 8, 28, 60 ], [ 0, 0, 20, 20 ] ], [ [ 0, 9, 29, 60 ], [ 0, 0, 20, 20 ] ], [ [ 0, 10, 30, 60 ], [ 0, 0, 20, 20 ] ], [ [ 0, 11, 31, 60 ], [ 0, 0, 20, 20 ] ], [ [ 0, 12, 32, 60 ], [ 0, 0, 20, 20 ] ], [ [ 0, 13, 33, 60 ], [ 0, 0, 20, 20 ] ], [ [ 0, 14, 34, 60 ], [ 0, 0, 20, 20 ] ], [ [ 0, 15, 35, 60 ], [ 0, 0, 20, 20 ] ], [ [ 0, 16, 36, 60 ], [ 0, 0, 20, 20 ] ], [ [ 0, 17, 37, 60 ], [ 0, 0, 20, 20 ] ], [ [ 0, 18, 38, 60 ], [ 0, 0, 20, 20 ] ], [ [ 0, 19, 39, 60 ], [ 0, 0, 20, 20 ] ], [ [ 0, 20, 40, 60 ], [ 0, 0, 20, 20 ] ], [ [ 0, 21, 41, 60 ], [ 0, 0, 20, 20 ] ], [ [ 0, 22, 42, 60 ], [ 0, 0, 20, 20 ] ], [ [ 0, 23, 43, 60 ], [ 0, 0, 20, 20 ] ], [ [ 0, 24, 44, 60 ], [ 0, 0, 20, 20 ] ], [ [ 0, 25, 45, 60 ], [ 0, 0, 20, 20 ] ], [ [ 0, 26, 46, 60 ], [ 0, 0, 20, 20 ] ], [ [ 0, 27, 47, 60 ], [ 0, 0, 20, 20 ] ], [ [ 0, 28, 48, 60 ], [ 0, 0, 20, 20 ] ], [ [ 0, 29, 49, 60 ], [ 0, 0, 20, 20 ] ], [ [ 0, 30, 50, 60 ], [ 0, 0, 20, 20 ] ], [ [ 0, 31, 51, 60 ], [ 0, 0, 20, 20 ] ], [ [ 0, 32, 52, 60 ], [ 0, 0, 20, 20 ] ], [ [ 0, 33, 53, 60 ], [ 0, 0, 20, 20 ] ], [ [ 0, 34, 54, 60 ], [ 0, 0, 20, 20 ] ], [ [ 0, 35, 55, 60 ], [ 0, 0, 20, 20 ] ], [ [ 0, 36, 56, 60 ], [ 0, 0, 20, 20 ] ], [ [ 0, 37, 57, 60 ], [ 0, 0, 20, 20 ] ], [ [ 0, 38, 58, 60 ], [ 0, 0, 20, 20 ] ], [ [ 0, 39, 59, 60 ], [ 0, 0, 20, 20 ] ], [ [ 0, 40, 60 ], [ 0, 0, 20 ] ] ], "tuples": [ [ 0, 20, 20, 0, 0, 0, 20, 20 ] ], "tupleFields": [ "identical", "ambiguousColumns", "columns", "mismatches", "gapColumns", "gapOpens", "readAligned", "referenceCovered" ], "variation": { "readAligned": { "shared": true, "min": 20, "max": 20 }, "referenceCovered": { "shared": true, "min": 20, "max": 20 }, "identity": { "shared": true, "withheldIn": 41 }, "overhangStart": { "shared": true, "min": 0, "max": 0 }, "overhangEnd": { "shared": true, "min": 0, "max": 0 } }, "placements": [ { "refStart": 1, "refEnd": 20, "crossesOrigin": false, "wholeCircle": false, "readStart": 1, "readEnd": 20, "asSupplied": { "readStart": 1, "readEnd": 20 }, "alignments": 1, "band": { "diagonalMin": 0, "diagonalMax": 0, "cellsNeeded": 62, "bandLimited": false } }, { "refStart": 2, "refEnd": 21, "crossesOrigin": false, "wholeCircle": false, "readStart": 1, "readEnd": 20, "asSupplied": { "readStart": 1, "readEnd": 20 }, "alignments": 1, "band": { "diagonalMin": 1, "diagonalMax": 1, "cellsNeeded": 63, "bandLimited": false } }, { "refStart": 3, "refEnd": 22, "crossesOrigin": false, "wholeCircle": false, "readStart": 1, "readEnd": 20, "asSupplied": { "readStart": 1, "readEnd": 20 }, "alignments": 1, "band": { "diagonalMin": 2, "diagonalMax": 2, "cellsNeeded": 63, "bandLimited": false } }, { "refStart": 4, "refEnd": 23, "crossesOrigin": false, "wholeCircle": false, "readStart": 1, "readEnd": 20, "asSupplied": { "readStart": 1, "readEnd": 20 }, "alignments": 1, "band": { "diagonalMin": 3, "diagonalMax": 3, "cellsNeeded": 63, "bandLimited": false } }, { "refStart": 5, "refEnd": 24, "crossesOrigin": false, "wholeCircle": false, "readStart": 1, "readEnd": 20, "asSupplied": { "readStart": 1, "readEnd": 20 }, "alignments": 1, "band": { "diagonalMin": 4, "diagonalMax": 4, "cellsNeeded": 63, "bandLimited": false } }, { "refStart": 6, "refEnd": 25, "crossesOrigin": false, "wholeCircle": false, "readStart": 1, "readEnd": 20, "asSupplied": { "readStart": 1, "readEnd": 20 }, "alignments": 1, "band": { "diagonalMin": 5, "diagonalMax": 5, "cellsNeeded": 63, "bandLimited": false } }, { "refStart": 7, "refEnd": 26, "crossesOrigin": false, "wholeCircle": false, "readStart": 1, "readEnd": 20, "asSupplied": { "readStart": 1, "readEnd": 20 }, "alignments": 1, "band": { "diagonalMin": 6, "diagonalMax": 6, "cellsNeeded": 63, "bandLimited": false } }, { "refStart": 8, "refEnd": 27, "crossesOrigin": false, "wholeCircle": false, "readStart": 1, "readEnd": 20, "asSupplied": { "readStart": 1, "readEnd": 20 }, "alignments": 1, "band": { "diagonalMin": 7, "diagonalMax": 7, "cellsNeeded": 63, "bandLimited": false } }, { "refStart": 9, "refEnd": 28, "crossesOrigin": false, "wholeCircle": false, "readStart": 1, "readEnd": 20, "asSupplied": { "readStart": 1, "readEnd": 20 }, "alignments": 1, "band": { "diagonalMin": 8, "diagonalMax": 8, "cellsNeeded": 63, "bandLimited": false } }, { "refStart": 10, "refEnd": 29, "crossesOrigin": false, "wholeCircle": false, "readStart": 1, "readEnd": 20, "asSupplied": { "readStart": 1, "readEnd": 20 }, "alignments": 1, "band": { "diagonalMin": 9, "diagonalMax": 9, "cellsNeeded": 63, "bandLimited": false } }, { "refStart": 11, "refEnd": 30, "crossesOrigin": false, "wholeCircle": false, "readStart": 1, "readEnd": 20, "asSupplied": { "readStart": 1, "readEnd": 20 }, "alignments": 1, "band": { "diagonalMin": 10, "diagonalMax": 10, "cellsNeeded": 63, "bandLimited": false } }, { "refStart": 12, "refEnd": 31, "crossesOrigin": false, "wholeCircle": false, "readStart": 1, "readEnd": 20, "asSupplied": { "readStart": 1, "readEnd": 20 }, "alignments": 1, "band": { "diagonalMin": 11, "diagonalMax": 11, "cellsNeeded": 63, "bandLimited": false } }, { "refStart": 13, "refEnd": 32, "crossesOrigin": false, "wholeCircle": false, "readStart": 1, "readEnd": 20, "asSupplied": { "readStart": 1, "readEnd": 20 }, "alignments": 1, "band": { "diagonalMin": 12, "diagonalMax": 12, "cellsNeeded": 63, "bandLimited": false } }, { "refStart": 14, "refEnd": 33, "crossesOrigin": false, "wholeCircle": false, "readStart": 1, "readEnd": 20, "asSupplied": { "readStart": 1, "readEnd": 20 }, "alignments": 1, "band": { "diagonalMin": 13, "diagonalMax": 13, "cellsNeeded": 63, "bandLimited": false } }, { "refStart": 15, "refEnd": 34, "crossesOrigin": false, "wholeCircle": false, "readStart": 1, "readEnd": 20, "asSupplied": { "readStart": 1, "readEnd": 20 }, "alignments": 1, "band": { "diagonalMin": 14, "diagonalMax": 14, "cellsNeeded": 63, "bandLimited": false } }, { "refStart": 16, "refEnd": 35, "crossesOrigin": false, "wholeCircle": false, "readStart": 1, "readEnd": 20, "asSupplied": { "readStart": 1, "readEnd": 20 }, "alignments": 1, "band": { "diagonalMin": 15, "diagonalMax": 15, "cellsNeeded": 63, "bandLimited": false } }, { "refStart": 17, "refEnd": 36, "crossesOrigin": false, "wholeCircle": false, "readStart": 1, "readEnd": 20, "asSupplied": { "readStart": 1, "readEnd": 20 }, "alignments": 1, "band": { "diagonalMin": 16, "diagonalMax": 16, "cellsNeeded": 63, "bandLimited": false } }, { "refStart": 18, "refEnd": 37, "crossesOrigin": false, "wholeCircle": false, "readStart": 1, "readEnd": 20, "asSupplied": { "readStart": 1, "readEnd": 20 }, "alignments": 1, "band": { "diagonalMin": 17, "diagonalMax": 17, "cellsNeeded": 63, "bandLimited": false } }, { "refStart": 19, "refEnd": 38, "crossesOrigin": false, "wholeCircle": false, "readStart": 1, "readEnd": 20, "asSupplied": { "readStart": 1, "readEnd": 20 }, "alignments": 1, "band": { "diagonalMin": 18, "diagonalMax": 18, "cellsNeeded": 63, "bandLimited": false } }, { "refStart": 20, "refEnd": 39, "crossesOrigin": false, "wholeCircle": false, "readStart": 1, "readEnd": 20, "asSupplied": { "readStart": 1, "readEnd": 20 }, "alignments": 1, "band": { "diagonalMin": 19, "diagonalMax": 19, "cellsNeeded": 63, "bandLimited": false } }, { "refStart": 21, "refEnd": 40, "crossesOrigin": false, "wholeCircle": false, "readStart": 1, "readEnd": 20, "asSupplied": { "readStart": 1, "readEnd": 20 }, "alignments": 1, "band": { "diagonalMin": 20, "diagonalMax": 20, "cellsNeeded": 63, "bandLimited": false } }, { "refStart": 22, "refEnd": 41, "crossesOrigin": false, "wholeCircle": false, "readStart": 1, "readEnd": 20, "asSupplied": { "readStart": 1, "readEnd": 20 }, "alignments": 1, "band": { "diagonalMin": 21, "diagonalMax": 21, "cellsNeeded": 63, "bandLimited": false } }, { "refStart": 23, "refEnd": 42, "crossesOrigin": false, "wholeCircle": false, "readStart": 1, "readEnd": 20, "asSupplied": { "readStart": 1, "readEnd": 20 }, "alignments": 1, "band": { "diagonalMin": 22, "diagonalMax": 22, "cellsNeeded": 63, "bandLimited": false } }, { "refStart": 24, "refEnd": 43, "crossesOrigin": false, "wholeCircle": false, "readStart": 1, "readEnd": 20, "asSupplied": { "readStart": 1, "readEnd": 20 }, "alignments": 1, "band": { "diagonalMin": 23, "diagonalMax": 23, "cellsNeeded": 63, "bandLimited": false } }, { "refStart": 25, "refEnd": 44, "crossesOrigin": false, "wholeCircle": false, "readStart": 1, "readEnd": 20, "asSupplied": { "readStart": 1, "readEnd": 20 }, "alignments": 1, "band": { "diagonalMin": 24, "diagonalMax": 24, "cellsNeeded": 63, "bandLimited": false } }, { "refStart": 26, "refEnd": 45, "crossesOrigin": false, "wholeCircle": false, "readStart": 1, "readEnd": 20, "asSupplied": { "readStart": 1, "readEnd": 20 }, "alignments": 1, "band": { "diagonalMin": 25, "diagonalMax": 25, "cellsNeeded": 63, "bandLimited": false } }, { "refStart": 27, "refEnd": 46, "crossesOrigin": false, "wholeCircle": false, "readStart": 1, "readEnd": 20, "asSupplied": { "readStart": 1, "readEnd": 20 }, "alignments": 1, "band": { "diagonalMin": 26, "diagonalMax": 26, "cellsNeeded": 63, "bandLimited": false } }, { "refStart": 28, "refEnd": 47, "crossesOrigin": false, "wholeCircle": false, "readStart": 1, "readEnd": 20, "asSupplied": { "readStart": 1, "readEnd": 20 }, "alignments": 1, "band": { "diagonalMin": 27, "diagonalMax": 27, "cellsNeeded": 63, "bandLimited": false } }, { "refStart": 29, "refEnd": 48, "crossesOrigin": false, "wholeCircle": false, "readStart": 1, "readEnd": 20, "asSupplied": { "readStart": 1, "readEnd": 20 }, "alignments": 1, "band": { "diagonalMin": 28, "diagonalMax": 28, "cellsNeeded": 63, "bandLimited": false } }, { "refStart": 30, "refEnd": 49, "crossesOrigin": false, "wholeCircle": false, "readStart": 1, "readEnd": 20, "asSupplied": { "readStart": 1, "readEnd": 20 }, "alignments": 1, "band": { "diagonalMin": 29, "diagonalMax": 29, "cellsNeeded": 63, "bandLimited": false } }, { "refStart": 31, "refEnd": 50, "crossesOrigin": false, "wholeCircle": false, "readStart": 1, "readEnd": 20, "asSupplied": { "readStart": 1, "readEnd": 20 }, "alignments": 1, "band": { "diagonalMin": 30, "diagonalMax": 30, "cellsNeeded": 63, "bandLimited": false } }, { "refStart": 32, "refEnd": 51, "crossesOrigin": false, "wholeCircle": false, "readStart": 1, "readEnd": 20, "asSupplied": { "readStart": 1, "readEnd": 20 }, "alignments": 1, "band": { "diagonalMin": 31, "diagonalMax": 31, "cellsNeeded": 63, "bandLimited": false } }, { "refStart": 33, "refEnd": 52, "crossesOrigin": false, "wholeCircle": false, "readStart": 1, "readEnd": 20, "asSupplied": { "readStart": 1, "readEnd": 20 }, "alignments": 1, "band": { "diagonalMin": 32, "diagonalMax": 32, "cellsNeeded": 63, "bandLimited": false } }, { "refStart": 34, "refEnd": 53, "crossesOrigin": false, "wholeCircle": false, "readStart": 1, "readEnd": 20, "asSupplied": { "readStart": 1, "readEnd": 20 }, "alignments": 1, "band": { "diagonalMin": 33, "diagonalMax": 33, "cellsNeeded": 63, "bandLimited": false } }, { "refStart": 35, "refEnd": 54, "crossesOrigin": false, "wholeCircle": false, "readStart": 1, "readEnd": 20, "asSupplied": { "readStart": 1, "readEnd": 20 }, "alignments": 1, "band": { "diagonalMin": 34, "diagonalMax": 34, "cellsNeeded": 63, "bandLimited": false } }, { "refStart": 36, "refEnd": 55, "crossesOrigin": false, "wholeCircle": false, "readStart": 1, "readEnd": 20, "asSupplied": { "readStart": 1, "readEnd": 20 }, "alignments": 1, "band": { "diagonalMin": 35, "diagonalMax": 35, "cellsNeeded": 63, "bandLimited": false } }, { "refStart": 37, "refEnd": 56, "crossesOrigin": false, "wholeCircle": false, "readStart": 1, "readEnd": 20, "asSupplied": { "readStart": 1, "readEnd": 20 }, "alignments": 1, "band": { "diagonalMin": 36, "diagonalMax": 36, "cellsNeeded": 63, "bandLimited": false } }, { "refStart": 38, "refEnd": 57, "crossesOrigin": false, "wholeCircle": false, "readStart": 1, "readEnd": 20, "asSupplied": { "readStart": 1, "readEnd": 20 }, "alignments": 1, "band": { "diagonalMin": 37, "diagonalMax": 37, "cellsNeeded": 63, "bandLimited": false } }, { "refStart": 39, "refEnd": 58, "crossesOrigin": false, "wholeCircle": false, "readStart": 1, "readEnd": 20, "asSupplied": { "readStart": 1, "readEnd": 20 }, "alignments": 1, "band": { "diagonalMin": 38, "diagonalMax": 38, "cellsNeeded": 63, "bandLimited": false } }, { "refStart": 40, "refEnd": 59, "crossesOrigin": false, "wholeCircle": false, "readStart": 1, "readEnd": 20, "asSupplied": { "readStart": 1, "readEnd": 20 }, "alignments": 1, "band": { "diagonalMin": 39, "diagonalMax": 39, "cellsNeeded": 63, "bandLimited": false } }, { "refStart": 41, "refEnd": 60, "crossesOrigin": false, "wholeCircle": false, "readStart": 1, "readEnd": 20, "asSupplied": { "readStart": 1, "readEnd": 20 }, "alignments": 1, "band": { "diagonalMin": 40, "diagonalMax": 40, "cellsNeeded": 62, "bandLimited": false } } ] } }, { "mode": "local", "region": null, "strand": "none", "strandUndetermined": false, "plus": { "score": 0, "count": 0, "overCap": false, "state": "no-alignment", "biopython": { "score": 0, "count": 0 } }, "minus": { "score": 0, "count": 0, "overCap": false, "state": "no-alignment", "biopython": { "score": 0, "count": 0 } } } ] } }, { "id": "distant-placements", "note": "7g: a 30-base read present twice, more than 1,000 bases apart, on a grid over the test budget: two narrow bands, not one band-limited one.", "input": { "reference": { "residues": "GACACCATCGAATGGCGCAAAACCTTTCGCGGTATGGCATGATAGCGCCCGGAAGAGAGTCAATTCAGGGTGGTGAATGTGAAACCAGTAACGTTATACGATGTCGCAGAGTATGCCGGTGTCTCTTATCAGACCGTTTCCCGCGTGGTGAACCAGGCCAGCCACGTTTCTGCGAAAACGCGGGAAAAAGTGGAAGCGGCGATGGCGGAGCTGAATTACATTCCCAACCGCGTGGCACAACAACTGGCGGGCAAACAGTCGTTGCTGATTGGCGTTGCCACCTCCAGTCTGGCCCTGCACGCGCCGTCGCAAATTGTCGCGGCGATTAAATCTCGCGCCGATCAACTGGGTGCCAGCGTGGTGGTGTCGATGGTAGAACGAAGCGGCGTCGAAGCCTGTAAAGCGGCGGTGCACAATCTTCTCGCGCAACGCGTCAGTGGGCTGATCATTAACTATCCGCTGGATGACCAGGATGCCATTGCTGTGGAAGCTGCCTGCACTAATGTTCCGGCGTTATTTCTTGATGTCTCTGACCAGACACCCATCAACAGTATTATTTTCTCCCATGAAGACGGTACGCGACTGGGCGTGGAGCATCTGGTCGCATTGGGTCACCAGCAAATCGCGCTGTTAGCGGGCCCATTAAGTTCTGTCTCGGCGCGTCTGCGTCTGGCTGGCTGGCATAAATATCTCACTCGCAATCAAATTCAGCCGATAGCGGAACGGGAAGGCGACTGGAGTGCCATGTCCGGTTTTCAACAAACCATGCAAATGCTGAATGAGGGCATCGTTCCCACTGCGATGCTGGTTGCCAACGATCAGATGGCGCTGGGCGCAATGCGCGCCATTACCGAGTCCGGGCTGCGCGTTGGTGCGGATATCTCGGTAGTGGGATACGACGATACCGAAGACAGCTCATGTTATATCCCGCCGTCAACCACCATCAAACAGGATTTTCGCCTGCTGGGGCAAACCAGCGTGGACCGCTTGCTGCAACTCTCTCAGGGCCAGGCGGTGAAGGGCAATCAGCTGTTGCCCGTCTCACTGGTGAAAAGAAAAACCACCCTGGCGCCCAATACGCAAACCGCCTCTCCCCGCGCGTTGGCCGATTCATTAATGCAGCTGGCACGACAGGTTTCCCGACTGGAAAGCGGGCAGTGAGCGCAACGCAATTAATGTGAGTTAGCTCACTCATTAGGCATGTCGCAGAGTATGCCGGTGTCTCTTATCACCCCAGGCTTTACACTTTATGCTTCCGGCTCGTATGTTGTGTGGAATTGTGAGCGGATAACAATTTCACACAGGAAACAGCTATGACCATGATTACGGATTCACTGGCCGTCGTTTTACAACGTCGTGACTGGGAAAACCCTGGCGTTACCCAACTTAATCGCCTTGCAGCACATCCCCCTTTCGCCAGCTGGCGTAATAGCGAAGAGGCCCGCACCGATCGCCCTTCCCAACAGTTGCGCAGCCTGAATGGCGAATGGCGCTTTGCCTGGTTTCCGGCACCAGAAGCGGTGCCGGAAA", "topology": "linear", "source": "J01636.1 1-1200, 101-130, 1201-1500" }, "read": { "residues": "ATGTCGCAGAGTATGCCGGTGTCTCTTATC", "source": "J01636.1 101-130" }, "modes": [ "semiglobal-read", "local" ] }, "expected": { "results": [ { "mode": "semiglobal-read", "region": null, "strand": "+", "strandUndetermined": false, "plus": { "score": 60, "count": 2, "overCap": false, "state": "aligned", "biopython": { "score": 60, "count": 2 }, "uniquePairs": [], "uniquePlacement": false, "placementNotDetermined": false, "noCommonColumn": false, "hull": { "refStart": 101, "refEnd": 1230, "crossesOrigin": false, "wholeCircle": false }, "selected": { "coordinates": [ [ 0, 100, 130, 1530 ], [ 0, 0, 30, 30 ] ], "gappedReference": "ATGTCGCAGAGTATGCCGGTGTCTCTTATC", "gappedRead": "ATGTCGCAGAGTATGCCGGTGTCTCTTATC", "columns": 30, "identical": 30, "mismatches": 0, "ambiguousColumns": 0, "gapColumns": 0, "gapOpens": 0, "identity": { "numerator": 30, "denominator": 30 }, "readAligned": { "bases": 30, "of": 30 }, "referenceCovered": { "bases": 30, "of": 1530 }, "placement": { "refStart": 101, "refEnd": 130, "readStart": 1, "readEnd": 30, "crossesOrigin": false }, "overhang": [], "differences": [] }, "band": { "diagonalMin": 100, "diagonalMax": 1200, "cellsNeeded": 34193, "unionBandLimited": true, "scope": "every optimal path", "gridCells": 47461, "searchedBanded": true, "sharedWords": 38, "sharedWordsOverCap": false, "seedGuarantee": { "differencesUpTo": 0, "guaranteed": true } }, "enumeration": "listed", "alignments": [ [ [ 0, 100, 130, 1530 ], [ 0, 0, 30, 30 ] ], [ [ 0, 1200, 1230, 1530 ], [ 0, 0, 30, 30 ] ] ], "tuples": [ [ 30, 0, 30, 0, 0, 0, 30, 30 ] ], "tupleFields": [ "identical", "ambiguousColumns", "columns", "mismatches", "gapColumns", "gapOpens", "readAligned", "referenceCovered" ], "variation": { "readAligned": { "shared": true, "min": 30, "max": 30 }, "referenceCovered": { "shared": true, "min": 30, "max": 30 }, "identity": { "shared": true, "min": { "numerator": 1, "denominator": 1 }, "max": { "numerator": 1, "denominator": 1 } }, "overhangStart": { "shared": true, "min": 0, "max": 0 }, "overhangEnd": { "shared": true, "min": 0, "max": 0 } }, "placements": [ { "refStart": 101, "refEnd": 130, "crossesOrigin": false, "wholeCircle": false, "readStart": 1, "readEnd": 30, "alignments": 1, "band": { "diagonalMin": 100, "diagonalMax": 100, "cellsNeeded": 93, "bandLimited": false } }, { "refStart": 1201, "refEnd": 1230, "crossesOrigin": false, "wholeCircle": false, "readStart": 1, "readEnd": 30, "alignments": 1, "band": { "diagonalMin": 1200, "diagonalMax": 1200, "cellsNeeded": 93, "bandLimited": false } } ] }, "minus": { "score": 1, "count": 3, "overCap": false, "state": "aligned", "biopython": { "score": 1, "count": 3 }, "uniquePairs": [ [ 893, 1 ], [ 894, 2 ], [ 895, 3 ], [ 896, 4 ], [ 897, 5 ], [ 898, 6 ], [ 899, 7 ], [ 901, 8 ], [ 902, 9 ], [ 903, 10 ], [ 904, 11 ], [ 905, 12 ], [ 906, 13 ], [ 907, 14 ], [ 910, 15 ], [ 915, 20 ], [ 916, 21 ], [ 917, 22 ], [ 919, 23 ], [ 920, 24 ], [ 921, 25 ], [ 922, 26 ], [ 923, 27 ], [ 924, 28 ], [ 925, 29 ], [ 926, 30 ] ], "uniquePlacement": true, "placementNotDetermined": false, "noCommonColumn": false, "hull": { "refStart": 893, "refEnd": 926, "crossesOrigin": false, "wholeCircle": false }, "selected": { "coordinates": [ [ 0, 892, 899, 900, 907, 909, 910, 911, 913, 913, 917, 918, 926, 1530 ], [ 0, 0, 7, 7, 14, 14, 15, 15, 17, 18, 22, 22, 30, 30 ] ], "gappedReference": "GATACGACGATACCGAAGACA-GCTCATGTTATAT", "gappedRead": "GATAAGA-GACACCG--G-CATACTC-TGCGACAT", "columns": 35, "identical": 23, "mismatches": 6, "ambiguousColumns": 0, "gapColumns": 6, "gapOpens": 5, "identity": { "numerator": 23, "denominator": 35 }, "readAligned": { "bases": 30, "of": 30 }, "referenceCovered": { "bases": 34, "of": 1530 }, "placement": { "refStart": 893, "refEnd": 926, "readStart": 1, "readEnd": 30, "crossesOrigin": false, "asSupplied": { "readStart": 1, "readEnd": 30 } }, "overhang": [], "differences": [ { "kind": "substitution", "ref": 897, "refBase": "C", "readBase": "A", "read": 5, "common": true, "asSupplied": { "read": 26, "readBase": "T" } }, { "kind": "deletion", "refStart": 900, "refEnd": 900, "length": 1, "bases": "C", "readAfter": 7, "asSupplied": { "readBetween": [ 23, 24 ] }, "common": true }, { "kind": "substitution", "ref": 903, "refBase": "T", "readBase": "C", "read": 10, "common": true, "asSupplied": { "read": 21, "readBase": "G" } }, { "kind": "deletion", "refStart": 908, "refEnd": 909, "length": 2, "bases": "AA", "readAfter": 14, "asSupplied": { "readBetween": [ 16, 17 ] }, "common": true }, { "kind": "deletion", "refStart": 911, "refEnd": 911, "length": 1, "bases": "A", "readAfter": 15, "asSupplied": { "readBetween": [ 15, 16 ] }, "common": false, "notFixed": { "from": { "ref": 910, "read": 15, "readAsSupplied": 16 }, "to": { "ref": 915, "read": 20, "readAsSupplied": 11 } } }, { "kind": "insertion", "refAfter": 913, "length": 1, "bases": "T", "readStart": 18, "readEnd": 18, "asSupplied": { "readStart": 13, "readEnd": 13, "bases": "A" }, "common": false, "notFixed": { "from": { "ref": 910, "read": 15, "readAsSupplied": 16 }, "to": { "ref": 915, "read": 20, "readAsSupplied": 11 } } }, { "kind": "substitution", "ref": 914, "refBase": "G", "readBase": "A", "read": 19, "common": false, "notFixed": { "from": { "ref": 910, "read": 15, "readAsSupplied": 16 }, "to": { "ref": 915, "read": 20, "readAsSupplied": 11 } }, "asSupplied": { "read": 12, "readBase": "T" } }, { "kind": "deletion", "refStart": 918, "refEnd": 918, "length": 1, "bases": "A", "readAfter": 22, "asSupplied": { "readBetween": [ 8, 9 ] }, "common": true }, { "kind": "substitution", "ref": 921, "refBase": "T", "readBase": "C", "read": 25, "common": true, "asSupplied": { "read": 6, "readBase": "G" } }, { "kind": "substitution", "ref": 922, "refBase": "T", "readBase": "G", "read": 26, "common": true, "asSupplied": { "read": 5, "readBase": "C" } }, { "kind": "substitution", "ref": 924, "refBase": "T", "readBase": "C", "read": 28, "common": true, "asSupplied": { "read": 3, "readBase": "G" } } ] }, "band": { "diagonalMin": 892, "diagonalMax": 896, "cellsNeeded": 217, "unionBandLimited": false, "scope": "every optimal path", "gridCells": 47461, "searchedBanded": true, "sharedWords": 0, "sharedWordsOverCap": false, "seedGuarantee": { "differencesUpTo": 29, "guaranteed": false } }, "enumeration": "listed", "alignments": [ [ [ 0, 892, 899, 900, 907, 909, 910, 911, 913, 913, 917, 918, 926, 1530 ], [ 0, 0, 7, 7, 14, 14, 15, 15, 17, 18, 22, 22, 30, 30 ] ], [ [ 0, 892, 899, 900, 907, 909, 910, 910, 913, 914, 917, 918, 926, 1530 ], [ 0, 0, 7, 7, 14, 14, 15, 16, 19, 19, 22, 22, 30, 30 ] ], [ [ 0, 892, 899, 900, 907, 909, 910, 911, 914, 914, 917, 918, 926, 1530 ], [ 0, 0, 7, 7, 14, 14, 15, 15, 18, 19, 22, 22, 30, 30 ] ] ], "tuples": [ [ 23, 0, 35, 6, 6, 5, 30, 34 ] ], "tupleFields": [ "identical", "ambiguousColumns", "columns", "mismatches", "gapColumns", "gapOpens", "readAligned", "referenceCovered" ], "variation": { "readAligned": { "shared": true, "min": 30, "max": 30 }, "referenceCovered": { "shared": true, "min": 34, "max": 34 }, "identity": { "shared": true, "min": { "numerator": 23, "denominator": 35 }, "max": { "numerator": 23, "denominator": 35 } }, "overhangStart": { "shared": true, "min": 0, "max": 0 }, "overhangEnd": { "shared": true, "min": 0, "max": 0 } }, "placements": [ { "refStart": 893, "refEnd": 926, "crossesOrigin": false, "wholeCircle": false, "readStart": 1, "readEnd": 30, "asSupplied": { "readStart": 1, "readEnd": 30 }, "alignments": 3, "band": { "diagonalMin": 892, "diagonalMax": 896, "cellsNeeded": 217, "bandLimited": false } } ] } }, { "mode": "local", "region": null, "strand": "+", "strandUndetermined": false, "plus": { "score": 60, "count": 2, "overCap": false, "state": "aligned", "biopython": { "score": 60, "count": 2 }, "uniquePairs": [], "uniquePlacement": false, "placementNotDetermined": false, "noCommonColumn": false, "hull": { "refStart": 101, "refEnd": 1230, "crossesOrigin": false, "wholeCircle": false }, "selected": { "coordinates": [ [ 100, 130 ], [ 0, 30 ] ], "gappedReference": "ATGTCGCAGAGTATGCCGGTGTCTCTTATC", "gappedRead": "ATGTCGCAGAGTATGCCGGTGTCTCTTATC", "columns": 30, "identical": 30, "mismatches": 0, "ambiguousColumns": 0, "gapColumns": 0, "gapOpens": 0, "identity": { "numerator": 30, "denominator": 30 }, "readAligned": { "bases": 30, "of": 30 }, "referenceCovered": { "bases": 30, "of": 1530 }, "placement": { "refStart": 101, "refEnd": 130, "readStart": 1, "readEnd": 30, "crossesOrigin": false }, "overhang": [], "differences": [] }, "band": { "diagonalMin": 100, "diagonalMax": 1200, "cellsNeeded": 34193, "unionBandLimited": true, "scope": "every optimal path", "gridCells": 47461, "searchedBanded": true, "sharedWords": 38, "sharedWordsOverCap": false, "seedGuarantee": { "differencesUpTo": 0, "guaranteed": true } }, "enumeration": "listed", "alignments": [ [ [ 100, 130 ], [ 0, 30 ] ], [ [ 1200, 1230 ], [ 0, 30 ] ] ], "tuples": [ [ 30, 0, 30, 0, 0, 0, 30, 30 ] ], "tupleFields": [ "identical", "ambiguousColumns", "columns", "mismatches", "gapColumns", "gapOpens", "readAligned", "referenceCovered" ], "variation": { "readAligned": { "shared": true, "min": 30, "max": 30 }, "referenceCovered": { "shared": true, "min": 30, "max": 30 }, "identity": { "shared": true, "min": { "numerator": 1, "denominator": 1 }, "max": { "numerator": 1, "denominator": 1 } }, "overhangStart": { "shared": true, "min": 0, "max": 0 }, "overhangEnd": { "shared": true, "min": 0, "max": 0 } }, "placements": [ { "refStart": 101, "refEnd": 130, "crossesOrigin": false, "wholeCircle": false, "readStart": 1, "readEnd": 30, "alignments": 1, "band": { "diagonalMin": 100, "diagonalMax": 100, "cellsNeeded": 93, "bandLimited": false } }, { "refStart": 1201, "refEnd": 1230, "crossesOrigin": false, "wholeCircle": false, "readStart": 1, "readEnd": 30, "alignments": 1, "band": { "diagonalMin": 1200, "diagonalMax": 1200, "cellsNeeded": 93, "bandLimited": false } } ] }, "minus": { "score": 14, "count": 2, "overCap": false, "state": "aligned", "biopython": { "score": 14, "count": 2 }, "uniquePairs": [], "uniquePlacement": false, "placementNotDetermined": false, "noCommonColumn": false, "hull": { "refStart": 169, "refEnd": 542, "crossesOrigin": false, "wholeCircle": false }, "selected": { "coordinates": [ [ 168, 175 ], [ 20, 27 ] ], "gappedReference": "TCTGCGA", "gappedRead": "TCTGCGA", "columns": 7, "identical": 7, "mismatches": 0, "ambiguousColumns": 0, "gapColumns": 0, "gapOpens": 0, "identity": { "numerator": 7, "denominator": 7 }, "readAligned": { "bases": 7, "of": 30 }, "referenceCovered": { "bases": 7, "of": 1530 }, "placement": { "refStart": 169, "refEnd": 175, "readStart": 21, "readEnd": 27, "crossesOrigin": false, "asSupplied": { "readStart": 4, "readEnd": 10 } }, "overhang": [], "differences": [] }, "band": { "diagonalMin": 148, "diagonalMax": 529, "cellsNeeded": 11904, "unionBandLimited": false, "scope": "every optimal path", "gridCells": 47461, "searchedBanded": true, "sharedWords": 0, "sharedWordsOverCap": false, "seedGuarantee": { "differencesUpTo": 23, "guaranteed": false } }, "enumeration": "listed", "alignments": [ [ [ 168, 175 ], [ 20, 27 ] ], [ [ 535, 542 ], [ 6, 13 ] ] ], "tuples": [ [ 7, 0, 7, 0, 0, 0, 7, 7 ] ], "tupleFields": [ "identical", "ambiguousColumns", "columns", "mismatches", "gapColumns", "gapOpens", "readAligned", "referenceCovered" ], "variation": { "readAligned": { "shared": true, "min": 7, "max": 7 }, "referenceCovered": { "shared": true, "min": 7, "max": 7 }, "identity": { "shared": true, "min": { "numerator": 1, "denominator": 1 }, "max": { "numerator": 1, "denominator": 1 } }, "overhangStart": { "shared": true, "min": 0, "max": 0 }, "overhangEnd": { "shared": true, "min": 0, "max": 0 } }, "placements": [ { "refStart": 169, "refEnd": 175, "crossesOrigin": false, "wholeCircle": false, "readStart": 21, "readEnd": 27, "asSupplied": { "readStart": 4, "readEnd": 10 }, "alignments": 1, "band": { "diagonalMin": 148, "diagonalMax": 148, "cellsNeeded": 93, "bandLimited": false } }, { "refStart": 536, "refEnd": 542, "crossesOrigin": false, "wholeCircle": false, "readStart": 7, "readEnd": 13, "asSupplied": { "readStart": 18, "readEnd": 24 }, "alignments": 1, "band": { "diagonalMin": 529, "diagonalMax": 529, "cellsNeeded": 93, "bandLimited": false } } ] } } ] } }, { "id": "wraps-past-one-turn", "note": "7h: a circular reference of 40 (J01636.1 1001-1040) and a read whose best semiglobal-read alignment spans 45 reference bases: wraps past one turn, no numbers.", "input": { "reference": { "residues": "CTCAGGGCCAGGCGGTGAAGGGCAATCAGCTGTTGCCCGT", "topology": "circular", "source": "J01636.1 1001-1040, circular" }, "read": { "residues": "TGTTGCCCGTCTCAGTGAAGGGCAATCAGCTGTTG", "source": "reference bases 31-40, 1-5, 16-35" }, "modes": [ "semiglobal-read" ] }, "expected": { "results": [ { "mode": "semiglobal-read", "region": null, "strand": "+", "strandUndetermined": false, "plus": { "score": 47, "count": 2, "overCap": false, "state": "wraps-past-one-turn", "biopython": { "score": 47, "count": 2, "tailScore": 28, "tailCountSubtracted": 0, "certifiedText": { "extension": 35, "textLength": 109, "reruns": 0, "differencesUpTo": 11 } }, "enumeration": "listed" }, "minus": { "score": 11, "count": 7, "overCap": false, "state": "aligned", "biopython": { "score": 11, "count": 14, "tailScore": 11, "tailCountSubtracted": 7, "certifiedText": { "extension": 35, "textLength": 109, "reruns": 0, "differencesUpTo": 29 } }, "uniquePairs": [ [ 23, 1 ], [ 24, 2 ], [ 25, 3 ], [ 27, 4 ], [ 28, 5 ], [ 29, 6 ], [ 30, 7 ], [ 31, 8 ], [ 32, 9 ], [ 33, 11 ], [ 34, 12 ], [ 35, 13 ], [ 36, 14 ], [ 37, 15 ], [ 38, 16 ], [ 39, 17 ], [ 40, 18 ], [ 6, 29 ], [ 7, 30 ], [ 8, 31 ], [ 9, 34 ], [ 10, 35 ] ], "uniquePlacement": true, "placementNotDetermined": false, "noCommonColumn": false, "hull": { "refStart": 23, "refEnd": 10, "crossesOrigin": true, "wholeCircle": false }, "selected": { "coordinates": [ [ 0, 22, 25, 26, 32, 32, 40, 40, 44, 44, 48, 48, 50 ], [ 0, 0, 3, 3, 9, 10, 18, 20, 24, 27, 31, 33, 35 ] ], "gappedReference": "CAATCAGCTG-TTGCCCGT--CTCA---GGGC--CA", "gappedRead": "CAA-CAGCTGATTGCCCTTCACTGAGACGGGCAACA", "columns": 36, "identical": 25, "mismatches": 2, "ambiguousColumns": 0, "gapColumns": 9, "gapOpens": 5, "identity": { "numerator": 25, "denominator": 36 }, "readAligned": { "bases": 35, "of": 35 }, "referenceCovered": { "bases": 28, "of": 40 }, "placement": { "refStart": 23, "refEnd": 10, "readStart": 1, "readEnd": 35, "crossesOrigin": true, "asSupplied": { "readStart": 1, "readEnd": 35 } }, "overhang": [], "differences": [ { "kind": "deletion", "refStart": 26, "refEnd": 26, "length": 1, "bases": "T", "readAfter": 3, "asSupplied": { "readBetween": [ 32, 33 ] }, "common": true }, { "kind": "insertion", "refAfter": 32, "length": 1, "bases": "A", "readStart": 10, "readEnd": 10, "asSupplied": { "readStart": 26, "readEnd": 26, "bases": "T" }, "common": true }, { "kind": "substitution", "ref": 39, "refBase": "G", "readBase": "T", "read": 17, "common": true, "asSupplied": { "read": 19, "readBase": "A" } }, { "kind": "insertion", "refAfter": 40, "length": 2, "bases": "CA", "readStart": 19, "readEnd": 20, "crossesOrigin": true, "asSupplied": { "readStart": 16, "readEnd": 17, "bases": "TG" }, "common": false, "notFixed": { "from": { "ref": 40, "read": 18, "readAsSupplied": 18 }, "to": { "ref": 6, "read": 29, "readAsSupplied": 7 } } }, { "kind": "substitution", "ref": 3, "refBase": "C", "readBase": "G", "read": 23, "common": false, "notFixed": { "from": { "ref": 40, "read": 18, "readAsSupplied": 18 }, "to": { "ref": 6, "read": 29, "readAsSupplied": 7 } }, "asSupplied": { "read": 13, "readBase": "C" } }, { "kind": "insertion", "refAfter": 4, "length": 3, "bases": "GAC", "readStart": 25, "readEnd": 27, "asSupplied": { "readStart": 9, "readEnd": 11, "bases": "GTC" }, "common": false, "notFixed": { "from": { "ref": 40, "read": 18, "readAsSupplied": 18 }, "to": { "ref": 6, "read": 29, "readAsSupplied": 7 } } }, { "kind": "insertion", "refAfter": 8, "length": 2, "bases": "AA", "readStart": 32, "readEnd": 33, "asSupplied": { "readStart": 3, "readEnd": 4, "bases": "TT" }, "common": true } ] }, "band": { "diagonalMin": 15, "diagonalMax": 23, "cellsNeeded": 396, "unionBandLimited": false, "scope": "every optimal path", "gridCells": 3960, "searchedBanded": false, "sharedWords": 0, "sharedWordsOverCap": false, "seedGuarantee": { "differencesUpTo": 29, "guaranteed": false } }, "enumeration": "listed", "alignments": [ [ [ 0, 22, 25, 26, 32, 32, 40, 40, 44, 44, 48, 48, 50 ], [ 0, 0, 3, 3, 9, 10, 18, 20, 24, 27, 31, 33, 35 ] ], [ [ 0, 22, 25, 26, 32, 32, 41, 41, 44, 44, 48, 48, 50 ], [ 0, 0, 3, 3, 9, 10, 19, 21, 24, 27, 31, 33, 35 ] ], [ [ 0, 22, 25, 26, 32, 32, 43, 43, 44, 44, 48, 48, 50 ], [ 0, 0, 3, 3, 9, 10, 21, 23, 24, 27, 31, 33, 35 ] ], [ [ 0, 22, 25, 26, 32, 32, 43, 43, 44, 44, 48, 48, 50 ], [ 0, 0, 3, 3, 9, 10, 21, 25, 26, 27, 31, 33, 35 ] ], [ [ 0, 22, 25, 26, 32, 32, 40, 40, 45, 45, 48, 48, 50 ], [ 0, 0, 3, 3, 9, 10, 18, 20, 25, 28, 31, 33, 35 ] ], [ [ 0, 22, 25, 26, 32, 32, 41, 41, 45, 45, 48, 48, 50 ], [ 0, 0, 3, 3, 9, 10, 19, 21, 25, 28, 31, 33, 35 ] ], [ [ 0, 22, 25, 26, 32, 32, 43, 43, 45, 45, 48, 48, 50 ], [ 0, 0, 3, 3, 9, 10, 21, 23, 25, 28, 31, 33, 35 ] ] ], "tuples": [ [ 25, 0, 36, 2, 9, 5, 35, 28 ] ], "tupleFields": [ "identical", "ambiguousColumns", "columns", "mismatches", "gapColumns", "gapOpens", "readAligned", "referenceCovered" ], "variation": { "readAligned": { "shared": true, "min": 35, "max": 35 }, "referenceCovered": { "shared": true, "min": 28, "max": 28 }, "identity": { "shared": true, "min": { "numerator": 25, "denominator": 36 }, "max": { "numerator": 25, "denominator": 36 } }, "overhangStart": { "shared": true, "min": 0, "max": 0 }, "overhangEnd": { "shared": true, "min": 0, "max": 0 } }, "placements": [ { "refStart": 23, "refEnd": 10, "crossesOrigin": true, "wholeCircle": false, "readStart": 1, "readEnd": 35, "asSupplied": { "readStart": 1, "readEnd": 35 }, "alignments": 7, "band": { "diagonalMin": 15, "diagonalMax": 23, "cellsNeeded": 396, "bandLimited": false } } ] } } ] } }, { "id": "no-unbroken-word", "note": "7i: a read whose optimum holds no unbroken 12-base match (J01636.1 801-900, every tenth base changed), on a grid over the test budget: band-limited, never a seeded suboptimum.", "input": { "reference": { "residues": "GACACCATCGAATGGCGCAAAACCTTTCGCGGTATGGCATGATAGCGCCCGGAAGAGAGTCAATTCAGGGTGGTGAATGTGAAACCAGTAACGTTATACGATGTCGCAGAGTATGCCGGTGTCTCTTATCAGACCGTTTCCCGCGTGGTGAACCAGGCCAGCCACGTTTCTGCGAAAACGCGGGAAAAAGTGGAAGCGGCGATGGCGGAGCTGAATTACATTCCCAACCGCGTGGCACAACAACTGGCGGGCAAACAGTCGTTGCTGATTGGCGTTGCCACCTCCAGTCTGGCCCTGCACGCGCCGTCGCAAATTGTCGCGGCGATTAAATCTCGCGCCGATCAACTGGGTGCCAGCGTGGTGGTGTCGATGGTAGAACGAAGCGGCGTCGAAGCCTGTAAAGCGGCGGTGCACAATCTTCTCGCGCAACGCGTCAGTGGGCTGATCATTAACTATCCGCTGGATGACCAGGATGCCATTGCTGTGGAAGCTGCCTGCACTAATGTTCCGGCGTTATTTCTTGATGTCTCTGACCAGACACCCATCAACAGTATTATTTTCTCCCATGAAGACGGTACGCGACTGGGCGTGGAGCATCTGGTCGCATTGGGTCACCAGCAAATCGCGCTGTTAGCGGGCCCATTAAGTTCTGTCTCGGCGCGTCTGCGTCTGGCTGGCTGGCATAAATATCTCACTCGCAATCAAATTCAGCCGATAGCGGAACGGGAAGGCGACTGGAGTGCCATGTCCGGTTTTCAACAAACCATGCAAATGCTGAATGAGGGCATCGTTCCCACTGCGATGCTGGTTGCCAACGATCAGATGGCGCTGGGCGCAATGCGCGCCATTACCGAGTCCGGGCTGCGCGTTGGTGCGGATATCTCGGTAGTGGGATACGACGATACCGAAGACAGCTCATGTTATATCCCGCCGTCAACCACCATCAAACAGGATTTTCGCCTGCTGGGGCAAACCAGCGTGGACCGCTTGCTGCAACTCTCTCAGGGCCAGGCGGTGAAGGGCAATCAGCTGTTGCCCGTCTCACTGGTGAAAAGAAAAACCACCCTGGCGCCCAATACGCAAACCGCCTCTCCCCGCGCGTTGGCCGATTCATTAATGCAGCTGGCACGACAGGTTTCCCGACTGGAAAGCGGGCAGTGAGCGCAACGCAATTAATGTGAGTTAGCTCACTCATTAGGCACCCCAGGCTTTACACTTTATGCTTCCGGCTCGTATGTTGTGTGGAATTGTGAGCGGATAACAATTTCACACAGGAAACAGCTATGACCATGATTACGGATTCACTGGCCGTCGTTTTACAACGTCGTGACTGGGAAAACCCTGGCGTTACCCAACTTAATCGCCTTGCAGCACATCCCCCTTTCGCCAGCTGGCGTAATAGCGAAGAGGCCCGCACCGATCGCCCTTCCCAACAGTTGCGCAGCCTGAATGGCGAATGGCGCTTTGCCTGGTTTCCGGCACCAGAAGCGGTGCCGGAAA", "topology": "linear", "source": "J01636.1 1-1500" }, "read": { "residues": "GATGCTGGTAGCCAACGATGAGATGGCGCAGGGCGCAATTCGCGCCATTCCCGAGTCCGTGCTGCGCGTAGGTGCGGATCTCTCGGTAGAGGGATACGAG", "source": "J01636.1 801-900, read bases 10, 20, ..., 100 changed" }, "modes": [ "semiglobal-read", "local" ] }, "expected": { "results": [ { "mode": "semiglobal-read", "region": null, "strand": "+", "strandUndetermined": false, "plus": { "score": 150, "count": 2, "overCap": false, "state": "aligned", "biopython": { "score": 150, "count": 2 }, "uniquePairs": [ [ 801, 1 ], [ 802, 2 ], [ 803, 3 ], [ 804, 4 ], [ 805, 5 ], [ 806, 6 ], [ 807, 7 ], [ 808, 8 ], [ 809, 9 ], [ 810, 10 ], [ 811, 11 ], [ 812, 12 ], [ 813, 13 ], [ 814, 14 ], [ 815, 15 ], [ 816, 16 ], [ 817, 17 ], [ 818, 18 ], [ 819, 19 ], [ 820, 20 ], [ 821, 21 ], [ 822, 22 ], [ 823, 23 ], [ 824, 24 ], [ 825, 25 ], [ 826, 26 ], [ 827, 27 ], [ 828, 28 ], [ 829, 29 ], [ 830, 30 ], [ 831, 31 ], [ 832, 32 ], [ 833, 33 ], [ 834, 34 ], [ 835, 35 ], [ 836, 36 ], [ 837, 37 ], [ 838, 38 ], [ 839, 39 ], [ 840, 40 ], [ 841, 41 ], [ 842, 42 ], [ 843, 43 ], [ 844, 44 ], [ 845, 45 ], [ 846, 46 ], [ 847, 47 ], [ 848, 48 ], [ 849, 49 ], [ 850, 50 ], [ 851, 51 ], [ 852, 52 ], [ 853, 53 ], [ 854, 54 ], [ 855, 55 ], [ 856, 56 ], [ 857, 57 ], [ 858, 58 ], [ 859, 59 ], [ 860, 60 ], [ 861, 61 ], [ 862, 62 ], [ 863, 63 ], [ 864, 64 ], [ 865, 65 ], [ 866, 66 ], [ 867, 67 ], [ 868, 68 ], [ 869, 69 ], [ 870, 70 ], [ 871, 71 ], [ 872, 72 ], [ 873, 73 ], [ 874, 74 ], [ 875, 75 ], [ 876, 76 ], [ 877, 77 ], [ 878, 78 ], [ 879, 79 ], [ 880, 80 ], [ 881, 81 ], [ 882, 82 ], [ 883, 83 ], [ 884, 84 ], [ 885, 85 ], [ 886, 86 ], [ 887, 87 ], [ 888, 88 ], [ 889, 89 ], [ 890, 90 ], [ 891, 91 ], [ 892, 92 ], [ 893, 93 ], [ 894, 94 ], [ 895, 95 ], [ 896, 96 ], [ 897, 97 ], [ 898, 98 ], [ 899, 99 ] ], "uniquePlacement": true, "placementNotDetermined": false, "noCommonColumn": false, "hull": { "refStart": 801, "refEnd": 901, "crossesOrigin": false, "wholeCircle": false }, "selected": { "coordinates": [ [ 0, 800, 900, 1500 ], [ 0, 0, 100, 100 ] ], "gappedReference": "GATGCTGGTTGCCAACGATCAGATGGCGCTGGGCGCAATGCGCGCCATTACCGAGTCCGGGCTGCGCGTTGGTGCGGATATCTCGGTAGTGGGATACGAC", "gappedRead": "GATGCTGGTAGCCAACGATGAGATGGCGCAGGGCGCAATTCGCGCCATTCCCGAGTCCGTGCTGCGCGTAGGTGCGGATCTCTCGGTAGAGGGATACGAG", "columns": 100, "identical": 90, "mismatches": 10, "ambiguousColumns": 0, "gapColumns": 0, "gapOpens": 0, "identity": { "numerator": 90, "denominator": 100 }, "readAligned": { "bases": 100, "of": 100 }, "referenceCovered": { "bases": 100, "of": 1500 }, "placement": { "refStart": 801, "refEnd": 900, "readStart": 1, "readEnd": 100, "crossesOrigin": false }, "overhang": [], "differences": [ { "kind": "substitution", "ref": 810, "refBase": "T", "readBase": "A", "read": 10, "common": true }, { "kind": "substitution", "ref": 820, "refBase": "C", "readBase": "G", "read": 20, "common": true }, { "kind": "substitution", "ref": 830, "refBase": "T", "readBase": "A", "read": 30, "common": true }, { "kind": "substitution", "ref": 840, "refBase": "G", "readBase": "T", "read": 40, "common": true }, { "kind": "substitution", "ref": 850, "refBase": "A", "readBase": "C", "read": 50, "common": true }, { "kind": "substitution", "ref": 860, "refBase": "G", "readBase": "T", "read": 60, "common": true }, { "kind": "substitution", "ref": 870, "refBase": "T", "readBase": "A", "read": 70, "common": true }, { "kind": "substitution", "ref": 880, "refBase": "A", "readBase": "C", "read": 80, "common": true }, { "kind": "substitution", "ref": 890, "refBase": "T", "readBase": "A", "read": 90, "common": true }, { "kind": "substitution", "ref": 900, "refBase": "C", "readBase": "G", "read": 100, "common": false, "notFixed": { "from": { "ref": 899, "read": 99 }, "to": null } } ] }, "band": { "diagonalMin": 800, "diagonalMax": 801, "cellsNeeded": 404, "unionBandLimited": false, "scope": "every optimal path", "gridCells": 151601, "searchedBanded": true, "sharedWords": 0, "sharedWordsOverCap": false, "seedGuarantee": { "differencesUpTo": 25, "guaranteed": false } }, "enumeration": "listed", "alignments": [ [ [ 0, 800, 900, 1500 ], [ 0, 0, 100, 100 ] ], [ [ 0, 800, 899, 900, 901, 1500 ], [ 0, 0, 99, 99, 100, 100 ] ] ], "tuples": [ [ 90, 0, 100, 10, 0, 0, 100, 100 ], [ 91, 0, 101, 9, 1, 1, 100, 101 ] ], "tupleFields": [ "identical", "ambiguousColumns", "columns", "mismatches", "gapColumns", "gapOpens", "readAligned", "referenceCovered" ], "variation": { "readAligned": { "shared": true, "min": 100, "max": 100 }, "referenceCovered": { "shared": false, "min": 100, "max": 101 }, "identity": { "shared": false, "min": { "numerator": 9, "denominator": 10 }, "max": { "numerator": 91, "denominator": 101 } }, "overhangStart": { "shared": true, "min": 0, "max": 0 }, "overhangEnd": { "shared": true, "min": 0, "max": 0 } }, "placements": [ { "refStart": 801, "refEnd": 901, "crossesOrigin": false, "wholeCircle": false, "readStart": 1, "readEnd": 100, "alignments": 2, "band": { "diagonalMin": 800, "diagonalMax": 801, "cellsNeeded": 404, "bandLimited": false } } ] }, "minus": { "score": -17, "count": 16, "overCap": false, "state": "aligned", "biopython": { "score": -17, "count": 16 }, "uniquePairs": [ [ 1417, 1 ], [ 1418, 3 ], [ 1419, 4 ], [ 1420, 6 ], [ 1421, 7 ], [ 1422, 8 ], [ 1423, 9 ], [ 1424, 10 ], [ 1425, 11 ], [ 1426, 12 ], [ 1427, 13 ], [ 1428, 14 ], [ 1429, 15 ], [ 1430, 16 ], [ 1431, 17 ], [ 1432, 18 ], [ 1434, 27 ], [ 1435, 28 ], [ 1436, 29 ], [ 1437, 30 ], [ 1438, 31 ], [ 1439, 34 ], [ 1440, 35 ], [ 1441, 36 ], [ 1442, 37 ], [ 1443, 38 ], [ 1444, 39 ], [ 1445, 40 ], [ 1446, 42 ], [ 1447, 43 ], [ 1448, 44 ], [ 1449, 45 ], [ 1450, 46 ], [ 1451, 47 ], [ 1452, 48 ], [ 1453, 49 ], [ 1454, 50 ], [ 1455, 51 ], [ 1456, 52 ], [ 1457, 53 ], [ 1458, 54 ], [ 1459, 55 ], [ 1460, 56 ], [ 1461, 57 ], [ 1462, 58 ], [ 1463, 59 ], [ 1465, 63 ], [ 1466, 64 ], [ 1467, 65 ], [ 1469, 70 ], [ 1470, 71 ], [ 1471, 72 ], [ 1472, 74 ], [ 1473, 78 ], [ 1474, 79 ], [ 1475, 80 ], [ 1476, 81 ], [ 1477, 84 ], [ 1479, 89 ], [ 1480, 90 ], [ 1481, 92 ], [ 1482, 93 ], [ 1483, 94 ], [ 1484, 95 ], [ 1485, 96 ], [ 1486, 97 ], [ 1487, 98 ], [ 1488, 99 ], [ 1489, 100 ] ], "uniquePlacement": true, "placementNotDetermined": false, "noCommonColumn": false, "hull": { "refStart": 1417, "refEnd": 1489, "crossesOrigin": false, "wholeCircle": false }, "selected": { "coordinates": [ [ 0, 1416, 1417, 1417, 1419, 1419, 1432, 1432, 1433, 1433, 1438, 1438, 1445, 1445, 1463, 1463, 1467, 1467, 1471, 1471, 1472, 1472, 1476, 1476, 1477, 1477, 1480, 1480, 1489, 1500 ], [ 0, 0, 1, 2, 4, 5, 18, 19, 20, 26, 31, 33, 40, 41, 59, 61, 65, 68, 72, 73, 74, 77, 81, 83, 84, 87, 90, 91, 100, 100 ] ], "gappedReference": "C-CG-ATCGCCCTTCCCA-A------CAGTT--GCGCAGC-CTGAATGGCGAATGGCGC--TTTG---CCTG-G---TTTC--C---GGC-ACCAGAAGC", "gappedRead": "CTCGTATCCCTCTACCGAGAGATCCGCACCTACGCGCAGCACGGACTCGGGAATGGCGCGAATTGCGCCCTGCGCCATCTCATCGTTGGCTACCAGCATC", "columns": 100, "identical": 59, "mismatches": 14, "ambiguousColumns": 0, "gapColumns": 27, "gapOpens": 13, "identity": { "numerator": 59, "denominator": 100 }, "readAligned": { "bases": 100, "of": 100 }, "referenceCovered": { "bases": 73, "of": 1500 }, "placement": { "refStart": 1417, "refEnd": 1489, "readStart": 1, "readEnd": 100, "crossesOrigin": false, "asSupplied": { "readStart": 1, "readEnd": 100 } }, "overhang": [], "differences": [ { "kind": "insertion", "refAfter": 1417, "length": 1, "bases": "T", "readStart": 2, "readEnd": 2, "asSupplied": { "readStart": 99, "readEnd": 99, "bases": "A" }, "common": true }, { "kind": "insertion", "refAfter": 1419, "length": 1, "bases": "T", "readStart": 5, "readEnd": 5, "asSupplied": { "readStart": 96, "readEnd": 96, "bases": "A" }, "common": true }, { "kind": "substitution", "ref": 1423, "refBase": "G", "readBase": "C", "read": 9, "common": true, "asSupplied": { "read": 92, "readBase": "G" } }, { "kind": "substitution", "ref": 1425, "refBase": "C", "readBase": "T", "read": 11, "common": true, "asSupplied": { "read": 90, "readBase": "A" } }, { "kind": "substitution", "ref": 1428, "refBase": "T", "readBase": "A", "read": 14, "common": true, "asSupplied": { "read": 87, "readBase": "T" } }, { "kind": "substitution", "ref": 1431, "refBase": "C", "readBase": "G", "read": 17, "common": true, "asSupplied": { "read": 84, "readBase": "C" } }, { "kind": "insertion", "refAfter": 1432, "length": 1, "bases": "G", "readStart": 19, "readEnd": 19, "asSupplied": { "readStart": 82, "readEnd": 82, "bases": "C" }, "common": false, "notFixed": { "from": { "ref": 1432, "read": 18, "readAsSupplied": 83 }, "to": { "ref": 1434, "read": 27, "readAsSupplied": 74 } } }, { "kind": "insertion", "refAfter": 1433, "length": 6, "bases": "GATCCG", "readStart": 21, "readEnd": 26, "asSupplied": { "readStart": 75, "readEnd": 80, "bases": "CGGATC" }, "common": false, "notFixed": { "from": { "ref": 1432, "read": 18, "readAsSupplied": 83 }, "to": { "ref": 1434, "read": 27, "readAsSupplied": 74 } } }, { "kind": "substitution", "ref": 1436, "refBase": "G", "readBase": "C", "read": 29, "common": true, "asSupplied": { "read": 72, "readBase": "G" } }, { "kind": "substitution", "ref": 1437, "refBase": "T", "readBase": "C", "read": 30, "common": true, "asSupplied": { "read": 71, "readBase": "G" } }, { "kind": "insertion", "refAfter": 1438, "length": 2, "bases": "AC", "readStart": 32, "readEnd": 33, "asSupplied": { "readStart": 68, "readEnd": 69, "bases": "GT" }, "common": true }, { "kind": "insertion", "refAfter": 1445, "length": 1, "bases": "A", "readStart": 41, "readEnd": 41, "asSupplied": { "readStart": 60, "readEnd": 60, "bases": "T" }, "common": true }, { "kind": "substitution", "ref": 1447, "refBase": "T", "readBase": "G", "read": 43, "common": true, "asSupplied": { "read": 58, "readBase": "C" } }, { "kind": "substitution", "ref": 1450, "refBase": "A", "readBase": "C", "read": 46, "common": true, "asSupplied": { "read": 55, "readBase": "G" } }, { "kind": "substitution", "ref": 1452, "refBase": "G", "readBase": "C", "read": 48, "common": true, "asSupplied": { "read": 53, "readBase": "G" } }, { "kind": "substitution", "ref": 1454, "refBase": "C", "readBase": "G", "read": 50, "common": true, "asSupplied": { "read": 51, "readBase": "C" } }, { "kind": "insertion", "refAfter": 1463, "length": 2, "bases": "GA", "readStart": 60, "readEnd": 61, "asSupplied": { "readStart": 40, "readEnd": 41, "bases": "TC" }, "common": false, "notFixed": { "from": { "ref": 1463, "read": 59, "readAsSupplied": 42 }, "to": { "ref": 1465, "read": 63, "readAsSupplied": 38 } } }, { "kind": "substitution", "ref": 1464, "refBase": "T", "readBase": "A", "read": 62, "common": false, "notFixed": { "from": { "ref": 1463, "read": 59, "readAsSupplied": 42 }, "to": { "ref": 1465, "read": 63, "readAsSupplied": 38 } }, "asSupplied": { "read": 39, "readBase": "T" } }, { "kind": "insertion", "refAfter": 1467, "length": 3, "bases": "CGC", "readStart": 66, "readEnd": 68, "asSupplied": { "readStart": 33, "readEnd": 35, "bases": "GCG" }, "common": false, "notFixed": { "from": { "ref": 1467, "read": 65, "readAsSupplied": 36 }, "to": { "ref": 1469, "read": 70, "readAsSupplied": 31 } } }, { "kind": "insertion", "refAfter": 1471, "length": 1, "bases": "C", "readStart": 73, "readEnd": 73, "asSupplied": { "readStart": 28, "readEnd": 28, "bases": "G" }, "common": true }, { "kind": "insertion", "refAfter": 1472, "length": 3, "bases": "CCA", "readStart": 75, "readEnd": 77, "asSupplied": { "readStart": 24, "readEnd": 26, "bases": "TGG" }, "common": true }, { "kind": "substitution", "ref": 1474, "refBase": "T", "readBase": "C", "read": 79, "common": true, "asSupplied": { "read": 22, "readBase": "G" } }, { "kind": "insertion", "refAfter": 1476, "length": 2, "bases": "AT", "readStart": 82, "readEnd": 83, "asSupplied": { "readStart": 18, "readEnd": 19, "bases": "AT" }, "common": true }, { "kind": "insertion", "refAfter": 1477, "length": 3, "bases": "GTT", "readStart": 85, "readEnd": 87, "asSupplied": { "readStart": 14, "readEnd": 16, "bases": "AAC" }, "common": false, "notFixed": { "from": { "ref": 1477, "read": 84, "readAsSupplied": 17 }, "to": { "ref": 1479, "read": 89, "readAsSupplied": 12 } } }, { "kind": "insertion", "refAfter": 1480, "length": 1, "bases": "T", "readStart": 91, "readEnd": 91, "asSupplied": { "readStart": 10, "readEnd": 10, "bases": "A" }, "common": true }, { "kind": "substitution", "ref": 1486, "refBase": "A", "readBase": "C", "read": 97, "common": true, "asSupplied": { "read": 4, "readBase": "G" } }, { "kind": "substitution", "ref": 1488, "refBase": "G", "readBase": "T", "read": 99, "common": true, "asSupplied": { "read": 2, "readBase": "A" } } ] }, "band": { "diagonalMin": 1389, "diagonalMax": 1416, "cellsNeeded": 2877, "unionBandLimited": false, "scope": "every optimal path", "gridCells": 151601, "searchedBanded": true, "sharedWords": 0, "sharedWordsOverCap": false, "seedGuarantee": { "differencesUpTo": 108, "guaranteed": false } }, "enumeration": "listed", "alignments": [ [ [ 0, 1416, 1417, 1417, 1419, 1419, 1432, 1432, 1433, 1433, 1438, 1438, 1445, 1445, 1463, 1463, 1467, 1467, 1471, 1471, 1472, 1472, 1476, 1476, 1477, 1477, 1480, 1480, 1489, 1500 ], [ 0, 0, 1, 2, 4, 5, 18, 19, 20, 26, 31, 33, 40, 41, 59, 61, 65, 68, 72, 73, 74, 77, 81, 83, 84, 87, 90, 91, 100, 100 ] ], [ [ 0, 1416, 1417, 1417, 1419, 1419, 1432, 1432, 1433, 1433, 1438, 1438, 1445, 1445, 1463, 1463, 1467, 1467, 1471, 1471, 1472, 1472, 1476, 1476, 1477, 1477, 1480, 1480, 1489, 1500 ], [ 0, 0, 1, 2, 4, 5, 18, 21, 22, 26, 31, 33, 40, 41, 59, 61, 65, 68, 72, 73, 74, 77, 81, 83, 84, 87, 90, 91, 100, 100 ] ], [ [ 0, 1416, 1417, 1417, 1419, 1419, 1432, 1432, 1433, 1433, 1438, 1438, 1445, 1445, 1464, 1464, 1467, 1467, 1471, 1471, 1472, 1472, 1476, 1476, 1477, 1477, 1480, 1480, 1489, 1500 ], [ 0, 0, 1, 2, 4, 5, 18, 19, 20, 26, 31, 33, 40, 41, 60, 62, 65, 68, 72, 73, 74, 77, 81, 83, 84, 87, 90, 91, 100, 100 ] ], [ [ 0, 1416, 1417, 1417, 1419, 1419, 1432, 1432, 1433, 1433, 1438, 1438, 1445, 1445, 1464, 1464, 1467, 1467, 1471, 1471, 1472, 1472, 1476, 1476, 1477, 1477, 1480, 1480, 1489, 1500 ], [ 0, 0, 1, 2, 4, 5, 18, 21, 22, 26, 31, 33, 40, 41, 60, 62, 65, 68, 72, 73, 74, 77, 81, 83, 84, 87, 90, 91, 100, 100 ] ], [ [ 0, 1416, 1417, 1417, 1419, 1419, 1432, 1432, 1433, 1433, 1438, 1438, 1445, 1445, 1463, 1463, 1468, 1468, 1471, 1471, 1472, 1472, 1476, 1476, 1477, 1477, 1480, 1480, 1489, 1500 ], [ 0, 0, 1, 2, 4, 5, 18, 19, 20, 26, 31, 33, 40, 41, 59, 61, 66, 69, 72, 73, 74, 77, 81, 83, 84, 87, 90, 91, 100, 100 ] ], [ [ 0, 1416, 1417, 1417, 1419, 1419, 1432, 1432, 1433, 1433, 1438, 1438, 1445, 1445, 1463, 1463, 1468, 1468, 1471, 1471, 1472, 1472, 1476, 1476, 1477, 1477, 1480, 1480, 1489, 1500 ], [ 0, 0, 1, 2, 4, 5, 18, 21, 22, 26, 31, 33, 40, 41, 59, 61, 66, 69, 72, 73, 74, 77, 81, 83, 84, 87, 90, 91, 100, 100 ] ], [ [ 0, 1416, 1417, 1417, 1419, 1419, 1432, 1432, 1433, 1433, 1438, 1438, 1445, 1445, 1464, 1464, 1468, 1468, 1471, 1471, 1472, 1472, 1476, 1476, 1477, 1477, 1480, 1480, 1489, 1500 ], [ 0, 0, 1, 2, 4, 5, 18, 19, 20, 26, 31, 33, 40, 41, 60, 62, 66, 69, 72, 73, 74, 77, 81, 83, 84, 87, 90, 91, 100, 100 ] ], [ [ 0, 1416, 1417, 1417, 1419, 1419, 1432, 1432, 1433, 1433, 1438, 1438, 1445, 1445, 1464, 1464, 1468, 1468, 1471, 1471, 1472, 1472, 1476, 1476, 1477, 1477, 1480, 1480, 1489, 1500 ], [ 0, 0, 1, 2, 4, 5, 18, 21, 22, 26, 31, 33, 40, 41, 60, 62, 66, 69, 72, 73, 74, 77, 81, 83, 84, 87, 90, 91, 100, 100 ] ], [ [ 0, 1416, 1417, 1417, 1419, 1419, 1432, 1432, 1433, 1433, 1438, 1438, 1445, 1445, 1463, 1463, 1467, 1467, 1471, 1471, 1472, 1472, 1476, 1476, 1478, 1478, 1480, 1480, 1489, 1500 ], [ 0, 0, 1, 2, 4, 5, 18, 19, 20, 26, 31, 33, 40, 41, 59, 61, 65, 68, 72, 73, 74, 77, 81, 83, 85, 88, 90, 91, 100, 100 ] ], [ [ 0, 1416, 1417, 1417, 1419, 1419, 1432, 1432, 1433, 1433, 1438, 1438, 1445, 1445, 1463, 1463, 1467, 1467, 1471, 1471, 1472, 1472, 1476, 1476, 1478, 1478, 1480, 1480, 1489, 1500 ], [ 0, 0, 1, 2, 4, 5, 18, 21, 22, 26, 31, 33, 40, 41, 59, 61, 65, 68, 72, 73, 74, 77, 81, 83, 85, 88, 90, 91, 100, 100 ] ], [ [ 0, 1416, 1417, 1417, 1419, 1419, 1432, 1432, 1433, 1433, 1438, 1438, 1445, 1445, 1464, 1464, 1467, 1467, 1471, 1471, 1472, 1472, 1476, 1476, 1478, 1478, 1480, 1480, 1489, 1500 ], [ 0, 0, 1, 2, 4, 5, 18, 19, 20, 26, 31, 33, 40, 41, 60, 62, 65, 68, 72, 73, 74, 77, 81, 83, 85, 88, 90, 91, 100, 100 ] ], [ [ 0, 1416, 1417, 1417, 1419, 1419, 1432, 1432, 1433, 1433, 1438, 1438, 1445, 1445, 1464, 1464, 1467, 1467, 1471, 1471, 1472, 1472, 1476, 1476, 1478, 1478, 1480, 1480, 1489, 1500 ], [ 0, 0, 1, 2, 4, 5, 18, 21, 22, 26, 31, 33, 40, 41, 60, 62, 65, 68, 72, 73, 74, 77, 81, 83, 85, 88, 90, 91, 100, 100 ] ], [ [ 0, 1416, 1417, 1417, 1419, 1419, 1432, 1432, 1433, 1433, 1438, 1438, 1445, 1445, 1463, 1463, 1468, 1468, 1471, 1471, 1472, 1472, 1476, 1476, 1478, 1478, 1480, 1480, 1489, 1500 ], [ 0, 0, 1, 2, 4, 5, 18, 19, 20, 26, 31, 33, 40, 41, 59, 61, 66, 69, 72, 73, 74, 77, 81, 83, 85, 88, 90, 91, 100, 100 ] ], [ [ 0, 1416, 1417, 1417, 1419, 1419, 1432, 1432, 1433, 1433, 1438, 1438, 1445, 1445, 1463, 1463, 1468, 1468, 1471, 1471, 1472, 1472, 1476, 1476, 1478, 1478, 1480, 1480, 1489, 1500 ], [ 0, 0, 1, 2, 4, 5, 18, 21, 22, 26, 31, 33, 40, 41, 59, 61, 66, 69, 72, 73, 74, 77, 81, 83, 85, 88, 90, 91, 100, 100 ] ], [ [ 0, 1416, 1417, 1417, 1419, 1419, 1432, 1432, 1433, 1433, 1438, 1438, 1445, 1445, 1464, 1464, 1468, 1468, 1471, 1471, 1472, 1472, 1476, 1476, 1478, 1478, 1480, 1480, 1489, 1500 ], [ 0, 0, 1, 2, 4, 5, 18, 19, 20, 26, 31, 33, 40, 41, 60, 62, 66, 69, 72, 73, 74, 77, 81, 83, 85, 88, 90, 91, 100, 100 ] ], [ [ 0, 1416, 1417, 1417, 1419, 1419, 1432, 1432, 1433, 1433, 1438, 1438, 1445, 1445, 1464, 1464, 1468, 1468, 1471, 1471, 1472, 1472, 1476, 1476, 1478, 1478, 1480, 1480, 1489, 1500 ], [ 0, 0, 1, 2, 4, 5, 18, 21, 22, 26, 31, 33, 40, 41, 60, 62, 66, 69, 72, 73, 74, 77, 81, 83, 85, 88, 90, 91, 100, 100 ] ] ], "tuples": [ [ 59, 0, 100, 14, 27, 13, 100, 73 ] ], "tupleFields": [ "identical", "ambiguousColumns", "columns", "mismatches", "gapColumns", "gapOpens", "readAligned", "referenceCovered" ], "variation": { "readAligned": { "shared": true, "min": 100, "max": 100 }, "referenceCovered": { "shared": true, "min": 73, "max": 73 }, "identity": { "shared": true, "min": { "numerator": 59, "denominator": 100 }, "max": { "numerator": 59, "denominator": 100 } }, "overhangStart": { "shared": true, "min": 0, "max": 0 }, "overhangEnd": { "shared": true, "min": 0, "max": 0 } }, "placements": [ { "refStart": 1417, "refEnd": 1489, "crossesOrigin": false, "wholeCircle": false, "readStart": 1, "readEnd": 100, "asSupplied": { "readStart": 1, "readEnd": 100 }, "alignments": 16, "band": { "diagonalMin": 1389, "diagonalMax": 1416, "cellsNeeded": 2877, "bandLimited": false } } ] } }, { "mode": "local", "region": null, "strand": "+", "strandUndetermined": false, "plus": { "score": 153, "count": 1, "overCap": false, "state": "aligned", "biopython": { "score": 153, "count": 1 }, "uniquePairs": [ [ 801, 1 ], [ 802, 2 ], [ 803, 3 ], [ 804, 4 ], [ 805, 5 ], [ 806, 6 ], [ 807, 7 ], [ 808, 8 ], [ 809, 9 ], [ 810, 10 ], [ 811, 11 ], [ 812, 12 ], [ 813, 13 ], [ 814, 14 ], [ 815, 15 ], [ 816, 16 ], [ 817, 17 ], [ 818, 18 ], [ 819, 19 ], [ 820, 20 ], [ 821, 21 ], [ 822, 22 ], [ 823, 23 ], [ 824, 24 ], [ 825, 25 ], [ 826, 26 ], [ 827, 27 ], [ 828, 28 ], [ 829, 29 ], [ 830, 30 ], [ 831, 31 ], [ 832, 32 ], [ 833, 33 ], [ 834, 34 ], [ 835, 35 ], [ 836, 36 ], [ 837, 37 ], [ 838, 38 ], [ 839, 39 ], [ 840, 40 ], [ 841, 41 ], [ 842, 42 ], [ 843, 43 ], [ 844, 44 ], [ 845, 45 ], [ 846, 46 ], [ 847, 47 ], [ 848, 48 ], [ 849, 49 ], [ 850, 50 ], [ 851, 51 ], [ 852, 52 ], [ 853, 53 ], [ 854, 54 ], [ 855, 55 ], [ 856, 56 ], [ 857, 57 ], [ 858, 58 ], [ 859, 59 ], [ 860, 60 ], [ 861, 61 ], [ 862, 62 ], [ 863, 63 ], [ 864, 64 ], [ 865, 65 ], [ 866, 66 ], [ 867, 67 ], [ 868, 68 ], [ 869, 69 ], [ 870, 70 ], [ 871, 71 ], [ 872, 72 ], [ 873, 73 ], [ 874, 74 ], [ 875, 75 ], [ 876, 76 ], [ 877, 77 ], [ 878, 78 ], [ 879, 79 ], [ 880, 80 ], [ 881, 81 ], [ 882, 82 ], [ 883, 83 ], [ 884, 84 ], [ 885, 85 ], [ 886, 86 ], [ 887, 87 ], [ 888, 88 ], [ 889, 89 ], [ 890, 90 ], [ 891, 91 ], [ 892, 92 ], [ 893, 93 ], [ 894, 94 ], [ 895, 95 ], [ 896, 96 ], [ 897, 97 ], [ 898, 98 ], [ 899, 99 ] ], "uniquePlacement": true, "placementNotDetermined": false, "noCommonColumn": false, "hull": { "refStart": 801, "refEnd": 899, "crossesOrigin": false, "wholeCircle": false }, "selected": { "coordinates": [ [ 800, 899 ], [ 0, 99 ] ], "gappedReference": "GATGCTGGTTGCCAACGATCAGATGGCGCTGGGCGCAATGCGCGCCATTACCGAGTCCGGGCTGCGCGTTGGTGCGGATATCTCGGTAGTGGGATACGA", "gappedRead": "GATGCTGGTAGCCAACGATGAGATGGCGCAGGGCGCAATTCGCGCCATTCCCGAGTCCGTGCTGCGCGTAGGTGCGGATCTCTCGGTAGAGGGATACGA", "columns": 99, "identical": 90, "mismatches": 9, "ambiguousColumns": 0, "gapColumns": 0, "gapOpens": 0, "identity": { "numerator": 90, "denominator": 99 }, "readAligned": { "bases": 99, "of": 100 }, "referenceCovered": { "bases": 99, "of": 1500 }, "placement": { "refStart": 801, "refEnd": 899, "readStart": 1, "readEnd": 99, "crossesOrigin": false }, "overhang": [], "differences": [ { "kind": "substitution", "ref": 810, "refBase": "T", "readBase": "A", "read": 10, "common": true }, { "kind": "substitution", "ref": 820, "refBase": "C", "readBase": "G", "read": 20, "common": true }, { "kind": "substitution", "ref": 830, "refBase": "T", "readBase": "A", "read": 30, "common": true }, { "kind": "substitution", "ref": 840, "refBase": "G", "readBase": "T", "read": 40, "common": true }, { "kind": "substitution", "ref": 850, "refBase": "A", "readBase": "C", "read": 50, "common": true }, { "kind": "substitution", "ref": 860, "refBase": "G", "readBase": "T", "read": 60, "common": true }, { "kind": "substitution", "ref": 870, "refBase": "T", "readBase": "A", "read": 70, "common": true }, { "kind": "substitution", "ref": 880, "refBase": "A", "readBase": "C", "read": 80, "common": true }, { "kind": "substitution", "ref": 890, "refBase": "T", "readBase": "A", "read": 90, "common": true } ] }, "band": { "diagonalMin": 800, "diagonalMax": 800, "cellsNeeded": 303, "unionBandLimited": false, "scope": "every optimal path", "gridCells": 151601, "searchedBanded": true, "sharedWords": 0, "sharedWordsOverCap": false, "seedGuarantee": { "differencesUpTo": 23, "guaranteed": false } }, "enumeration": "listed", "alignments": [ [ [ 800, 899 ], [ 0, 99 ] ] ], "tuples": [ [ 90, 0, 99, 9, 0, 0, 99, 99 ] ], "tupleFields": [ "identical", "ambiguousColumns", "columns", "mismatches", "gapColumns", "gapOpens", "readAligned", "referenceCovered" ], "variation": { "readAligned": { "shared": true, "min": 99, "max": 99 }, "referenceCovered": { "shared": true, "min": 99, "max": 99 }, "identity": { "shared": true, "min": { "numerator": 10, "denominator": 11 }, "max": { "numerator": 10, "denominator": 11 } }, "overhangStart": { "shared": true, "min": 0, "max": 0 }, "overhangEnd": { "shared": true, "min": 0, "max": 0 } }, "placements": [ { "refStart": 801, "refEnd": 899, "crossesOrigin": false, "wholeCircle": false, "readStart": 1, "readEnd": 99, "alignments": 1, "band": { "diagonalMin": 800, "diagonalMax": 800, "cellsNeeded": 303, "bandLimited": false } } ] }, "minus": { "score": 25, "count": 1, "overCap": false, "state": "aligned", "biopython": { "score": 25, "count": 1 }, "uniquePairs": [ [ 1439, 34 ], [ 1440, 35 ], [ 1441, 36 ], [ 1442, 37 ], [ 1443, 38 ], [ 1444, 39 ], [ 1445, 40 ], [ 1446, 42 ], [ 1447, 43 ], [ 1448, 44 ], [ 1449, 45 ], [ 1450, 46 ], [ 1451, 47 ], [ 1452, 48 ], [ 1453, 49 ], [ 1454, 50 ], [ 1455, 51 ], [ 1456, 52 ], [ 1457, 53 ], [ 1458, 54 ], [ 1459, 55 ], [ 1460, 56 ], [ 1461, 57 ], [ 1462, 58 ], [ 1463, 59 ] ], "uniquePlacement": true, "placementNotDetermined": false, "noCommonColumn": false, "hull": { "refStart": 1439, "refEnd": 1463, "crossesOrigin": false, "wholeCircle": false }, "selected": { "coordinates": [ [ 1438, 1445, 1445, 1463 ], [ 33, 40, 41, 59 ] ], "gappedReference": "GCGCAGC-CTGAATGGCGAATGGCGC", "gappedRead": "GCGCAGCACGGACTCGGGAATGGCGC", "columns": 26, "identical": 21, "mismatches": 4, "ambiguousColumns": 0, "gapColumns": 1, "gapOpens": 1, "identity": { "numerator": 21, "denominator": 26 }, "readAligned": { "bases": 26, "of": 100 }, "referenceCovered": { "bases": 25, "of": 1500 }, "placement": { "refStart": 1439, "refEnd": 1463, "readStart": 34, "readEnd": 59, "crossesOrigin": false, "asSupplied": { "readStart": 42, "readEnd": 67 } }, "overhang": [], "differences": [ { "kind": "insertion", "refAfter": 1445, "length": 1, "bases": "A", "readStart": 41, "readEnd": 41, "asSupplied": { "readStart": 60, "readEnd": 60, "bases": "T" }, "common": true }, { "kind": "substitution", "ref": 1447, "refBase": "T", "readBase": "G", "read": 43, "common": true, "asSupplied": { "read": 58, "readBase": "C" } }, { "kind": "substitution", "ref": 1450, "refBase": "A", "readBase": "C", "read": 46, "common": true, "asSupplied": { "read": 55, "readBase": "G" } }, { "kind": "substitution", "ref": 1452, "refBase": "G", "readBase": "C", "read": 48, "common": true, "asSupplied": { "read": 53, "readBase": "G" } }, { "kind": "substitution", "ref": 1454, "refBase": "C", "readBase": "G", "read": 50, "common": true, "asSupplied": { "read": 51, "readBase": "C" } } ] }, "band": { "diagonalMin": 1404, "diagonalMax": 1405, "cellsNeeded": 386, "unionBandLimited": false, "scope": "every optimal path", "gridCells": 151601, "searchedBanded": true, "sharedWords": 0, "sharedWordsOverCap": false, "seedGuarantee": { "differencesUpTo": 87, "guaranteed": false } }, "enumeration": "listed", "alignments": [ [ [ 1438, 1445, 1445, 1463 ], [ 33, 40, 41, 59 ] ] ], "tuples": [ [ 21, 0, 26, 4, 1, 1, 26, 25 ] ], "tupleFields": [ "identical", "ambiguousColumns", "columns", "mismatches", "gapColumns", "gapOpens", "readAligned", "referenceCovered" ], "variation": { "readAligned": { "shared": true, "min": 26, "max": 26 }, "referenceCovered": { "shared": true, "min": 25, "max": 25 }, "identity": { "shared": true, "min": { "numerator": 21, "denominator": 26 }, "max": { "numerator": 21, "denominator": 26 } }, "overhangStart": { "shared": true, "min": 0, "max": 0 }, "overhangEnd": { "shared": true, "min": 0, "max": 0 } }, "placements": [ { "refStart": 1439, "refEnd": 1463, "crossesOrigin": false, "wholeCircle": false, "readStart": 34, "readEnd": 59, "asSupplied": { "readStart": 42, "readEnd": 67 }, "alignments": 1, "band": { "diagonalMin": 1404, "diagonalMax": 1405, "cellsNeeded": 386, "bandLimited": false } } ] } } ] } }, { "id": "long-read-origin", "note": "7j: a 1,000-base read across the origin of a 6,646-base circle (J01566.1, circular as recorded), with one 3-base insertion and one 4-base deletion: the production regime at full size, its truth from Biopython on the certified text.", "input": { "reference": { "residues": "TTCTATGCTCCTATATTGATAAGAATAAACTTAATACTATAAATGAGGTGTTAGGGATTTAATTATTCTTTATTGATATAAAAAGTCCTAGCAATCCAAATGGGATTGCTAGGACCAAACAAAGTAGATTATATAGCATAAATAGGTTTAATTTTGCTACGGGGGCGTTATTTAGGTTTTTTCTTCTTTCGAAAAAATCTTTCTTTATGAAGTTAAAAGCTATGTATTCAATAGCATATTTTGAATATGGACATAGAATAGTGCTTATCACTATTGCATATAGCATCTTATCTGACACAAGGAAATAATACCCTTCGCTGTTTTTTGTTATAAGGTATATATATATAAGTGTGCAGTACAGGCCAAATAAAATATTTTTTATGTAGTATCTTAAGCTCATAAATTAAACCTCGCCATATATTCTTTTCATTTTATAAGGATCGAGTTATGAGGAAAAGATTTTTTGTGGGAATATTCGCGATAAACCTCCTTGTTGGATGTCAGGCTAACTATATACCTGATGTTCAGGGAGGGACCATCGCACCATCCTCCTCTTCTAAACTGACGGGGATCGCGGTTCAGTAGAAAAGATTAAAGGATCTTCTTGAGATCCTTTTTTTCTGCGCGTAATCTGCTGCTTGCAAACAAAAAAACCACCGCTACCAACGGTGGTTTGTTTGCCGGATCAAGAGCTACCAACTCTTTTTCCGAAGGTAACTGGCTTCAGCAGAGCGCAGATACCAAATACTGTCCTTCTAGTGTAGCCGTAGTCGGGCCACTACTTCAAGAACTCTGTAGCACCGTTTGTGCCATCATCGCTCTGCTAATCCGGTTACCAGTGGCTGCTGCCAGTGGCGTTAAGGCGTGCCTTACCGGGTTGGACTCAAGACGATAGTTACCGGATAAGGCGCAGCGGTCGGGCTGAACGGGGGGTTCGTGCACACAGCCCAGCTTGGAGCGAACGACCTACACCGAACTGAGATACCAACAGCGTGAGCTATGAGAAAGCGCCACGCTTCCCGAAGGGAGAAAGGCGGACAGGTATCCGGTAAGCGGCAGGGTCGGAACAGGAGAGCGCACGAGGGAGCTTCCAGGGGGAAACGCCTGGTAGCTTTATAGTCCTGTCGGGTTTCGCCACCTCTGACTTGAGCGTCTATTTTTGTGATGCTCGTCAGGGGGGCGGAGCCTATGGAAAAACGCCTGCTACGTGGCCTTCTTCCTGTTCCTGGTCTTTTGCTCACATGTTCTTTCCGGCCTTATCCCCTGATTCTGTGGATAACTGTGTTACCGTTTTTGTGTGAGTCAGTACCGCTCGCCGCAGTCGAACGACCGAGCGTAGCGAGTCAGTGAGCGAGGAAGCGGAAAAGCGCCTGGACGTGCATTTTCTCCTTACGCATCTGTGCGGCATTTCACACCCGGCATGGCGTACTTTTCATACAATCCGCACTGATGCCGCATGGTTAAGCCAGTATACACTCCGCTATCGCTACGTGACTGGGTCAGGGCTGCGCCCCGACACCCGCTAAAACCTGCTGACGCGCCCTGACGGGCTTGTCAGCTCCCGGCATCCGCTCACAGACAAGCTGTGACCGTCTCCGGGAGCTGCATGTGTCAGAGGTTTTCACCGTCATCCCCGAAACGTGCGAGGCAGCTGCGGTAAAGCTCATCGGCGTGGTCGTGAAGCGATTCACAAATATCGGCCTGTTCATCTGCGTCCAGTTCGTTGAGCTTCTCCAGCAGCGTTAATGTCTGGCTTCTGATAAAGCGGGCCATGTTAAGGGCGGTTTTTTCCTGTTTAGTCACTGATGCCTCCGTGTAAGGGGGATTTCTGTTCATGGGGTAATGATACCGATGAAACGCGAGAGGATGCTCACAATACGGGTTACTGATGATGAACATGCCCGGTTACTTGAACGCTGTGAGGGTAAACAACTGGCGGTATGGATGCGGCGGGTCTGCCTGGGGGAGCCGGTTGCCCGTTCCGGAAAACTGCCGACACTGGCACCGCCGTTACTGCGTCAGCTGGCCGCCATCGGAAATAACCTGAATCAGACAGCCCGTAAGGTGAACAGCGGGCAGTGGTCTTCCGGTGACCGGGTTCAGGTGGTGGCCGCACTGATGGCCATCGGGGATGAGCTGCGCCGGCTGCGTCTGGCTGTCAGGGAACAGGGGGCGCGGGATGATAGTTAAATTTCATGCCAGGGGAAAAGGTGGTGGCAGTGGTCCGGTTGATTACCTGCTGGGGAGGGAGCGTAACCGCGAAGGCGCAACGGTGCTTCAGGGTATACCGGAAGAAGTCCGGGAACTCATCGATGCCACGCCATTTGCGAAGAAATACACGTCCGGTGTTCTGTCGTTCGCGGAGAAGGAGCTGCCGCCGGGAGGACGTGAAAAAGTGATGGCGAGCTTTGAGCGTGTACTGATGCCCGGTCTCGAAAAAAATCAGTACAGCATCCTGTGGGTGGAGCACCAGGACAAGGGACGGCTTGAGCTGAATTTTGTCATTCCGAACATGGAGCTACAGACCGGAAAACGCCTCCAGCCGTACTACGACCGCGCAGACAGGCCTAGAATTGATGCTTGGCAGACGCTGTTAAATCACCATTACGGGCTGCATGACCCGAACGCCCCGGAGAACCGCAGGACGCTGACACTCCCTGATAACCTGCCTGAAACGAAACAGGCGCTTGCTGAGGGCGTCACGCGAGGTATAGATGCACTTTACCATGCCGGAGAGATAAAAGGCCGTCAGGATGTGATTCAGGCGCTCACTGAGGCGGGGCTGGAAGTGGTCAGGGTGACGCGAAGCAGTATCAGCATTGCAGATCCGAACGGCGGGAAGAATATCAGGCTGAAAGGAGCATTTTATGAGCAATCTTTTGCAGACGGGCGCGGAGTTCGAGAAAAAGCTGAAAGAGAGAGCCGAATCTACAGAGAAAATGCTGAACAACGAGTTCAGGAGGCTCGGCGAATCTGTAAGCGAGGCTGTGACATCAAACGAGACGAAAATCAGAGACGCTATAGCCCTGTTCACAGCCTCGACAGAGGAATCGCTGGAAAAACACCGGGAAGGGGTGAAAGAGGCGATGATGCAGCACAGGAGGGACGTGTTAAAGCTGGCAGGGAATACGGGCATGATGTTACTGGGGATAGTCTTTCTCCTGTTTACCGCGAGTGGCGGGACGCTCTGGTATCTTGGAGGGAGGATACAGGCGAACCTGGAAGAAATCAGGAAGCAGGAAGAGACATTGCAGAAACTGAACGCGAAGACATGGGGCGTGGAGTTTGTGCAGGACGGGAACAGGAAATTCCTTGTCCTTCCGTACGGGAAATCAGCGGAGGTGATTCCCTTTCAGGGGAAAGAGTGGGTACATCTGAAGGAGTGACACAGAGTGACAGAGCTGGAAACACATTTGCTGAACGCCTTAGAGCAGCTGCAACAGGACTATATGCAGCGGCTGAGCGAATGGGAGAGCGCCTTCGTGGAATTGCAGAAGATGTTTTCGCTTACGCAACGGGACAACGCGATGCTGAACGAGCGGGTCATGCAGTTGAGTCAGCAGGTGCAACACTTGAGCGAGCAGACAGAACGCTTGAGCCAGTTATACAGCGAGAACTGGAGATAAGAGAGGAACGGCTGATACAGGAGCGCGAACATGTGTTATCCCTAGAACGGGAGCGTCAGCCGGAAATACAGGAACGCACGCTGGATGGCCCTTCGCTGGGATGGTGAAACCATGAAAAATGGCAGCTTCAGTGGATTAAGTGGGGGTAATGTGGCCTGTACCCTCTGGTTGCATAGGTATTCATACGGTTAAAATTTATCAGGCGCGATCGCGCAGTTTTTAGGGTGGTTTGTTGCCATTTTTACCTGTCTGCTGCCGTGATCGCGCTGAACGCGTTTTAGCGGTGCGTACAATTAAGGGATTATGGTAAATCCACTTACTGTCTGCCCTCGTAGCCATCGAGATAAACCGCAGAAATCGTGTCAGCCAGCAGCCTGGATTTTTTCGGGGTAAGGTCTTTGCTGCGGTAATCAGTACCCGCAAATTGAGTTGTGCCCCGGAGTGAGTTTAAAAATTCTTGGCTGTGAAACTGCTGAATGCGTTGTTGCACATCACTCCGTGATTTTCCTGTCGCTTTGTCTTTAGCTCCCATATCCCAGAACTGCCGAAAAAAAGGCACCATCATTCGTGTTGTGTCGGCTTTTTGGGTGGAAAAGTTGGGATCAAAACCGTCATCAGAAGCATATACGTAATGCCGGGTATGTTGTTCCACGCTGCCCTTTGGGGTACAGGCTGTGAGAGCTACTGTTGCTGTTATCATGGCGATAAGACAAAGTTTGTTTCCGGTACGTCTCATGAGTGTCTCCCTACCTTAAAGTATTTATTCTCGGTGAGTTATTATCCGAAGACTATTTTATCATCAGTCTCTGACAGCGTTCAGCGACCGAACAACCTGGACCAGAATCCCCGTTTCTTTTCCAGTTCCAGTGCCTGCCTGAGCTGGGCTATCTCATTTTGTAGCTGTTCCCGTTCTGCTTCCTGGCGTCTGCGATCCATATCCTGTGCCTGTTTATCCTCAAGCATCAGCGTCAGGCATTGTTTCAGCTCATTCAGTTCCCGGAGAATGCGTTCTGTCTGCTGATCATGTGGATTTTCTGCATGTCCCTCACTGTGCCTTTCTGGTGTCTCATTCTGCTTTAATTCGCCGTATGCCCGGATCAGTTCACTGGTTTCAAACTCCCGTCGTCCGTCCCTGCCGGTACGGTAACTGACAAGGCCTCCGCGCATATCACGGTAAAACTGTGAACGCGATCTGCCTGTCATTTTTAGTGCGTCCCGGAGTGTGTGCCATGCCATAAAGTGACAGTGTCCCATAGATGTCTCATCTCATAGTTTCAGTAAAACATAATGAGGTCTGAGAACGGTAATGTTTGTGCTGGTTTTTGTGGCATCGGGCGAGAATAGCGCGTGGTGTGAAAGACTGTTTTTTTGATCGTTTTCACAAAAATGGAAGTCCACAGTCTTGACAGGGAAAATGCAGCGGCGTAGCTTTTATGCTGTATATAAAACCAGTGGTTATATGTACAGTATTTATTTTTAACTTATTGTTTTAAAAGTCAAAGAGGATTTTATAATGGAAACCGCGGTAGCGTACTATAAAGATGGTGTTCCTTATGATGATAAGGGACAGGTAATTATTACTCTTTTGAATGGTACTCCTGACGGGAGTGGCTCTGGCGGCGGAGGTGGAAAAGGAGGCAGTAAAAGTGAAAGTTCTGCAGCTATTCATGCAACTGCTAAATGGTCTACTGCTCAATTAAAGAAAACACAGGCAGAGCAGGCTGCCCGGGCAAAAGCTGCAGCGGAAGCACAGGCGAAAGCAAAGGCAAACAGGGATGCGCTGACTCAGCGCCTGAAGGATATCGTGAATGAGGCTCTTCGTCACAATGCCTCACGTACGCCTTCAGCAACAGAGCTTGCTCATGCTAATAATGCAGCTATGCAGGCGGAAGCAGAGCGTTTGCGCCTTGCGAAAGCAGAAGAAAAAGCCCGTAAAGAAGCGGAAGCAGCAGAAAAGGCTTTTCAGGAAGCAGAACAACGACGTAAAGAGATTGAACGGGAGAAGGCTGAAACAGAACGCCAGTTGAAACTGGCTGAAGCTGAAGAGAAACGACTGGCTGCATTGAGTGAAGAAGCTAAAGCTGTTGAGATCGCCCAAAAAAAACTTTCTGCTGCACAATCTGAAGTGGTGAAAATGGATGGAGAGATTAAGACTCTCAATTCTCGTTTAAGCTCCAGTATCCATGCCCGTGATGCAGAAATGAAAACGCTCGCTGGAAAACGAAATGAACTGGCTCAGGCATCCGCTAAATATAAAGAACTGGATGAGCTGGTCAAAAAACTATCACCAAGAGCCAATGATCCGCTTCAGAACCGTCCTTTTTTTGAAGCAACCAGACGACGGGTTGGGGCCGGTAAGATTAGAGAAGAAAAACAAAAACAGGTAACAGCATCAGAAACACGTATTAACCGGATAAATGCTGATATAACTCAGATCCAGAAGGCTATTTCTCAGGTCAGTAATAATCGTAATGCCGGTATCGCTCGTGTTCATGAAGCTGAAGAAAATTTGAAAAAAGCACAGAATAATCTCCTTAATTCACAGATTAAGGATGCTGTTGATGCAACAGTTAGCTTTTATCAAACGCTGACTGAAAAATATGGTGAAAAATATTCGAAAATGGCACAGGAACTTGCTGATAAGTCTAAAGGTAAGAAAATCGGCAATGTGAATGAAGCTCTCGCTGCTTTTGAAAAATACAAGGATGTTTTAAATAAGAAATTCAGCAAAGCCGATCGTGATGCTATTTTTAATGCGTTGGCATCGGTGAAGTATGATGACTGGGCTAAACATTTAGATCAGTTTGCCAAGTACTTGAAGATTACGGGGCATGTTTCTTTTGGATATGATGTGGTATCTGATATCCTAAAAATTAAGGATACAGGTGACTGGAAGCCACTATTTCTTACATTAGAGAAGAAAGCTGCAGATGCAGGGGTGAGTTATGTTGTTGCTTTACTTTTTAGCTTGCTTGCTGGAACTACATTAGGTATTTGGGGTATTGCTATTGTTACAGGAA", "topology": "circular", "source": "J01566.1, circular, 6,646 bases" }, "read": { "residues": "ACAGAATAATCTCCTTAATTCACAGATTAAGGATGCTGTTGATGCAACAGTTAGCTTTTATCAAACGCTGACTGAAAAATATGGTGAAAAATATTCGAAAATGGCACAGGAACTTGCTGATAAGTCTAAAGGTAAGAAAATCGGCAATGTGAATGAAGCTCTCGCTGCTTTTGAAAAATACAAGGATGTTTTAAATAAGAAATTCAGCAAAGCCGATCGTGATGCTATTTTTAATGCGTTGGCATCGGTGCATAAGTATGATGACTGGGCTAAACATTTAGATCAGTTTGCCAAGTACTTGAAGATTACGGGGCATGTTTCTTTTGGATATGATGTGGTATCTGATATCCTAAAAATTAAGGATACAGGTGACTGGAAGCCACTATTTCTTACATTAGAGAAGAAAGCTGCAGATGCAGGGGTGAGTTATGTTGTTGCTTTACTTTTTAGCTTGCTTGCTGGAACTACATTAGGTATTTGGGGTATTGCTATTGTTACAGGAATTCTATGCTCCTATATTGATAAGAATAAACTTAATACTATAAATGAGGTGTTAGGGATTTAATTATTCTTTATTGATATAAAAAGTCCTAGCAATCCAAATGGGATTGCTAGGACCAAACAAAGTAGATTATATAGCATAAATAGGTTTAATTTTGCTACGGGGGCGTTATTTAGGTTTTTTCTTCTTTCGAAAAAATCTTTCTTTATGAAGTTAAAAGCTATGTATTCAATAGCATATTTTGAATATGGAGAATAGTGCTTATCACTATTGCATATAGCATCTTATCTGACACAAGGAAATAATACCCTTCGCTGTTTTTTGTTATAAGGTATATATATATAAGTGTGCAGTACAGGCCAAATAAAATATTTTTTATGTAGTATCTTAAGCTCATAAATTAAACCTCGCCATATATTCTTTTCATTTTATAAGGATCGAGTTATGAGGAAAAGATTTTTTGTGGGAATATTCGCGATAAACCTCCTTGTTGGATGT", "source": "J01566.1 6147-6646 then 1-501, CAT inserted after read base 250, reference bases 251-254 of the second part (J01566.1 251-254) deleted" }, "modes": [ "semiglobal-read" ] }, "expected": { "results": [ { "mode": "semiglobal-read", "region": null, "strand": "+", "strandUndetermined": false, "plus": { "score": 1974, "count": 2, "overCap": false, "state": "aligned", "biopython": { "score": 1974, "count": 2, "tailScore": -26, "tailCountSubtracted": 0, "certifiedText": { "extension": 1000, "textLength": 8645, "reruns": 0, "differencesUpTo": 13 } }, "uniquePairs": [ [ 6147, 1 ], [ 6148, 2 ], [ 6149, 3 ], [ 6150, 4 ], [ 6151, 5 ], [ 6152, 6 ], [ 6153, 7 ], [ 6154, 8 ], [ 6155, 9 ], [ 6156, 10 ], [ 6157, 11 ], [ 6158, 12 ], [ 6159, 13 ], [ 6160, 14 ], [ 6161, 15 ], [ 6162, 16 ], [ 6163, 17 ], [ 6164, 18 ], [ 6165, 19 ], [ 6166, 20 ], [ 6167, 21 ], [ 6168, 22 ], [ 6169, 23 ], [ 6170, 24 ], [ 6171, 25 ], [ 6172, 26 ], [ 6173, 27 ], [ 6174, 28 ], [ 6175, 29 ], [ 6176, 30 ], [ 6177, 31 ], [ 6178, 32 ], [ 6179, 33 ], [ 6180, 34 ], [ 6181, 35 ], [ 6182, 36 ], [ 6183, 37 ], [ 6184, 38 ], [ 6185, 39 ], [ 6186, 40 ], [ 6187, 41 ], [ 6188, 42 ], [ 6189, 43 ], [ 6190, 44 ], [ 6191, 45 ], [ 6192, 46 ], [ 6193, 47 ], [ 6194, 48 ], [ 6195, 49 ], [ 6196, 50 ], [ 6197, 51 ], [ 6198, 52 ], [ 6199, 53 ], [ 6200, 54 ], [ 6201, 55 ], [ 6202, 56 ], [ 6203, 57 ], [ 6204, 58 ], [ 6205, 59 ], [ 6206, 60 ], [ 6207, 61 ], [ 6208, 62 ], [ 6209, 63 ], [ 6210, 64 ], [ 6211, 65 ], [ 6212, 66 ], [ 6213, 67 ], [ 6214, 68 ], [ 6215, 69 ], [ 6216, 70 ], [ 6217, 71 ], [ 6218, 72 ], [ 6219, 73 ], [ 6220, 74 ], [ 6221, 75 ], [ 6222, 76 ], [ 6223, 77 ], [ 6224, 78 ], [ 6225, 79 ], [ 6226, 80 ], [ 6227, 81 ], [ 6228, 82 ], [ 6229, 83 ], [ 6230, 84 ], [ 6231, 85 ], [ 6232, 86 ], [ 6233, 87 ], [ 6234, 88 ], [ 6235, 89 ], [ 6236, 90 ], [ 6237, 91 ], [ 6238, 92 ], [ 6239, 93 ], [ 6240, 94 ], [ 6241, 95 ], [ 6242, 96 ], [ 6243, 97 ], [ 6244, 98 ], [ 6245, 99 ], [ 6246, 100 ], [ 6247, 101 ], [ 6248, 102 ], [ 6249, 103 ], [ 6250, 104 ], [ 6251, 105 ], [ 6252, 106 ], [ 6253, 107 ], [ 6254, 108 ], [ 6255, 109 ], [ 6256, 110 ], [ 6257, 111 ], [ 6258, 112 ], [ 6259, 113 ], [ 6260, 114 ], [ 6261, 115 ], [ 6262, 116 ], [ 6263, 117 ], [ 6264, 118 ], [ 6265, 119 ], [ 6266, 120 ], [ 6267, 121 ], [ 6268, 122 ], [ 6269, 123 ], [ 6270, 124 ], [ 6271, 125 ], [ 6272, 126 ], [ 6273, 127 ], [ 6274, 128 ], [ 6275, 129 ], [ 6276, 130 ], [ 6277, 131 ], [ 6278, 132 ], [ 6279, 133 ], [ 6280, 134 ], [ 6281, 135 ], [ 6282, 136 ], [ 6283, 137 ], [ 6284, 138 ], [ 6285, 139 ], [ 6286, 140 ], [ 6287, 141 ], [ 6288, 142 ], [ 6289, 143 ], [ 6290, 144 ], [ 6291, 145 ], [ 6292, 146 ], [ 6293, 147 ], [ 6294, 148 ], [ 6295, 149 ], [ 6296, 150 ], [ 6297, 151 ], [ 6298, 152 ], [ 6299, 153 ], [ 6300, 154 ], [ 6301, 155 ], [ 6302, 156 ], [ 6303, 157 ], [ 6304, 158 ], [ 6305, 159 ], [ 6306, 160 ], [ 6307, 161 ], [ 6308, 162 ], [ 6309, 163 ], [ 6310, 164 ], [ 6311, 165 ], [ 6312, 166 ], [ 6313, 167 ], [ 6314, 168 ], [ 6315, 169 ], [ 6316, 170 ], [ 6317, 171 ], [ 6318, 172 ], [ 6319, 173 ], [ 6320, 174 ], [ 6321, 175 ], [ 6322, 176 ], [ 6323, 177 ], [ 6324, 178 ], [ 6325, 179 ], [ 6326, 180 ], [ 6327, 181 ], [ 6328, 182 ], [ 6329, 183 ], [ 6330, 184 ], [ 6331, 185 ], [ 6332, 186 ], [ 6333, 187 ], [ 6334, 188 ], [ 6335, 189 ], [ 6336, 190 ], [ 6337, 191 ], [ 6338, 192 ], [ 6339, 193 ], [ 6340, 194 ], [ 6341, 195 ], [ 6342, 196 ], [ 6343, 197 ], [ 6344, 198 ], [ 6345, 199 ], [ 6346, 200 ], [ 6347, 201 ], [ 6348, 202 ], [ 6349, 203 ], [ 6350, 204 ], [ 6351, 205 ], [ 6352, 206 ], [ 6353, 207 ], [ 6354, 208 ], [ 6355, 209 ], [ 6356, 210 ], [ 6357, 211 ], [ 6358, 212 ], [ 6359, 213 ], [ 6360, 214 ], [ 6361, 215 ], [ 6362, 216 ], [ 6363, 217 ], [ 6364, 218 ], [ 6365, 219 ], [ 6366, 220 ], [ 6367, 221 ], [ 6368, 222 ], [ 6369, 223 ], [ 6370, 224 ], [ 6371, 225 ], [ 6372, 226 ], [ 6373, 227 ], [ 6374, 228 ], [ 6375, 229 ], [ 6376, 230 ], [ 6377, 231 ], [ 6378, 232 ], [ 6379, 233 ], [ 6380, 234 ], [ 6381, 235 ], [ 6382, 236 ], [ 6383, 237 ], [ 6384, 238 ], [ 6385, 239 ], [ 6386, 240 ], [ 6387, 241 ], [ 6388, 242 ], [ 6389, 243 ], [ 6390, 244 ], [ 6391, 245 ], [ 6392, 246 ], [ 6393, 247 ], [ 6394, 248 ], [ 6395, 249 ], [ 6396, 250 ], [ 6397, 254 ], [ 6398, 255 ], [ 6399, 256 ], [ 6400, 257 ], [ 6401, 258 ], [ 6402, 259 ], [ 6403, 260 ], [ 6404, 261 ], [ 6405, 262 ], [ 6406, 263 ], [ 6407, 264 ], [ 6408, 265 ], [ 6409, 266 ], [ 6410, 267 ], [ 6411, 268 ], [ 6412, 269 ], [ 6413, 270 ], [ 6414, 271 ], [ 6415, 272 ], [ 6416, 273 ], [ 6417, 274 ], [ 6418, 275 ], [ 6419, 276 ], [ 6420, 277 ], [ 6421, 278 ], [ 6422, 279 ], [ 6423, 280 ], [ 6424, 281 ], [ 6425, 282 ], [ 6426, 283 ], [ 6427, 284 ], [ 6428, 285 ], [ 6429, 286 ], [ 6430, 287 ], [ 6431, 288 ], [ 6432, 289 ], [ 6433, 290 ], [ 6434, 291 ], [ 6435, 292 ], [ 6436, 293 ], [ 6437, 294 ], [ 6438, 295 ], [ 6439, 296 ], [ 6440, 297 ], [ 6441, 298 ], [ 6442, 299 ], [ 6443, 300 ], [ 6444, 301 ], [ 6445, 302 ], [ 6446, 303 ], [ 6447, 304 ], [ 6448, 305 ], [ 6449, 306 ], [ 6450, 307 ], [ 6451, 308 ], [ 6452, 309 ], [ 6453, 310 ], [ 6454, 311 ], [ 6455, 312 ], [ 6456, 313 ], [ 6457, 314 ], [ 6458, 315 ], [ 6459, 316 ], [ 6460, 317 ], [ 6461, 318 ], [ 6462, 319 ], [ 6463, 320 ], [ 6464, 321 ], [ 6465, 322 ], [ 6466, 323 ], [ 6467, 324 ], [ 6468, 325 ], [ 6469, 326 ], [ 6470, 327 ], [ 6471, 328 ], [ 6472, 329 ], [ 6473, 330 ], [ 6474, 331 ], [ 6475, 332 ], [ 6476, 333 ], [ 6477, 334 ], [ 6478, 335 ], [ 6479, 336 ], [ 6480, 337 ], [ 6481, 338 ], [ 6482, 339 ], [ 6483, 340 ], [ 6484, 341 ], [ 6485, 342 ], [ 6486, 343 ], [ 6487, 344 ], [ 6488, 345 ], [ 6489, 346 ], [ 6490, 347 ], [ 6491, 348 ], [ 6492, 349 ], [ 6493, 350 ], [ 6494, 351 ], [ 6495, 352 ], [ 6496, 353 ], [ 6497, 354 ], [ 6498, 355 ], [ 6499, 356 ], [ 6500, 357 ], [ 6501, 358 ], [ 6502, 359 ], [ 6503, 360 ], [ 6504, 361 ], [ 6505, 362 ], [ 6506, 363 ], [ 6507, 364 ], [ 6508, 365 ], [ 6509, 366 ], [ 6510, 367 ], [ 6511, 368 ], [ 6512, 369 ], [ 6513, 370 ], [ 6514, 371 ], [ 6515, 372 ], [ 6516, 373 ], [ 6517, 374 ], [ 6518, 375 ], [ 6519, 376 ], [ 6520, 377 ], [ 6521, 378 ], [ 6522, 379 ], [ 6523, 380 ], [ 6524, 381 ], [ 6525, 382 ], [ 6526, 383 ], [ 6527, 384 ], [ 6528, 385 ], [ 6529, 386 ], [ 6530, 387 ], [ 6531, 388 ], [ 6532, 389 ], [ 6533, 390 ], [ 6534, 391 ], [ 6535, 392 ], [ 6536, 393 ], [ 6537, 394 ], [ 6538, 395 ], [ 6539, 396 ], [ 6540, 397 ], [ 6541, 398 ], [ 6542, 399 ], [ 6543, 400 ], [ 6544, 401 ], [ 6545, 402 ], [ 6546, 403 ], [ 6547, 404 ], [ 6548, 405 ], [ 6549, 406 ], [ 6550, 407 ], [ 6551, 408 ], [ 6552, 409 ], [ 6553, 410 ], [ 6554, 411 ], [ 6555, 412 ], [ 6556, 413 ], [ 6557, 414 ], [ 6558, 415 ], [ 6559, 416 ], [ 6560, 417 ], [ 6561, 418 ], [ 6562, 419 ], [ 6563, 420 ], [ 6564, 421 ], [ 6565, 422 ], [ 6566, 423 ], [ 6567, 424 ], [ 6568, 425 ], [ 6569, 426 ], [ 6570, 427 ], [ 6571, 428 ], [ 6572, 429 ], [ 6573, 430 ], [ 6574, 431 ], [ 6575, 432 ], [ 6576, 433 ], [ 6577, 434 ], [ 6578, 435 ], [ 6579, 436 ], [ 6580, 437 ], [ 6581, 438 ], [ 6582, 439 ], [ 6583, 440 ], [ 6584, 441 ], [ 6585, 442 ], [ 6586, 443 ], [ 6587, 444 ], [ 6588, 445 ], [ 6589, 446 ], [ 6590, 447 ], [ 6591, 448 ], [ 6592, 449 ], [ 6593, 450 ], [ 6594, 451 ], [ 6595, 452 ], [ 6596, 453 ], [ 6597, 454 ], [ 6598, 455 ], [ 6599, 456 ], [ 6600, 457 ], [ 6601, 458 ], [ 6602, 459 ], [ 6603, 460 ], [ 6604, 461 ], [ 6605, 462 ], [ 6606, 463 ], [ 6607, 464 ], [ 6608, 465 ], [ 6609, 466 ], [ 6610, 467 ], [ 6611, 468 ], [ 6612, 469 ], [ 6613, 470 ], [ 6614, 471 ], [ 6615, 472 ], [ 6616, 473 ], [ 6617, 474 ], [ 6618, 475 ], [ 6619, 476 ], [ 6620, 477 ], [ 6621, 478 ], [ 6622, 479 ], [ 6623, 480 ], [ 6624, 481 ], [ 6625, 482 ], [ 6626, 483 ], [ 6627, 484 ], [ 6628, 485 ], [ 6629, 486 ], [ 6630, 487 ], [ 6631, 488 ], [ 6632, 489 ], [ 6633, 490 ], [ 6634, 491 ], [ 6635, 492 ], [ 6636, 493 ], [ 6637, 494 ], [ 6638, 495 ], [ 6639, 496 ], [ 6640, 497 ], [ 6641, 498 ], [ 6642, 499 ], [ 6643, 500 ], [ 6644, 501 ], [ 6645, 502 ], [ 6646, 503 ], [ 1, 504 ], [ 2, 505 ], [ 3, 506 ], [ 4, 507 ], [ 5, 508 ], [ 6, 509 ], [ 7, 510 ], [ 8, 511 ], [ 9, 512 ], [ 10, 513 ], [ 11, 514 ], [ 12, 515 ], [ 13, 516 ], [ 14, 517 ], [ 15, 518 ], [ 16, 519 ], [ 17, 520 ], [ 18, 521 ], [ 19, 522 ], [ 20, 523 ], [ 21, 524 ], [ 22, 525 ], [ 23, 526 ], [ 24, 527 ], [ 25, 528 ], [ 26, 529 ], [ 27, 530 ], [ 28, 531 ], [ 29, 532 ], [ 30, 533 ], [ 31, 534 ], [ 32, 535 ], [ 33, 536 ], [ 34, 537 ], [ 35, 538 ], [ 36, 539 ], [ 37, 540 ], [ 38, 541 ], [ 39, 542 ], [ 40, 543 ], [ 41, 544 ], [ 42, 545 ], [ 43, 546 ], [ 44, 547 ], [ 45, 548 ], [ 46, 549 ], [ 47, 550 ], [ 48, 551 ], [ 49, 552 ], [ 50, 553 ], [ 51, 554 ], [ 52, 555 ], [ 53, 556 ], [ 54, 557 ], [ 55, 558 ], [ 56, 559 ], [ 57, 560 ], [ 58, 561 ], [ 59, 562 ], [ 60, 563 ], [ 61, 564 ], [ 62, 565 ], [ 63, 566 ], [ 64, 567 ], [ 65, 568 ], [ 66, 569 ], [ 67, 570 ], [ 68, 571 ], [ 69, 572 ], [ 70, 573 ], [ 71, 574 ], [ 72, 575 ], [ 73, 576 ], [ 74, 577 ], [ 75, 578 ], [ 76, 579 ], [ 77, 580 ], [ 78, 581 ], [ 79, 582 ], [ 80, 583 ], [ 81, 584 ], [ 82, 585 ], [ 83, 586 ], [ 84, 587 ], [ 85, 588 ], [ 86, 589 ], [ 87, 590 ], [ 88, 591 ], [ 89, 592 ], [ 90, 593 ], [ 91, 594 ], [ 92, 595 ], [ 93, 596 ], [ 94, 597 ], [ 95, 598 ], [ 96, 599 ], [ 97, 600 ], [ 98, 601 ], [ 99, 602 ], [ 100, 603 ], [ 101, 604 ], [ 102, 605 ], [ 103, 606 ], [ 104, 607 ], [ 105, 608 ], [ 106, 609 ], [ 107, 610 ], [ 108, 611 ], [ 109, 612 ], [ 110, 613 ], [ 111, 614 ], [ 112, 615 ], [ 113, 616 ], [ 114, 617 ], [ 115, 618 ], [ 116, 619 ], [ 117, 620 ], [ 118, 621 ], [ 119, 622 ], [ 120, 623 ], [ 121, 624 ], [ 122, 625 ], [ 123, 626 ], [ 124, 627 ], [ 125, 628 ], [ 126, 629 ], [ 127, 630 ], [ 128, 631 ], [ 129, 632 ], [ 130, 633 ], [ 131, 634 ], [ 132, 635 ], [ 133, 636 ], [ 134, 637 ], [ 135, 638 ], [ 136, 639 ], [ 137, 640 ], [ 138, 641 ], [ 139, 642 ], [ 140, 643 ], [ 141, 644 ], [ 142, 645 ], [ 143, 646 ], [ 144, 647 ], [ 145, 648 ], [ 146, 649 ], [ 147, 650 ], [ 148, 651 ], [ 149, 652 ], [ 150, 653 ], [ 151, 654 ], [ 152, 655 ], [ 153, 656 ], [ 154, 657 ], [ 155, 658 ], [ 156, 659 ], [ 157, 660 ], [ 158, 661 ], [ 159, 662 ], [ 160, 663 ], [ 161, 664 ], [ 162, 665 ], [ 163, 666 ], [ 164, 667 ], [ 165, 668 ], [ 166, 669 ], [ 167, 670 ], [ 168, 671 ], [ 169, 672 ], [ 170, 673 ], [ 171, 674 ], [ 172, 675 ], [ 173, 676 ], [ 174, 677 ], [ 175, 678 ], [ 176, 679 ], [ 177, 680 ], [ 178, 681 ], [ 179, 682 ], [ 180, 683 ], [ 181, 684 ], [ 182, 685 ], [ 183, 686 ], [ 184, 687 ], [ 185, 688 ], [ 186, 689 ], [ 187, 690 ], [ 188, 691 ], [ 189, 692 ], [ 190, 693 ], [ 191, 694 ], [ 192, 695 ], [ 193, 696 ], [ 194, 697 ], [ 195, 698 ], [ 196, 699 ], [ 197, 700 ], [ 198, 701 ], [ 199, 702 ], [ 200, 703 ], [ 201, 704 ], [ 202, 705 ], [ 203, 706 ], [ 204, 707 ], [ 205, 708 ], [ 206, 709 ], [ 207, 710 ], [ 208, 711 ], [ 209, 712 ], [ 210, 713 ], [ 211, 714 ], [ 212, 715 ], [ 213, 716 ], [ 214, 717 ], [ 215, 718 ], [ 216, 719 ], [ 217, 720 ], [ 218, 721 ], [ 219, 722 ], [ 220, 723 ], [ 221, 724 ], [ 222, 725 ], [ 223, 726 ], [ 224, 727 ], [ 225, 728 ], [ 226, 729 ], [ 227, 730 ], [ 228, 731 ], [ 229, 732 ], [ 230, 733 ], [ 231, 734 ], [ 232, 735 ], [ 233, 736 ], [ 234, 737 ], [ 235, 738 ], [ 236, 739 ], [ 237, 740 ], [ 238, 741 ], [ 239, 742 ], [ 240, 743 ], [ 241, 744 ], [ 242, 745 ], [ 243, 746 ], [ 244, 747 ], [ 245, 748 ], [ 246, 749 ], [ 247, 750 ], [ 248, 751 ], [ 249, 752 ], [ 250, 753 ], [ 256, 755 ], [ 257, 756 ], [ 258, 757 ], [ 259, 758 ], [ 260, 759 ], [ 261, 760 ], [ 262, 761 ], [ 263, 762 ], [ 264, 763 ], [ 265, 764 ], [ 266, 765 ], [ 267, 766 ], [ 268, 767 ], [ 269, 768 ], [ 270, 769 ], [ 271, 770 ], [ 272, 771 ], [ 273, 772 ], [ 274, 773 ], [ 275, 774 ], [ 276, 775 ], [ 277, 776 ], [ 278, 777 ], [ 279, 778 ], [ 280, 779 ], [ 281, 780 ], [ 282, 781 ], [ 283, 782 ], [ 284, 783 ], [ 285, 784 ], [ 286, 785 ], [ 287, 786 ], [ 288, 787 ], [ 289, 788 ], [ 290, 789 ], [ 291, 790 ], [ 292, 791 ], [ 293, 792 ], [ 294, 793 ], [ 295, 794 ], [ 296, 795 ], [ 297, 796 ], [ 298, 797 ], [ 299, 798 ], [ 300, 799 ], [ 301, 800 ], [ 302, 801 ], [ 303, 802 ], [ 304, 803 ], [ 305, 804 ], [ 306, 805 ], [ 307, 806 ], [ 308, 807 ], [ 309, 808 ], [ 310, 809 ], [ 311, 810 ], [ 312, 811 ], [ 313, 812 ], [ 314, 813 ], [ 315, 814 ], [ 316, 815 ], [ 317, 816 ], [ 318, 817 ], [ 319, 818 ], [ 320, 819 ], [ 321, 820 ], [ 322, 821 ], [ 323, 822 ], [ 324, 823 ], [ 325, 824 ], [ 326, 825 ], [ 327, 826 ], [ 328, 827 ], [ 329, 828 ], [ 330, 829 ], [ 331, 830 ], [ 332, 831 ], [ 333, 832 ], [ 334, 833 ], [ 335, 834 ], [ 336, 835 ], [ 337, 836 ], [ 338, 837 ], [ 339, 838 ], [ 340, 839 ], [ 341, 840 ], [ 342, 841 ], [ 343, 842 ], [ 344, 843 ], [ 345, 844 ], [ 346, 845 ], [ 347, 846 ], [ 348, 847 ], [ 349, 848 ], [ 350, 849 ], [ 351, 850 ], [ 352, 851 ], [ 353, 852 ], [ 354, 853 ], [ 355, 854 ], [ 356, 855 ], [ 357, 856 ], [ 358, 857 ], [ 359, 858 ], [ 360, 859 ], [ 361, 860 ], [ 362, 861 ], [ 363, 862 ], [ 364, 863 ], [ 365, 864 ], [ 366, 865 ], [ 367, 866 ], [ 368, 867 ], [ 369, 868 ], [ 370, 869 ], [ 371, 870 ], [ 372, 871 ], [ 373, 872 ], [ 374, 873 ], [ 375, 874 ], [ 376, 875 ], [ 377, 876 ], [ 378, 877 ], [ 379, 878 ], [ 380, 879 ], [ 381, 880 ], [ 382, 881 ], [ 383, 882 ], [ 384, 883 ], [ 385, 884 ], [ 386, 885 ], [ 387, 886 ], [ 388, 887 ], [ 389, 888 ], [ 390, 889 ], [ 391, 890 ], [ 392, 891 ], [ 393, 892 ], [ 394, 893 ], [ 395, 894 ], [ 396, 895 ], [ 397, 896 ], [ 398, 897 ], [ 399, 898 ], [ 400, 899 ], [ 401, 900 ], [ 402, 901 ], [ 403, 902 ], [ 404, 903 ], [ 405, 904 ], [ 406, 905 ], [ 407, 906 ], [ 408, 907 ], [ 409, 908 ], [ 410, 909 ], [ 411, 910 ], [ 412, 911 ], [ 413, 912 ], [ 414, 913 ], [ 415, 914 ], [ 416, 915 ], [ 417, 916 ], [ 418, 917 ], [ 419, 918 ], [ 420, 919 ], [ 421, 920 ], [ 422, 921 ], [ 423, 922 ], [ 424, 923 ], [ 425, 924 ], [ 426, 925 ], [ 427, 926 ], [ 428, 927 ], [ 429, 928 ], [ 430, 929 ], [ 431, 930 ], [ 432, 931 ], [ 433, 932 ], [ 434, 933 ], [ 435, 934 ], [ 436, 935 ], [ 437, 936 ], [ 438, 937 ], [ 439, 938 ], [ 440, 939 ], [ 441, 940 ], [ 442, 941 ], [ 443, 942 ], [ 444, 943 ], [ 445, 944 ], [ 446, 945 ], [ 447, 946 ], [ 448, 947 ], [ 449, 948 ], [ 450, 949 ], [ 451, 950 ], [ 452, 951 ], [ 453, 952 ], [ 454, 953 ], [ 455, 954 ], [ 456, 955 ], [ 457, 956 ], [ 458, 957 ], [ 459, 958 ], [ 460, 959 ], [ 461, 960 ], [ 462, 961 ], [ 463, 962 ], [ 464, 963 ], [ 465, 964 ], [ 466, 965 ], [ 467, 966 ], [ 468, 967 ], [ 469, 968 ], [ 470, 969 ], [ 471, 970 ], [ 472, 971 ], [ 473, 972 ], [ 474, 973 ], [ 475, 974 ], [ 476, 975 ], [ 477, 976 ], [ 478, 977 ], [ 479, 978 ], [ 480, 979 ], [ 481, 980 ], [ 482, 981 ], [ 483, 982 ], [ 484, 983 ], [ 485, 984 ], [ 486, 985 ], [ 487, 986 ], [ 488, 987 ], [ 489, 988 ], [ 490, 989 ], [ 491, 990 ], [ 492, 991 ], [ 493, 992 ], [ 494, 993 ], [ 495, 994 ], [ 496, 995 ], [ 497, 996 ], [ 498, 997 ], [ 499, 998 ], [ 500, 999 ], [ 501, 1000 ] ], "uniquePlacement": true, "placementNotDetermined": false, "noCommonColumn": false, "hull": { "refStart": 6147, "refEnd": 501, "crossesOrigin": true, "wholeCircle": false }, "selected": { "coordinates": [ [ 0, 6146, 6396, 6396, 6896, 6900, 7147 ], [ 0, 0, 250, 253, 753, 753, 1000 ] ], "gappedReference": "ACAGAATAATCTCCTTAATTCACAGATTAAGGATGCTGTTGATGCAACAGTTAGCTTTTATCAAACGCTGACTGAAAAATATGGTGAAAAATATTCGAAAATGGCACAGGAACTTGCTGATAAGTCTAAAGGTAAGAAAATCGGCAATGTGAATGAAGCTCTCGCTGCTTTTGAAAAATACAAGGATGTTTTAAATAAGAAATTCAGCAAAGCCGATCGTGATGCTATTTTTAATGCGTTGGCATCGGTG---AAGTATGATGACTGGGCTAAACATTTAGATCAGTTTGCCAAGTACTTGAAGATTACGGGGCATGTTTCTTTTGGATATGATGTGGTATCTGATATCCTAAAAATTAAGGATACAGGTGACTGGAAGCCACTATTTCTTACATTAGAGAAGAAAGCTGCAGATGCAGGGGTGAGTTATGTTGTTGCTTTACTTTTTAGCTTGCTTGCTGGAACTACATTAGGTATTTGGGGTATTGCTATTGTTACAGGAATTCTATGCTCCTATATTGATAAGAATAAACTTAATACTATAAATGAGGTGTTAGGGATTTAATTATTCTTTATTGATATAAAAAGTCCTAGCAATCCAAATGGGATTGCTAGGACCAAACAAAGTAGATTATATAGCATAAATAGGTTTAATTTTGCTACGGGGGCGTTATTTAGGTTTTTTCTTCTTTCGAAAAAATCTTTCTTTATGAAGTTAAAAGCTATGTATTCAATAGCATATTTTGAATATGGACATAGAATAGTGCTTATCACTATTGCATATAGCATCTTATCTGACACAAGGAAATAATACCCTTCGCTGTTTTTTGTTATAAGGTATATATATATAAGTGTGCAGTACAGGCCAAATAAAATATTTTTTATGTAGTATCTTAAGCTCATAAATTAAACCTCGCCATATATTCTTTTCATTTTATAAGGATCGAGTTATGAGGAAAAGATTTTTTGTGGGAATATTCGCGATAAACCTCCTTGTTGGATGT", "gappedRead": "ACAGAATAATCTCCTTAATTCACAGATTAAGGATGCTGTTGATGCAACAGTTAGCTTTTATCAAACGCTGACTGAAAAATATGGTGAAAAATATTCGAAAATGGCACAGGAACTTGCTGATAAGTCTAAAGGTAAGAAAATCGGCAATGTGAATGAAGCTCTCGCTGCTTTTGAAAAATACAAGGATGTTTTAAATAAGAAATTCAGCAAAGCCGATCGTGATGCTATTTTTAATGCGTTGGCATCGGTGCATAAGTATGATGACTGGGCTAAACATTTAGATCAGTTTGCCAAGTACTTGAAGATTACGGGGCATGTTTCTTTTGGATATGATGTGGTATCTGATATCCTAAAAATTAAGGATACAGGTGACTGGAAGCCACTATTTCTTACATTAGAGAAGAAAGCTGCAGATGCAGGGGTGAGTTATGTTGTTGCTTTACTTTTTAGCTTGCTTGCTGGAACTACATTAGGTATTTGGGGTATTGCTATTGTTACAGGAATTCTATGCTCCTATATTGATAAGAATAAACTTAATACTATAAATGAGGTGTTAGGGATTTAATTATTCTTTATTGATATAAAAAGTCCTAGCAATCCAAATGGGATTGCTAGGACCAAACAAAGTAGATTATATAGCATAAATAGGTTTAATTTTGCTACGGGGGCGTTATTTAGGTTTTTTCTTCTTTCGAAAAAATCTTTCTTTATGAAGTTAAAAGCTATGTATTCAATAGCATATTTTGAATATGG----AGAATAGTGCTTATCACTATTGCATATAGCATCTTATCTGACACAAGGAAATAATACCCTTCGCTGTTTTTTGTTATAAGGTATATATATATAAGTGTGCAGTACAGGCCAAATAAAATATTTTTTATGTAGTATCTTAAGCTCATAAATTAAACCTCGCCATATATTCTTTTCATTTTATAAGGATCGAGTTATGAGGAAAAGATTTTTTGTGGGAATATTCGCGATAAACCTCCTTGTTGGATGT", "columns": 1004, "identical": 997, "mismatches": 0, "ambiguousColumns": 0, "gapColumns": 7, "gapOpens": 2, "identity": { "numerator": 997, "denominator": 1004 }, "readAligned": { "bases": 1000, "of": 1000 }, "referenceCovered": { "bases": 1001, "of": 6646 }, "placement": { "refStart": 6147, "refEnd": 501, "readStart": 1, "readEnd": 1000, "crossesOrigin": true }, "overhang": [], "differences": [ { "kind": "insertion", "refAfter": 6396, "length": 3, "bases": "CAT", "readStart": 251, "readEnd": 253, "common": true }, { "kind": "deletion", "refStart": 251, "refEnd": 254, "length": 4, "bases": "ACAT", "readAfter": 753, "common": false, "notFixed": { "from": { "ref": 250, "read": 753 }, "to": { "ref": 256, "read": 755 } } } ] }, "band": { "diagonalMin": 6143, "diagonalMax": 6147, "cellsNeeded": 7007, "unionBandLimited": false, "scope": "every optimal path", "gridCells": 8654646, "searchedBanded": true, "sharedWords": 967, "sharedWordsOverCap": false, "seedGuarantee": { "differencesUpTo": 13, "guaranteed": true } }, "enumeration": "listed", "alignments": [ [ [ 0, 6146, 6396, 6396, 6896, 6900, 7147 ], [ 0, 0, 250, 253, 753, 753, 1000 ] ], [ [ 0, 6146, 6396, 6396, 6897, 6901, 7147 ], [ 0, 0, 250, 253, 754, 754, 1000 ] ] ], "tuples": [ [ 997, 0, 1004, 0, 7, 2, 1000, 1001 ] ], "tupleFields": [ "identical", "ambiguousColumns", "columns", "mismatches", "gapColumns", "gapOpens", "readAligned", "referenceCovered" ], "variation": { "readAligned": { "shared": true, "min": 1000, "max": 1000 }, "referenceCovered": { "shared": true, "min": 1001, "max": 1001 }, "identity": { "shared": true, "min": { "numerator": 997, "denominator": 1004 }, "max": { "numerator": 997, "denominator": 1004 } }, "overhangStart": { "shared": true, "min": 0, "max": 0 }, "overhangEnd": { "shared": true, "min": 0, "max": 0 } }, "placements": [ { "refStart": 6147, "refEnd": 501, "crossesOrigin": true, "wholeCircle": false, "readStart": 1, "readEnd": 1000, "alignments": 2, "band": { "diagonalMin": 6143, "diagonalMax": 6147, "cellsNeeded": 7007, "bandLimited": false } } ] }, "minus": { "score": -420, "count": "14979048753070080", "overCap": true, "state": "aligned", "biopython": { "score": -420, "count": "14979048753070080", "tailScore": -440, "tailCountSubtracted": 0, "certifiedText": { "extension": 1210, "textLength": 8855, "reruns": 1, "differencesUpTo": 1210 } }, "uniquePairs": [ [ 6607, 1 ], [ 6608, 2 ], [ 6609, 4 ], [ 6610, 5 ], [ 6611, 6 ], [ 6612, 7 ], [ 6613, 8 ], [ 6614, 9 ], [ 6615, 10 ], [ 6616, 11 ], [ 6617, 12 ], [ 6618, 13 ], [ 6619, 14 ], [ 6623, 15 ], [ 6624, 16 ], [ 6625, 17 ], [ 6626, 18 ], [ 6627, 19 ], [ 6628, 20 ], [ 6629, 21 ], [ 6630, 22 ], [ 6631, 23 ], [ 6632, 24 ], [ 6640, 35 ], [ 6641, 36 ], [ 6642, 37 ], [ 6643, 38 ], [ 6644, 39 ], [ 6645, 40 ], [ 6646, 41 ], [ 1, 42 ], [ 2, 43 ], [ 3, 44 ], [ 4, 45 ], [ 5, 46 ], [ 6, 47 ], [ 9, 48 ], [ 10, 49 ], [ 11, 50 ], [ 12, 51 ], [ 13, 53 ], [ 14, 54 ], [ 15, 55 ], [ 16, 58 ], [ 17, 59 ], [ 18, 60 ], [ 19, 61 ], [ 20, 62 ], [ 21, 63 ], [ 22, 64 ], [ 23, 65 ], [ 24, 66 ], [ 25, 67 ], [ 26, 68 ], [ 27, 69 ], [ 28, 70 ], [ 29, 71 ], [ 30, 72 ], [ 31, 73 ], [ 32, 74 ], [ 33, 75 ], [ 34, 76 ], [ 35, 77 ], [ 36, 78 ], [ 37, 79 ], [ 38, 80 ], [ 39, 81 ], [ 40, 82 ], [ 41, 83 ], [ 42, 84 ], [ 43, 85 ], [ 44, 86 ], [ 48, 88 ], [ 49, 89 ], [ 50, 90 ], [ 53, 91 ], [ 54, 92 ], [ 55, 93 ], [ 58, 94 ], [ 59, 95 ], [ 60, 96 ], [ 61, 97 ], [ 62, 98 ], [ 71, 101 ], [ 72, 102 ], [ 75, 104 ], [ 76, 105 ], [ 77, 106 ], [ 78, 107 ], [ 79, 108 ], [ 80, 109 ], [ 81, 110 ], [ 82, 111 ], [ 83, 112 ], [ 84, 113 ], [ 86, 114 ], [ 87, 115 ], [ 88, 116 ], [ 89, 117 ], [ 90, 118 ], [ 92, 119 ], [ 93, 120 ], [ 94, 122 ], [ 95, 123 ], [ 96, 124 ], [ 97, 125 ], [ 98, 126 ], [ 99, 127 ], [ 100, 129 ], [ 101, 130 ], [ 102, 131 ], [ 103, 132 ], [ 104, 133 ], [ 105, 134 ], [ 106, 135 ], [ 107, 136 ], [ 108, 139 ], [ 109, 140 ], [ 110, 141 ], [ 111, 142 ], [ 112, 143 ], [ 113, 144 ], [ 114, 145 ], [ 115, 146 ], [ 116, 149 ], [ 117, 150 ], [ 118, 151 ], [ 119, 152 ], [ 120, 153 ], [ 121, 154 ], [ 122, 155 ], [ 123, 156 ], [ 125, 157 ], [ 126, 158 ], [ 127, 159 ], [ 128, 160 ], [ 131, 162 ], [ 132, 163 ], [ 133, 164 ], [ 134, 165 ], [ 135, 166 ], [ 136, 167 ], [ 137, 168 ], [ 138, 169 ], [ 139, 170 ], [ 140, 171 ], [ 141, 173 ], [ 142, 174 ], [ 143, 175 ], [ 144, 176 ], [ 150, 178 ], [ 151, 179 ], [ 152, 180 ], [ 153, 181 ], [ 154, 182 ], [ 155, 183 ], [ 156, 184 ], [ 157, 185 ], [ 158, 186 ], [ 159, 187 ], [ 160, 188 ], [ 161, 189 ], [ 162, 190 ], [ 163, 191 ], [ 169, 192 ], [ 170, 193 ], [ 174, 196 ], [ 179, 197 ], [ 180, 198 ], [ 181, 199 ], [ 182, 200 ], [ 183, 201 ], [ 184, 202 ], [ 185, 203 ], [ 186, 204 ], [ 187, 205 ], [ 188, 206 ], [ 189, 207 ], [ 190, 208 ], [ 191, 210 ], [ 192, 211 ], [ 193, 212 ], [ 194, 213 ], [ 195, 214 ], [ 196, 215 ], [ 197, 216 ], [ 203, 219 ], [ 204, 220 ], [ 205, 221 ], [ 206, 222 ], [ 207, 223 ], [ 208, 224 ], [ 209, 225 ], [ 212, 231 ], [ 213, 232 ], [ 214, 233 ], [ 215, 234 ], [ 216, 235 ], [ 217, 236 ], [ 218, 237 ], [ 219, 238 ], [ 220, 239 ], [ 222, 240 ], [ 225, 242 ], [ 226, 243 ], [ 227, 244 ], [ 228, 245 ], [ 229, 246 ], [ 232, 247 ], [ 235, 249 ], [ 236, 250 ], [ 237, 251 ], [ 238, 252 ], [ 239, 253 ], [ 240, 254 ], [ 241, 255 ], [ 242, 256 ], [ 243, 257 ], [ 244, 258 ], [ 245, 259 ], [ 246, 260 ], [ 247, 261 ], [ 248, 262 ], [ 249, 263 ], [ 252, 264 ], [ 253, 266 ], [ 254, 267 ], [ 255, 268 ], [ 256, 269 ], [ 257, 270 ], [ 258, 271 ], [ 259, 272 ], [ 260, 273 ], [ 262, 276 ], [ 263, 278 ], [ 264, 279 ], [ 265, 280 ], [ 266, 281 ], [ 267, 282 ], [ 268, 283 ], [ 269, 284 ], [ 270, 285 ], [ 271, 286 ], [ 277, 289 ], [ 278, 290 ], [ 279, 291 ], [ 280, 292 ], [ 281, 293 ], [ 282, 294 ], [ 283, 295 ], [ 286, 301 ], [ 287, 302 ], [ 288, 303 ], [ 289, 304 ], [ 290, 305 ], [ 291, 306 ], [ 292, 307 ], [ 294, 308 ], [ 295, 309 ], [ 296, 310 ], [ 297, 311 ], [ 298, 312 ], [ 299, 313 ], [ 300, 314 ], [ 301, 315 ], [ 302, 316 ], [ 303, 317 ], [ 304, 318 ], [ 305, 319 ], [ 306, 324 ], [ 309, 328 ], [ 310, 329 ], [ 311, 335 ], [ 312, 336 ], [ 313, 337 ], [ 314, 338 ], [ 315, 339 ], [ 316, 340 ], [ 317, 341 ], [ 318, 342 ], [ 319, 343 ], [ 320, 344 ], [ 321, 345 ], [ 322, 346 ], [ 323, 347 ], [ 324, 348 ], [ 326, 354 ], [ 327, 355 ], [ 328, 356 ], [ 329, 357 ], [ 331, 358 ], [ 332, 359 ], [ 333, 360 ], [ 334, 361 ], [ 335, 362 ], [ 336, 363 ], [ 337, 364 ], [ 338, 365 ], [ 339, 366 ], [ 340, 367 ], [ 342, 370 ], [ 343, 371 ], [ 344, 372 ], [ 345, 373 ], [ 346, 375 ], [ 347, 376 ], [ 348, 377 ], [ 349, 378 ], [ 350, 379 ], [ 351, 380 ], [ 352, 381 ], [ 353, 382 ], [ 356, 383 ], [ 357, 384 ], [ 358, 385 ], [ 359, 386 ], [ 360, 387 ], [ 361, 388 ], [ 362, 389 ], [ 363, 390 ], [ 366, 391 ], [ 367, 392 ], [ 368, 393 ], [ 369, 394 ], [ 370, 395 ], [ 371, 396 ], [ 372, 397 ], [ 373, 398 ], [ 375, 399 ], [ 376, 400 ], [ 377, 401 ], [ 378, 402 ], [ 379, 403 ], [ 380, 404 ], [ 382, 405 ], [ 383, 406 ], [ 384, 408 ], [ 385, 409 ], [ 386, 410 ], [ 387, 411 ], [ 388, 412 ], [ 389, 414 ], [ 390, 415 ], [ 391, 416 ], [ 392, 417 ], [ 393, 418 ], [ 394, 419 ], [ 395, 420 ], [ 396, 421 ], [ 397, 422 ], [ 398, 423 ], [ 400, 426 ], [ 401, 427 ], [ 404, 436 ], [ 405, 437 ], [ 406, 438 ], [ 407, 439 ], [ 408, 440 ], [ 409, 443 ], [ 410, 444 ], [ 411, 445 ], [ 412, 448 ], [ 413, 449 ], [ 414, 450 ], [ 416, 454 ], [ 417, 455 ], [ 418, 456 ], [ 419, 457 ], [ 420, 458 ], [ 421, 459 ], [ 422, 460 ], [ 423, 461 ], [ 424, 462 ], [ 425, 463 ], [ 426, 464 ], [ 427, 465 ], [ 428, 466 ], [ 429, 467 ], [ 430, 468 ], [ 431, 469 ], [ 432, 470 ], [ 433, 471 ], [ 434, 472 ], [ 435, 473 ], [ 436, 474 ], [ 437, 475 ], [ 438, 476 ], [ 439, 477 ], [ 440, 478 ], [ 441, 479 ], [ 442, 480 ], [ 443, 481 ], [ 444, 482 ], [ 447, 483 ], [ 448, 484 ], [ 449, 485 ], [ 451, 486 ], [ 452, 487 ], [ 453, 488 ], [ 454, 489 ], [ 455, 492 ], [ 456, 493 ], [ 457, 494 ], [ 458, 495 ], [ 459, 496 ], [ 460, 497 ], [ 461, 498 ], [ 462, 499 ], [ 463, 500 ], [ 464, 501 ], [ 465, 502 ], [ 466, 503 ], [ 467, 504 ], [ 468, 505 ], [ 469, 506 ], [ 470, 507 ], [ 471, 508 ], [ 472, 509 ], [ 473, 510 ], [ 475, 516 ], [ 476, 517 ], [ 477, 518 ], [ 478, 519 ], [ 479, 520 ], [ 480, 521 ], [ 481, 522 ], [ 482, 523 ], [ 483, 524 ], [ 484, 525 ], [ 485, 526 ], [ 486, 527 ], [ 487, 528 ], [ 488, 529 ], [ 489, 530 ], [ 490, 531 ], [ 491, 532 ], [ 492, 534 ], [ 493, 536 ], [ 494, 537 ], [ 495, 538 ], [ 496, 542 ], [ 497, 543 ], [ 498, 544 ], [ 499, 545 ], [ 500, 546 ], [ 502, 547 ], [ 503, 548 ], [ 504, 549 ], [ 505, 550 ], [ 506, 551 ], [ 507, 552 ], [ 510, 567 ], [ 511, 568 ], [ 512, 569 ], [ 513, 570 ], [ 514, 571 ], [ 515, 572 ], [ 516, 573 ], [ 517, 581 ], [ 518, 582 ], [ 519, 583 ], [ 520, 584 ], [ 521, 586 ], [ 522, 587 ], [ 523, 588 ], [ 524, 589 ], [ 525, 590 ], [ 526, 591 ], [ 527, 592 ], [ 528, 593 ], [ 529, 608 ], [ 530, 609 ], [ 531, 610 ], [ 532, 611 ], [ 533, 612 ], [ 534, 613 ], [ 535, 614 ], [ 536, 615 ], [ 537, 616 ], [ 538, 617 ], [ 539, 619 ], [ 540, 620 ], [ 541, 621 ], [ 542, 622 ], [ 544, 625 ], [ 545, 626 ], [ 546, 627 ], [ 547, 628 ], [ 548, 629 ], [ 549, 630 ], [ 550, 631 ], [ 551, 632 ], [ 552, 633 ], [ 553, 634 ], [ 554, 635 ], [ 555, 636 ], [ 556, 638 ], [ 557, 639 ], [ 558, 642 ], [ 559, 643 ], [ 560, 644 ], [ 561, 645 ], [ 562, 646 ], [ 563, 647 ], [ 564, 648 ], [ 565, 649 ], [ 566, 650 ], [ 567, 651 ], [ 568, 652 ], [ 569, 653 ], [ 570, 654 ], [ 571, 655 ], [ 572, 656 ], [ 573, 657 ], [ 574, 659 ], [ 575, 664 ], [ 576, 665 ], [ 577, 666 ], [ 578, 667 ], [ 579, 668 ], [ 580, 669 ], [ 581, 670 ], [ 583, 671 ], [ 584, 672 ], [ 586, 676 ], [ 587, 677 ], [ 588, 678 ], [ 589, 679 ], [ 590, 680 ], [ 591, 681 ], [ 599, 695 ], [ 600, 696 ], [ 601, 697 ], [ 602, 698 ], [ 603, 699 ], [ 605, 707 ], [ 606, 708 ], [ 607, 709 ], [ 609, 717 ], [ 610, 718 ], [ 611, 719 ], [ 612, 720 ], [ 613, 721 ], [ 614, 722 ], [ 615, 723 ], [ 616, 724 ], [ 617, 725 ], [ 618, 726 ], [ 619, 727 ], [ 620, 728 ], [ 621, 729 ], [ 622, 730 ], [ 623, 731 ], [ 624, 732 ], [ 625, 733 ], [ 626, 734 ], [ 627, 736 ], [ 628, 737 ], [ 629, 738 ], [ 630, 739 ], [ 631, 740 ], [ 632, 741 ], [ 633, 743 ], [ 634, 744 ], [ 635, 745 ], [ 637, 750 ], [ 638, 751 ], [ 640, 757 ], [ 641, 758 ], [ 642, 759 ], [ 643, 760 ], [ 644, 761 ], [ 645, 762 ], [ 646, 763 ], [ 647, 769 ], [ 648, 770 ], [ 649, 771 ], [ 650, 772 ], [ 651, 773 ], [ 652, 774 ], [ 653, 775 ], [ 654, 776 ], [ 655, 777 ], [ 656, 778 ], [ 657, 779 ], [ 658, 780 ], [ 662, 781 ], [ 663, 782 ], [ 664, 783 ], [ 665, 784 ], [ 666, 785 ], [ 667, 786 ], [ 668, 787 ], [ 682, 802 ], [ 683, 803 ], [ 684, 804 ], [ 685, 805 ], [ 686, 806 ], [ 687, 807 ], [ 688, 808 ], [ 689, 809 ], [ 690, 810 ], [ 691, 811 ], [ 692, 812 ], [ 693, 813 ], [ 694, 814 ], [ 695, 815 ], [ 696, 816 ], [ 697, 817 ], [ 698, 818 ], [ 699, 819 ], [ 700, 820 ], [ 701, 821 ], [ 702, 822 ], [ 703, 823 ], [ 704, 824 ], [ 705, 825 ], [ 706, 826 ], [ 707, 827 ], [ 716, 835 ], [ 717, 836 ], [ 718, 837 ], [ 720, 840 ], [ 721, 842 ], [ 722, 843 ], [ 723, 844 ], [ 724, 845 ], [ 725, 846 ], [ 726, 847 ], [ 728, 850 ], [ 729, 851 ], [ 730, 852 ], [ 731, 853 ], [ 732, 854 ], [ 733, 855 ], [ 734, 856 ], [ 735, 857 ], [ 736, 858 ], [ 737, 859 ], [ 738, 860 ], [ 739, 861 ], [ 746, 863 ], [ 747, 864 ], [ 748, 865 ], [ 749, 866 ], [ 750, 867 ], [ 751, 868 ], [ 752, 869 ], [ 753, 870 ], [ 754, 871 ], [ 755, 872 ], [ 757, 873 ], [ 758, 874 ], [ 759, 875 ], [ 760, 878 ], [ 762, 879 ], [ 763, 880 ], [ 764, 881 ], [ 765, 882 ], [ 766, 883 ], [ 767, 884 ], [ 770, 888 ], [ 775, 896 ], [ 776, 897 ], [ 777, 898 ], [ 778, 899 ], [ 779, 900 ], [ 780, 901 ], [ 783, 902 ], [ 784, 903 ], [ 785, 904 ], [ 788, 905 ], [ 789, 906 ], [ 790, 907 ], [ 792, 908 ], [ 793, 909 ], [ 794, 910 ], [ 795, 911 ], [ 796, 912 ], [ 797, 913 ], [ 798, 914 ], [ 799, 915 ], [ 800, 916 ], [ 801, 917 ], [ 802, 918 ], [ 803, 919 ], [ 804, 920 ], [ 813, 930 ], [ 814, 931 ], [ 815, 932 ], [ 816, 933 ], [ 817, 934 ], [ 818, 935 ], [ 822, 938 ], [ 823, 939 ], [ 824, 940 ], [ 825, 941 ], [ 826, 942 ], [ 827, 943 ], [ 832, 946 ], [ 833, 947 ], [ 834, 948 ], [ 835, 949 ], [ 836, 950 ], [ 837, 951 ], [ 838, 952 ], [ 839, 953 ], [ 840, 954 ], [ 851, 964 ], [ 852, 965 ], [ 853, 966 ], [ 854, 967 ], [ 855, 968 ], [ 856, 969 ], [ 857, 970 ], [ 858, 971 ], [ 859, 972 ], [ 860, 973 ], [ 861, 974 ], [ 862, 975 ], [ 863, 976 ], [ 864, 977 ], [ 865, 978 ], [ 866, 979 ], [ 867, 980 ], [ 868, 981 ], [ 869, 982 ], [ 870, 983 ], [ 871, 984 ], [ 872, 985 ], [ 873, 986 ], [ 874, 987 ], [ 875, 988 ], [ 878, 992 ], [ 879, 993 ], [ 880, 994 ], [ 881, 995 ], [ 882, 996 ], [ 883, 997 ], [ 884, 998 ], [ 885, 999 ], [ 886, 1000 ] ], "uniquePlacement": true, "placementNotDetermined": false, "noCommonColumn": false, "hull": { "refStart": 6607, "refEnd": 886, "crossesOrigin": true, "wholeCircle": false }, "selected": { "coordinates": [ [ 0, 6606, 6608, 6608, 6619, 6622, 6632, 6632, 6652, 6654, 6658, 6658, 6661, 6661, 6690, 6692, 6696, 6698, 6701, 6703, 6708, 6714, 6718, 6719, 6730, 6731, 6736, 6737, 6739, 6739, 6745, 6745, 6753, 6753, 6761, 6761, 6769, 6770, 6774, 6775, 6786, 6786, 6790, 6794, 6809, 6814, 6816, 6817, 6820, 6824, 6836, 6836, 6843, 6846, 6855, 6855, 6856, 6856, 6866, 6867, 6868, 6869, 6875, 6877, 6878, 6879, 6895, 6897, 6898, 6898, 6906, 6906, 6908, 6908, 6918, 6919, 6920, 6922, 6929, 6929, 6938, 6939, 6951, 6951, 6952, 6952, 6956, 6956, 6970, 6970, 6975, 6976, 6986, 6986, 6991, 6991, 6999, 7001, 7009, 7011, 7019, 7020, 7026, 7027, 7029, 7029, 7034, 7034, 7044, 7044, 7047, 7047, 7054, 7054, 7057, 7057, 7060, 7060, 7090, 7092, 7095, 7096, 7100, 7100, 7119, 7119, 7137, 7137, 7138, 7138, 7141, 7141, 7146, 7147, 7153, 7153, 7162, 7162, 7166, 7166, 7174, 7174, 7184, 7184, 7188, 7188, 7201, 7201, 7203, 7203, 7219, 7219, 7220, 7220, 7227, 7228, 7230, 7230, 7237, 7239, 7241, 7241, 7244, 7244, 7249, 7249, 7253, 7253, 7254, 7254, 7272, 7272, 7278, 7278, 7281, 7281, 7284, 7284, 7292, 7292, 7304, 7307, 7314, 7316, 7324, 7324, 7353, 7354, 7364, 7364, 7366, 7366, 7372, 7372, 7385, 7390, 7401, 7402, 7405, 7405, 7406, 7407, 7413, 7413, 7416, 7416, 7418, 7418, 7426, 7428, 7431, 7433, 7436, 7437, 7450, 7450, 7464, 7465, 7473, 7475, 7492, 7493, 7521, 7521, 7532 ], [ 0, 0, 2, 3, 14, 14, 24, 27, 47, 47, 51, 52, 55, 57, 86, 86, 90, 90, 93, 93, 98, 98, 102, 102, 113, 113, 118, 118, 120, 121, 127, 128, 136, 138, 146, 148, 156, 156, 160, 160, 171, 172, 176, 176, 191, 191, 193, 193, 196, 196, 208, 209, 216, 216, 225, 226, 227, 229, 239, 239, 240, 240, 246, 246, 247, 247, 263, 263, 264, 265, 273, 274, 276, 277, 287, 287, 288, 288, 295, 298, 307, 307, 319, 323, 324, 325, 329, 334, 348, 352, 357, 357, 367, 368, 373, 374, 382, 382, 390, 390, 398, 398, 404, 404, 406, 407, 412, 413, 423, 424, 427, 433, 440, 442, 445, 447, 450, 452, 482, 482, 485, 485, 489, 491, 510, 514, 532, 533, 534, 535, 538, 541, 546, 546, 552, 564, 573, 580, 584, 585, 593, 607, 617, 618, 622, 623, 636, 637, 639, 641, 657, 658, 659, 663, 670, 670, 672, 674, 681, 681, 683, 684, 687, 694, 699, 705, 709, 711, 712, 716, 734, 735, 741, 742, 745, 748, 751, 755, 763, 768, 780, 780, 787, 787, 795, 798, 827, 827, 837, 838, 840, 841, 847, 848, 861, 861, 872, 872, 875, 877, 878, 878, 884, 885, 888, 889, 891, 893, 901, 901, 904, 904, 907, 907, 920, 921, 935, 935, 943, 943, 960, 960, 988, 989, 1000 ] ], "gappedReference": "AC-TACATTAGGTATTTGGGGTATTGC---TATTGTTACAGGAATTCTATGCTCCT-ATA--TTGATAAGAATAAACTTAATACTATAAATGAGGTGTTAGGGATTTAATTATTCTTTATTGATATAAAAAGTCCTAGCA-ATCCAA-ATGGGATT--GCTAGGAC--CAAACAAAGTAGATTATATAGCATA-AATAGGTTTAATTTTGCTACGGGGGCGTTATTTAGGTTTTTTCTTCTTTC-GAAAAAATCTTTCTTTATG-A--AGTTAAAAGCTATGTATTCAATAGCATATTTTGAATATGGAC-ATAGAATA-GT-GCTTATCACTATTGCATATAG---CATCTTATCTGACACAAGGAAA----T-AATA-----CCCTTCGCTGTTTT----TTGTTATAAGGTATAT-ATATA-TAAGTGTGCAGTACAGGCCAAATAAAATATTTTTTATG-TAGTA-TCTTAAGCTC-ATA------AATTAAA--CCT--CGC--CATATATTCTTTTCATTTTATAAGGATCGAGTTATGAGGA--AAAGATTTTTTGTGGGAAT----ATTCGCGATAAACCTCCT-T-GTT---GGATGTCAGGCT------------AACTATATA-------CCTG-ATGTTCAG--------------GGAGGGACCA-TCGC-ACCATCCTCCTCT-TC--TAAACTGACGGGGATC-G----CGGTTCAGTA--GAAAAGATTAA-AGG-------ATCTT------CTTG--A----GATCCTTTTTTTCTGCGC-GTAATC-TGC---TGC----TTGCAAAC-----AAAAAAACCACCGCTACCAACGGTGGTTTGTT---TGCCGGATCAAGAGCTACCAACTCTTTTTCCGAAGGTAAC-TG-GCTTCA-GCAGAGCGCAGATACCAAATACTGTCCTTCTAG--TGTAGCCG-TAG-TC--GGGCCACTACTTCAAGAACTCTGTAGCACCGT-TTGTGCCATCATCGCTCTGCTAATCCGGTTACCAGTGGCTGCTGCCAGTGGCGTTAAGGCGTGCCTTACCG-GGTTGGACTCA", "gappedRead": "ACATCCAACAAGGA---GGTTTATCGCGAATATTCCCACAAAAAATCTTT--TCCTCATAACTCGATCCTTATAAAATGAAAAGAATATAT--GGCG--AGG--TTTAA------TTTA-TGAGCTTAAGA-TACTA-CATAAAAAATATTTTATTTGGCCTGTACTGCACACTTA-TATA-TATATACCTTATAACA----AAAAACAGCGAAGGG-----TA-TTA----TTTCCTTGTGTCAGATAAGA---TGCTATATGCAATAGTGATAAGC-A-CTATTC--T-CCATATTCAAAATATG--CTATTGAATACATAGCTTTTAACT-T--CATAAAGAAAGATTTTTTC-GAAAGAAGAAAAAACCTAAATAACGCCCCCGTAGCAAAATTAAACCTATT-TATGCTATATAATCTACTTTGTTTG--GTCCTAGC--AATCCCAT-TTGGAT-TGCTAGGACTTTTTATATCAATAAAGAATAATTAAATCCCTAACACCTCATTTATAGTATTAAGTTTATTCTTATCAA--TAT-AGGAGCATAGAATTCCTGTAACAATAGCAATACCCCAAATACCTAATGTAGTTCCAGCAAG-CAAGCTAAAAAGTAAAGCAACAACATAACTCACCCCTGCATCTGCAGCTTTCTTCTCTAATGTAAGAAATAGTGGCTTCCAGTCACCTGTATCCTTAATTTTTAGGATATCAGATACCACATCA-TATCCAAAAGA--AACATGCCCCGTAATCTTCAAGTACTTGGCAAACTGATCTAAATGTTTAGCCCAGTCATCATACTTATGCACCGATGCCAACGCATTAAAAATAGCATC---ACGATCG--GCTTTGCTGAATTTCTTATTTAAAACATCCTTGTATTTTT-CAAAAGCAGCGAGAGCTTCATTCACATTGCCGAT-----TTTCTTACCTT-TAGACT-TATCAGCAAGTTCCTGTGCCATT--TTC--GAA-TATTTTTCACCATATTTTTCAGTCAGCG-TTTGATAA--AAGCTAACTGTTGCATC-AACAGCATCCTTAATCTGTGAATTAAGGAGATTATTCTGT", "columns": 1086, "identical": 585, "mismatches": 255, "ambiguousColumns": 0, "gapColumns": 246, "gapOpens": 111, "identity": { "numerator": 585, "denominator": 1086 }, "readAligned": { "bases": 1000, "of": 1000 }, "referenceCovered": { "bases": 926, "of": 6646 }, "placement": { "refStart": 6607, "refEnd": 886, "readStart": 1, "readEnd": 1000, "crossesOrigin": true, "asSupplied": { "readStart": 1, "readEnd": 1000 } }, "overhang": [], "differences": [ { "kind": "insertion", "refAfter": 6608, "length": 1, "bases": "A", "readStart": 3, "readEnd": 3, "asSupplied": { "readStart": 998, "readEnd": 998, "bases": "T" }, "common": true }, { "kind": "substitution", "ref": 6610, "refBase": "A", "readBase": "C", "read": 5, "common": true, "asSupplied": { "read": 996, "readBase": "G" } }, { "kind": "substitution", "ref": 6613, "refBase": "T", "readBase": "A", "read": 8, "common": true, "asSupplied": { "read": 993, "readBase": "T" } }, { "kind": "substitution", "ref": 6614, "refBase": "T", "readBase": "C", "read": 9, "common": true, "asSupplied": { "read": 992, "readBase": "G" } }, { "kind": "substitution", "ref": 6616, "refBase": "G", "readBase": "A", "read": 11, "common": true, "asSupplied": { "read": 990, "readBase": "T" } }, { "kind": "substitution", "ref": 6618, "refBase": "T", "readBase": "G", "read": 13, "common": true, "asSupplied": { "read": 988, "readBase": "C" } }, { "kind": "deletion", "refStart": 6620, "refEnd": 6622, "length": 3, "bases": "TTT", "readAfter": 14, "asSupplied": { "readBetween": [ 986, 987 ] }, "common": true }, { "kind": "substitution", "ref": 6625, "refBase": "G", "readBase": "T", "read": 17, "common": true, "asSupplied": { "read": 984, "readBase": "A" } }, { "kind": "substitution", "ref": 6626, "refBase": "G", "readBase": "T", "read": 18, "common": true, "asSupplied": { "read": 983, "readBase": "A" } }, { "kind": "substitution", "ref": 6630, "refBase": "T", "readBase": "C", "read": 22, "common": true, "asSupplied": { "read": 979, "readBase": "G" } }, { "kind": "insertion", "refAfter": 6632, "length": 3, "bases": "GAA", "readStart": 25, "readEnd": 27, "asSupplied": { "readStart": 974, "readEnd": 976, "bases": "TTC" }, "common": false, "notFixed": { "from": { "ref": 6632, "read": 24, "readAsSupplied": 977 }, "to": { "ref": 6640, "read": 35, "readAsSupplied": 966 } } }, { "kind": "substitution", "ref": 6637, "refBase": "G", "readBase": "C", "read": 32, "common": false, "notFixed": { "from": { "ref": 6632, "read": 24, "readAsSupplied": 977 }, "to": { "ref": 6640, "read": 35, "readAsSupplied": 966 } }, "asSupplied": { "read": 969, "readBase": "G" } }, { "kind": "substitution", "ref": 6638, "refBase": "T", "readBase": "C", "read": 33, "common": false, "notFixed": { "from": { "ref": 6632, "read": 24, "readAsSupplied": 977 }, "to": { "ref": 6640, "read": 35, "readAsSupplied": 966 } }, "asSupplied": { "read": 968, "readBase": "G" } }, { "kind": "substitution", "ref": 6639, "refBase": "T", "readBase": "C", "read": 34, "common": false, "notFixed": { "from": { "ref": 6632, "read": 24, "readAsSupplied": 977 }, "to": { "ref": 6640, "read": 35, "readAsSupplied": 966 } }, "asSupplied": { "read": 967, "readBase": "G" } }, { "kind": "substitution", "ref": 6643, "refBase": "G", "readBase": "A", "read": 38, "common": true, "asSupplied": { "read": 963, "readBase": "T" } }, { "kind": "substitution", "ref": 6644, "refBase": "G", "readBase": "A", "read": 39, "common": true, "asSupplied": { "read": 962, "readBase": "T" } }, { "kind": "substitution", "ref": 1, "refBase": "T", "readBase": "A", "read": 42, "common": true, "asSupplied": { "read": 959, "readBase": "T" } }, { "kind": "substitution", "ref": 5, "refBase": "A", "readBase": "T", "read": 46, "common": true, "asSupplied": { "read": 955, "readBase": "A" } }, { "kind": "deletion", "refStart": 7, "refEnd": 8, "length": 2, "bases": "GC", "readAfter": 47, "asSupplied": { "readBetween": [ 953, 954 ] }, "common": true }, { "kind": "insertion", "refAfter": 12, "length": 1, "bases": "C", "readStart": 52, "readEnd": 52, "asSupplied": { "readStart": 949, "readEnd": 949, "bases": "G" }, "common": true }, { "kind": "insertion", "refAfter": 15, "length": 2, "bases": "AC", "readStart": 56, "readEnd": 57, "asSupplied": { "readStart": 944, "readEnd": 945, "bases": "GT" }, "common": true }, { "kind": "substitution", "ref": 17, "refBase": "T", "readBase": "C", "read": 59, "common": true, "asSupplied": { "read": 942, "readBase": "G" } }, { "kind": "substitution", "ref": 21, "refBase": "A", "readBase": "C", "read": 63, "common": true, "asSupplied": { "read": 938, "readBase": "G" } }, { "kind": "substitution", "ref": 22, "refBase": "A", "readBase": "C", "read": 64, "common": true, "asSupplied": { "read": 937, "readBase": "G" } }, { "kind": "substitution", "ref": 23, "refBase": "G", "readBase": "T", "read": 65, "common": true, "asSupplied": { "read": 936, "readBase": "A" } }, { "kind": "substitution", "ref": 24, "refBase": "A", "readBase": "T", "read": 66, "common": true, "asSupplied": { "read": 935, "readBase": "A" } }, { "kind": "substitution", "ref": 30, "refBase": "C", "readBase": "A", "read": 72, "common": true, "asSupplied": { "read": 929, "readBase": "T" } }, { "kind": "substitution", "ref": 32, "refBase": "T", "readBase": "G", "read": 74, "common": true, "asSupplied": { "read": 927, "readBase": "C" } }, { "kind": "substitution", "ref": 35, "refBase": "T", "readBase": "A", "read": 77, "common": true, "asSupplied": { "read": 924, "readBase": "T" } }, { "kind": "substitution", "ref": 37, "refBase": "C", "readBase": "G", "read": 79, "common": true, "asSupplied": { "read": 922, "readBase": "C" } }, { "kind": "substitution", "ref": 38, "refBase": "T", "readBase": "A", "read": 80, "common": true, "asSupplied": { "read": 921, "readBase": "T" } }, { "kind": "substitution", "ref": 42, "refBase": "A", "readBase": "T", "read": 84, "common": true, "asSupplied": { "read": 917, "readBase": "A" } }, { "kind": "deletion", "refStart": 45, "refEnd": 46, "length": 2, "bases": "GA", "readAfter": 86, "asSupplied": { "readBetween": [ 914, 915 ] }, "common": false, "notFixed": { "from": { "ref": 44, "read": 86, "readAsSupplied": 915 }, "to": { "ref": 48, "read": 88, "readAsSupplied": 913 } } }, { "kind": "substitution", "ref": 49, "refBase": "T", "readBase": "C", "read": 89, "common": true, "asSupplied": { "read": 912, "readBase": "G" } }, { "kind": "deletion", "refStart": 51, "refEnd": 52, "length": 2, "bases": "TT", "readAfter": 90, "asSupplied": { "readBetween": [ 910, 911 ] }, "common": true }, { "kind": "deletion", "refStart": 56, "refEnd": 57, "length": 2, "bases": "GA", "readAfter": 93, "asSupplied": { "readBetween": [ 907, 908 ] }, "common": true }, { "kind": "deletion", "refStart": 63, "refEnd": 68, "length": 6, "bases": "TTATTC", "readAfter": 98, "asSupplied": { "readBetween": [ 902, 903 ] }, "common": false, "notFixed": { "from": { "ref": 62, "read": 98, "readAsSupplied": 903 }, "to": { "ref": 71, "read": 101, "readAsSupplied": 900 } } }, { "kind": "deletion", "refStart": 73, "refEnd": 73, "length": 1, "bases": "T", "readAfter": 102, "asSupplied": { "readBetween": [ 898, 899 ] }, "common": false, "notFixed": { "from": { "ref": 72, "read": 102, "readAsSupplied": 899 }, "to": { "ref": 75, "read": 104, "readAsSupplied": 897 } } }, { "kind": "substitution", "ref": 77, "refBase": "T", "readBase": "G", "read": 106, "common": true, "asSupplied": { "read": 895, "readBase": "C" } }, { "kind": "substitution", "ref": 78, "refBase": "A", "readBase": "C", "read": 107, "common": true, "asSupplied": { "read": 894, "readBase": "G" } }, { "kind": "substitution", "ref": 80, "refBase": "A", "readBase": "T", "read": 109, "common": true, "asSupplied": { "read": 892, "readBase": "A" } }, { "kind": "substitution", "ref": 83, "refBase": "A", "readBase": "G", "read": 112, "common": true, "asSupplied": { "read": 889, "readBase": "C" } }, { "kind": "deletion", "refStart": 85, "refEnd": 85, "length": 1, "bases": "G", "readAfter": 113, "asSupplied": { "readBetween": [ 887, 888 ] }, "common": true }, { "kind": "substitution", "ref": 87, "refBase": "C", "readBase": "A", "read": 115, "common": true, "asSupplied": { "read": 886, "readBase": "T" } }, { "kind": "deletion", "refStart": 91, "refEnd": 91, "length": 1, "bases": "G", "readAfter": 118, "asSupplied": { "readBetween": [ 882, 883 ] }, "common": true }, { "kind": "insertion", "refAfter": 93, "length": 1, "bases": "T", "readStart": 121, "readEnd": 121, "asSupplied": { "readStart": 880, "readEnd": 880, "bases": "A" }, "common": true }, { "kind": "substitution", "ref": 95, "refBase": "T", "readBase": "A", "read": 123, "common": true, "asSupplied": { "read": 878, "readBase": "T" } }, { "kind": "substitution", "ref": 96, "refBase": "C", "readBase": "A", "read": 124, "common": true, "asSupplied": { "read": 877, "readBase": "T" } }, { "kind": "substitution", "ref": 97, "refBase": "C", "readBase": "A", "read": 125, "common": true, "asSupplied": { "read": 876, "readBase": "T" } }, { "kind": "insertion", "refAfter": 99, "length": 1, "bases": "T", "readStart": 128, "readEnd": 128, "asSupplied": { "readStart": 873, "readEnd": 873, "bases": "A" }, "common": true }, { "kind": "substitution", "ref": 102, "refBase": "G", "readBase": "T", "read": 131, "common": true, "asSupplied": { "read": 870, "readBase": "A" } }, { "kind": "substitution", "ref": 103, "refBase": "G", "readBase": "T", "read": 132, "common": true, "asSupplied": { "read": 869, "readBase": "A" } }, { "kind": "substitution", "ref": 104, "refBase": "G", "readBase": "T", "read": 133, "common": true, "asSupplied": { "read": 868, "readBase": "A" } }, { "kind": "insertion", "refAfter": 107, "length": 2, "bases": "TG", "readStart": 137, "readEnd": 138, "asSupplied": { "readStart": 863, "readEnd": 864, "bases": "CA" }, "common": true }, { "kind": "substitution", "ref": 110, "refBase": "T", "readBase": "C", "read": 141, "common": true, "asSupplied": { "read": 860, "readBase": "G" } }, { "kind": "substitution", "ref": 111, "refBase": "A", "readBase": "T", "read": 142, "common": true, "asSupplied": { "read": 859, "readBase": "A" } }, { "kind": "substitution", "ref": 113, "refBase": "G", "readBase": "T", "read": 144, "common": true, "asSupplied": { "read": 857, "readBase": "A" } }, { "kind": "insertion", "refAfter": 115, "length": 2, "bases": "TG", "readStart": 147, "readEnd": 148, "asSupplied": { "readStart": 853, "readEnd": 854, "bases": "CA" }, "common": true }, { "kind": "substitution", "ref": 118, "refBase": "A", "readBase": "C", "read": 151, "common": true, "asSupplied": { "read": 850, "readBase": "G" } }, { "kind": "substitution", "ref": 121, "refBase": "A", "readBase": "T", "read": 154, "common": true, "asSupplied": { "read": 847, "readBase": "A" } }, { "kind": "substitution", "ref": 122, "refBase": "A", "readBase": "T", "read": 155, "common": true, "asSupplied": { "read": 846, "readBase": "A" } }, { "kind": "deletion", "refStart": 124, "refEnd": 124, "length": 1, "bases": "G", "readAfter": 156, "asSupplied": { "readBetween": [ 844, 845 ] }, "common": true }, { "kind": "substitution", "ref": 127, "refBase": "G", "readBase": "T", "read": 159, "common": true, "asSupplied": { "read": 842, "readBase": "A" } }, { "kind": "deletion", "refStart": 129, "refEnd": 129, "length": 1, "bases": "T", "readAfter": 160, "asSupplied": { "readBetween": [ 840, 841 ] }, "common": false, "notFixed": { "from": { "ref": 128, "read": 160, "readAsSupplied": 841 }, "to": { "ref": 131, "read": 162, "readAsSupplied": 839 } } }, { "kind": "substitution", "ref": 136, "refBase": "G", "readBase": "C", "read": 167, "common": true, "asSupplied": { "read": 834, "readBase": "G" } }, { "kind": "substitution", "ref": 138, "refBase": "A", "readBase": "T", "read": 169, "common": true, "asSupplied": { "read": 832, "readBase": "A" } }, { "kind": "insertion", "refAfter": 140, "length": 1, "bases": "T", "readStart": 172, "readEnd": 172, "asSupplied": { "readStart": 829, "readEnd": 829, "bases": "A" }, "common": true }, { "kind": "substitution", "ref": 143, "refBase": "T", "readBase": "C", "read": 175, "common": true, "asSupplied": { "read": 826, "readBase": "G" } }, { "kind": "deletion", "refStart": 145, "refEnd": 148, "length": 4, "bases": "GGTT", "readAfter": 176, "asSupplied": { "readBetween": [ 824, 825 ] }, "common": false, "notFixed": { "from": { "ref": 144, "read": 176, "readAsSupplied": 825 }, "to": { "ref": 150, "read": 178, "readAsSupplied": 823 } } }, { "kind": "substitution", "ref": 149, "refBase": "T", "readBase": "A", "read": 177, "common": false, "notFixed": { "from": { "ref": 144, "read": 176, "readAsSupplied": 825 }, "to": { "ref": 150, "read": 178, "readAsSupplied": 823 } }, "asSupplied": { "read": 824, "readBase": "T" } }, { "kind": "substitution", "ref": 152, "refBase": "T", "readBase": "A", "read": 180, "common": true, "asSupplied": { "read": 821, "readBase": "T" } }, { "kind": "substitution", "ref": 153, "refBase": "T", "readBase": "A", "read": 181, "common": true, "asSupplied": { "read": 820, "readBase": "T" } }, { "kind": "substitution", "ref": 154, "refBase": "T", "readBase": "C", "read": 182, "common": true, "asSupplied": { "read": 819, "readBase": "G" } }, { "kind": "substitution", "ref": 155, "refBase": "T", "readBase": "A", "read": 183, "common": true, "asSupplied": { "read": 818, "readBase": "T" } }, { "kind": "substitution", "ref": 158, "refBase": "T", "readBase": "G", "read": 186, "common": true, "asSupplied": { "read": 815, "readBase": "C" } }, { "kind": "substitution", "ref": 160, "refBase": "C", "readBase": "A", "read": 188, "common": true, "asSupplied": { "read": 813, "readBase": "T" } }, { "kind": "deletion", "refStart": 164, "refEnd": 168, "length": 5, "bases": "GGCGT", "readAfter": 191, "asSupplied": { "readBetween": [ 809, 810 ] }, "common": true }, { "kind": "deletion", "refStart": 171, "refEnd": 171, "length": 1, "bases": "T", "readAfter": 193, "asSupplied": { "readBetween": [ 807, 808 ] }, "common": false, "notFixed": { "from": { "ref": 170, "read": 193, "readAsSupplied": 808 }, "to": { "ref": 174, "read": 196, "readAsSupplied": 805 } } }, { "kind": "deletion", "refStart": 175, "refEnd": 178, "length": 4, "bases": "GGTT", "readAfter": 196, "asSupplied": { "readBetween": [ 804, 805 ] }, "common": true }, { "kind": "substitution", "ref": 182, "refBase": "T", "readBase": "C", "read": 200, "common": true, "asSupplied": { "read": 801, "readBase": "G" } }, { "kind": "substitution", "ref": 186, "refBase": "C", "readBase": "G", "read": 204, "common": true, "asSupplied": { "read": 797, "readBase": "C" } }, { "kind": "substitution", "ref": 188, "refBase": "T", "readBase": "G", "read": 206, "common": true, "asSupplied": { "read": 795, "readBase": "C" } }, { "kind": "insertion", "refAfter": 190, "length": 1, "bases": "A", "readStart": 209, "readEnd": 209, "asSupplied": { "readStart": 792, "readEnd": 792, "bases": "T" }, "common": true }, { "kind": "substitution", "ref": 193, "refBase": "A", "readBase": "T", "read": 212, "common": true, "asSupplied": { "read": 789, "readBase": "A" } }, { "kind": "substitution", "ref": 196, "refBase": "A", "readBase": "G", "read": 215, "common": true, "asSupplied": { "read": 786, "readBase": "C" } }, { "kind": "deletion", "refStart": 198, "refEnd": 200, "length": 3, "bases": "TCT", "readAfter": 216, "asSupplied": { "readBetween": [ 784, 785 ] }, "common": false, "notFixed": { "from": { "ref": 197, "read": 216, "readAsSupplied": 785 }, "to": { "ref": 203, "read": 219, "readAsSupplied": 782 } } }, { "kind": "substitution", "ref": 202, "refBase": "T", "readBase": "G", "read": 218, "common": false, "notFixed": { "from": { "ref": 197, "read": 216, "readAsSupplied": 785 }, "to": { "ref": 203, "read": 219, "readAsSupplied": 782 } }, "asSupplied": { "read": 783, "readBase": "C" } }, { "kind": "substitution", "ref": 205, "refBase": "T", "readBase": "A", "read": 221, "common": true, "asSupplied": { "read": 780, "readBase": "T" } }, { "kind": "insertion", "refAfter": 209, "length": 1, "bases": "C", "readStart": 226, "readEnd": 226, "asSupplied": { "readStart": 775, "readEnd": 775, "bases": "G" }, "common": false, "notFixed": { "from": { "ref": 209, "read": 225, "readAsSupplied": 776 }, "to": { "ref": 212, "read": 231, "readAsSupplied": 770 } } }, { "kind": "insertion", "refAfter": 210, "length": 2, "bases": "AT", "readStart": 228, "readEnd": 229, "asSupplied": { "readStart": 772, "readEnd": 773, "bases": "AT" }, "common": false, "notFixed": { "from": { "ref": 209, "read": 225, "readAsSupplied": 776 }, "to": { "ref": 212, "read": 231, "readAsSupplied": 770 } } }, { "kind": "substitution", "ref": 214, "refBase": "T", "readBase": "G", "read": 233, "common": true, "asSupplied": { "read": 768, "readBase": "C" } }, { "kind": "substitution", "ref": 216, "refBase": "A", "readBase": "T", "read": 235, "common": true, "asSupplied": { "read": 766, "readBase": "A" } }, { "kind": "deletion", "refStart": 221, "refEnd": 221, "length": 1, "bases": "T", "readAfter": 239, "asSupplied": { "readBetween": [ 761, 762 ] }, "common": true }, { "kind": "deletion", "refStart": 223, "refEnd": 223, "length": 1, "bases": "T", "readAfter": 240, "asSupplied": { "readBetween": [ 760, 761 ] }, "common": false, "notFixed": { "from": { "ref": 222, "read": 240, "readAsSupplied": 761 }, "to": { "ref": 225, "read": 242, "readAsSupplied": 759 } } }, { "kind": "substitution", "ref": 224, "refBase": "G", "readBase": "C", "read": 241, "common": false, "notFixed": { "from": { "ref": 222, "read": 240, "readAsSupplied": 761 }, "to": { "ref": 225, "read": 242, "readAsSupplied": 759 } }, "asSupplied": { "read": 760, "readBase": "G" } }, { "kind": "deletion", "refStart": 230, "refEnd": 231, "length": 2, "bases": "AA", "readAfter": 246, "asSupplied": { "readBetween": [ 754, 755 ] }, "common": true }, { "kind": "deletion", "refStart": 233, "refEnd": 233, "length": 1, "bases": "A", "readAfter": 247, "asSupplied": { "readBetween": [ 753, 754 ] }, "common": false, "notFixed": { "from": { "ref": 232, "read": 247, "readAsSupplied": 754 }, "to": { "ref": 235, "read": 249, "readAsSupplied": 752 } } }, { "kind": "substitution", "ref": 234, "refBase": "G", "readBase": "C", "read": 248, "common": false, "notFixed": { "from": { "ref": 232, "read": 247, "readAsSupplied": 754 }, "to": { "ref": 235, "read": 249, "readAsSupplied": 752 } }, "asSupplied": { "read": 753, "readBase": "G" } }, { "kind": "substitution", "ref": 241, "refBase": "T", "readBase": "C", "read": 255, "common": true, "asSupplied": { "read": 746, "readBase": "G" } }, { "kind": "substitution", "ref": 242, "refBase": "T", "readBase": "A", "read": 256, "common": true, "asSupplied": { "read": 745, "readBase": "T" } }, { "kind": "substitution", "ref": 243, "refBase": "G", "readBase": "A", "read": 257, "common": true, "asSupplied": { "read": 744, "readBase": "T" } }, { "kind": "deletion", "refStart": 250, "refEnd": 251, "length": 2, "bases": "GA", "readAfter": 263, "asSupplied": { "readBetween": [ 737, 738 ] }, "common": true }, { "kind": "insertion", "refAfter": 252, "length": 1, "bases": "T", "readStart": 265, "readEnd": 265, "asSupplied": { "readStart": 736, "readEnd": 736, "bases": "A" }, "common": true }, { "kind": "substitution", "ref": 255, "refBase": "A", "readBase": "T", "read": 268, "common": true, "asSupplied": { "read": 733, "readBase": "A" } }, { "kind": "insertion", "refAfter": 260, "length": 1, "bases": "C", "readStart": 274, "readEnd": 274, "asSupplied": { "readStart": 727, "readEnd": 727, "bases": "G" }, "common": false, "notFixed": { "from": { "ref": 260, "read": 273, "readAsSupplied": 728 }, "to": { "ref": 262, "read": 276, "readAsSupplied": 725 } } }, { "kind": "substitution", "ref": 261, "refBase": "G", "readBase": "A", "read": 275, "common": false, "notFixed": { "from": { "ref": 260, "read": 273, "readAsSupplied": 728 }, "to": { "ref": 262, "read": 276, "readAsSupplied": 725 } }, "asSupplied": { "read": 726, "readBase": "T" } }, { "kind": "insertion", "refAfter": 262, "length": 1, "bases": "A", "readStart": 277, "readEnd": 277, "asSupplied": { "readStart": 724, "readEnd": 724, "bases": "T" }, "common": true }, { "kind": "substitution", "ref": 267, "refBase": "A", "readBase": "T", "read": 282, "common": true, "asSupplied": { "read": 719, "readBase": "A" } }, { "kind": "substitution", "ref": 269, "refBase": "C", "readBase": "A", "read": 284, "common": true, "asSupplied": { "read": 717, "readBase": "T" } }, { "kind": "deletion", "refStart": 273, "refEnd": 273, "length": 1, "bases": "A", "readAfter": 287, "asSupplied": { "readBetween": [ 713, 714 ] }, "common": false, "notFixed": { "from": { "ref": 271, "read": 286, "readAsSupplied": 715 }, "to": { "ref": 277, "read": 289, "readAsSupplied": 712 } } }, { "kind": "deletion", "refStart": 275, "refEnd": 276, "length": 2, "bases": "TG", "readAfter": 288, "asSupplied": { "readBetween": [ 712, 713 ] }, "common": false, "notFixed": { "from": { "ref": 271, "read": 286, "readAsSupplied": 715 }, "to": { "ref": 277, "read": 289, "readAsSupplied": 712 } } }, { "kind": "substitution", "ref": 281, "refBase": "T", "readBase": "A", "read": 293, "common": true, "asSupplied": { "read": 708, "readBase": "T" } }, { "kind": "insertion", "refAfter": 283, "length": 3, "bases": "AAA", "readStart": 296, "readEnd": 298, "asSupplied": { "readStart": 703, "readEnd": 705, "bases": "TTT" }, "common": false, "notFixed": { "from": { "ref": 283, "read": 295, "readAsSupplied": 706 }, "to": { "ref": 286, "read": 301, "readAsSupplied": 700 } } }, { "kind": "substitution", "ref": 284, "refBase": "C", "readBase": "G", "read": 299, "common": false, "notFixed": { "from": { "ref": 283, "read": 295, "readAsSupplied": 706 }, "to": { "ref": 286, "read": 301, "readAsSupplied": 700 } }, "asSupplied": { "read": 702, "readBase": "C" } }, { "kind": "substitution", "ref": 287, "refBase": "C", "readBase": "T", "read": 302, "common": true, "asSupplied": { "read": 699, "readBase": "A" } }, { "kind": "substitution", "ref": 290, "refBase": "A", "readBase": "T", "read": 305, "common": true, "asSupplied": { "read": 696, "readBase": "A" } }, { "kind": "deletion", "refStart": 293, "refEnd": 293, "length": 1, "bases": "T", "readAfter": 307, "asSupplied": { "readBetween": [ 693, 694 ] }, "common": true }, { "kind": "substitution", "ref": 296, "refBase": "C", "readBase": "A", "read": 310, "common": true, "asSupplied": { "read": 691, "readBase": "T" } }, { "kind": "substitution", "ref": 298, "refBase": "C", "readBase": "G", "read": 312, "common": true, "asSupplied": { "read": 689, "readBase": "C" } }, { "kind": "substitution", "ref": 302, "refBase": "G", "readBase": "A", "read": 316, "common": true, "asSupplied": { "read": 685, "readBase": "T" } }, { "kind": "insertion", "refAfter": 305, "length": 4, "bases": "AACC", "readStart": 320, "readEnd": 323, "asSupplied": { "readStart": 678, "readEnd": 681, "bases": "GGTT" }, "common": true }, { "kind": "insertion", "refAfter": 306, "length": 1, "bases": "A", "readStart": 325, "readEnd": 325, "asSupplied": { "readStart": 676, "readEnd": 676, "bases": "T" }, "common": false, "notFixed": { "from": { "ref": 306, "read": 324, "readAsSupplied": 677 }, "to": { "ref": 309, "read": 328, "readAsSupplied": 673 } } }, { "kind": "insertion", "refAfter": 310, "length": 5, "bases": "ACGCC", "readStart": 330, "readEnd": 334, "asSupplied": { "readStart": 667, "readEnd": 671, "bases": "GGCGT" }, "common": true }, { "kind": "substitution", "ref": 314, "refBase": "T", "readBase": "G", "read": 338, "common": true, "asSupplied": { "read": 663, "readBase": "C" } }, { "kind": "substitution", "ref": 316, "refBase": "C", "readBase": "A", "read": 340, "common": true, "asSupplied": { "read": 661, "readBase": "T" } }, { "kind": "substitution", "ref": 319, "refBase": "T", "readBase": "A", "read": 343, "common": true, "asSupplied": { "read": 658, "readBase": "T" } }, { "kind": "substitution", "ref": 320, "refBase": "G", "readBase": "A", "read": 344, "common": true, "asSupplied": { "read": 657, "readBase": "T" } }, { "kind": "substitution", "ref": 321, "refBase": "T", "readBase": "A", "read": 345, "common": true, "asSupplied": { "read": 656, "readBase": "T" } }, { "kind": "substitution", "ref": 322, "refBase": "T", "readBase": "A", "read": 346, "common": true, "asSupplied": { "read": 655, "readBase": "T" } }, { "kind": "insertion", "refAfter": 324, "length": 4, "bases": "AAAC", "readStart": 349, "readEnd": 352, "asSupplied": { "readStart": 649, "readEnd": 652, "bases": "GTTT" }, "common": false, "notFixed": { "from": { "ref": 324, "read": 348, "readAsSupplied": 653 }, "to": { "ref": 326, "read": 354, "readAsSupplied": 647 } } }, { "kind": "substitution", "ref": 325, "refBase": "T", "readBase": "C", "read": 353, "common": false, "notFixed": { "from": { "ref": 324, "read": 348, "readAsSupplied": 653 }, "to": { "ref": 326, "read": 354, "readAsSupplied": 647 } }, "asSupplied": { "read": 648, "readBase": "G" } }, { "kind": "substitution", "ref": 327, "refBase": "G", "readBase": "A", "read": 355, "common": true, "asSupplied": { "read": 646, "readBase": "T" } }, { "kind": "deletion", "refStart": 330, "refEnd": 330, "length": 1, "bases": "A", "readAfter": 357, "asSupplied": { "readBetween": [ 643, 644 ] }, "common": true }, { "kind": "substitution", "ref": 333, "refBase": "A", "readBase": "T", "read": 360, "common": true, "asSupplied": { "read": 641, "readBase": "A" } }, { "kind": "substitution", "ref": 335, "refBase": "G", "readBase": "C", "read": 362, "common": true, "asSupplied": { "read": 639, "readBase": "G" } }, { "kind": "insertion", "refAfter": 340, "length": 1, "bases": "A", "readStart": 368, "readEnd": 368, "asSupplied": { "readStart": 633, "readEnd": 633, "bases": "T" }, "common": false, "notFixed": { "from": { "ref": 340, "read": 367, "readAsSupplied": 634 }, "to": { "ref": 342, "read": 370, "readAsSupplied": 631 } } }, { "kind": "substitution", "ref": 343, "refBase": "A", "readBase": "C", "read": 371, "common": true, "asSupplied": { "read": 630, "readBase": "G" } }, { "kind": "insertion", "refAfter": 345, "length": 1, "bases": "C", "readStart": 374, "readEnd": 374, "asSupplied": { "readStart": 627, "readEnd": 627, "bases": "G" }, "common": true }, { "kind": "substitution", "ref": 347, "refBase": "A", "readBase": "T", "read": 376, "common": true, "asSupplied": { "read": 625, "readBase": "A" } }, { "kind": "substitution", "ref": 348, "refBase": "A", "readBase": "T", "read": 377, "common": true, "asSupplied": { "read": 624, "readBase": "A" } }, { "kind": "substitution", "ref": 351, "refBase": "G", "readBase": "T", "read": 380, "common": true, "asSupplied": { "read": 621, "readBase": "A" } }, { "kind": "deletion", "refStart": 354, "refEnd": 355, "length": 2, "bases": "CA", "readAfter": 382, "asSupplied": { "readBetween": [ 618, 619 ] }, "common": true }, { "kind": "substitution", "ref": 358, "refBase": "A", "readBase": "C", "read": 385, "common": true, "asSupplied": { "read": 616, "readBase": "G" } }, { "kind": "substitution", "ref": 360, "refBase": "A", "readBase": "T", "read": 387, "common": true, "asSupplied": { "read": 614, "readBase": "A" } }, { "kind": "substitution", "ref": 361, "refBase": "G", "readBase": "A", "read": 388, "common": true, "asSupplied": { "read": 613, "readBase": "T" } }, { "kind": "deletion", "refStart": 364, "refEnd": 365, "length": 2, "bases": "CA", "readAfter": 390, "asSupplied": { "readBetween": [ 610, 611 ] }, "common": true }, { "kind": "substitution", "ref": 369, "refBase": "A", "readBase": "C", "read": 394, "common": true, "asSupplied": { "read": 607, "readBase": "G" } }, { "kind": "substitution", "ref": 370, "refBase": "A", "readBase": "C", "read": 395, "common": true, "asSupplied": { "read": 606, "readBase": "G" } }, { "kind": "substitution", "ref": 371, "refBase": "A", "readBase": "C", "read": 396, "common": true, "asSupplied": { "read": 605, "readBase": "G" } }, { "kind": "deletion", "refStart": 374, "refEnd": 374, "length": 1, "bases": "A", "readAfter": 398, "asSupplied": { "readBetween": [ 602, 603 ] }, "common": true }, { "kind": "substitution", "ref": 377, "refBase": "T", "readBase": "G", "read": 401, "common": true, "asSupplied": { "read": 600, "readBase": "C" } }, { "kind": "substitution", "ref": 378, "refBase": "T", "readBase": "G", "read": 402, "common": true, "asSupplied": { "read": 599, "readBase": "C" } }, { "kind": "substitution", "ref": 379, "refBase": "T", "readBase": "A", "read": 403, "common": true, "asSupplied": { "read": 598, "readBase": "T" } }, { "kind": "deletion", "refStart": 381, "refEnd": 381, "length": 1, "bases": "A", "readAfter": 404, "asSupplied": { "readBetween": [ 596, 597 ] }, "common": true }, { "kind": "insertion", "refAfter": 383, "length": 1, "bases": "C", "readStart": 407, "readEnd": 407, "asSupplied": { "readStart": 594, "readEnd": 594, "bases": "G" }, "common": true }, { "kind": "substitution", "ref": 387, "refBase": "T", "readBase": "G", "read": 411, "common": true, "asSupplied": { "read": 590, "readBase": "C" } }, { "kind": "insertion", "refAfter": 388, "length": 1, "bases": "C", "readStart": 413, "readEnd": 413, "asSupplied": { "readStart": 588, "readEnd": 588, "bases": "G" }, "common": true }, { "kind": "substitution", "ref": 390, "refBase": "C", "readBase": "T", "read": 415, "common": true, "asSupplied": { "read": 586, "readBase": "A" } }, { "kind": "substitution", "ref": 393, "refBase": "A", "readBase": "T", "read": 418, "common": true, "asSupplied": { "read": 583, "readBase": "A" } }, { "kind": "substitution", "ref": 395, "refBase": "G", "readBase": "T", "read": 420, "common": true, "asSupplied": { "read": 581, "readBase": "A" } }, { "kind": "substitution", "ref": 396, "refBase": "C", "readBase": "A", "read": 421, "common": true, "asSupplied": { "read": 580, "readBase": "T" } }, { "kind": "insertion", "refAfter": 398, "length": 1, "bases": "A", "readStart": 424, "readEnd": 424, "asSupplied": { "readStart": 577, "readEnd": 577, "bases": "T" }, "common": false, "notFixed": { "from": { "ref": 398, "read": 423, "readAsSupplied": 578 }, "to": { "ref": 400, "read": 426, "readAsSupplied": 575 } } }, { "kind": "insertion", "refAfter": 401, "length": 6, "bases": "AAGAAT", "readStart": 428, "readEnd": 433, "asSupplied": { "readStart": 568, "readEnd": 573, "bases": "ATTCTT" }, "common": false, "notFixed": { "from": { "ref": 401, "read": 427, "readAsSupplied": 574 }, "to": { "ref": 404, "read": 436, "readAsSupplied": 565 } } }, { "kind": "insertion", "refAfter": 408, "length": 2, "bases": "TC", "readStart": 441, "readEnd": 442, "asSupplied": { "readStart": 559, "readEnd": 560, "bases": "GA" }, "common": true }, { "kind": "insertion", "refAfter": 411, "length": 2, "bases": "AA", "readStart": 446, "readEnd": 447, "asSupplied": { "readStart": 554, "readEnd": 555, "bases": "TT" }, "common": true }, { "kind": "substitution", "ref": 413, "refBase": "G", "readBase": "A", "read": 449, "common": true, "asSupplied": { "read": 552, "readBase": "T" } }, { "kind": "insertion", "refAfter": 414, "length": 2, "bases": "CT", "readStart": 451, "readEnd": 452, "asSupplied": { "readStart": 549, "readEnd": 550, "bases": "AG" }, "common": false, "notFixed": { "from": { "ref": 414, "read": 450, "readAsSupplied": 551 }, "to": { "ref": 416, "read": 454, "readAsSupplied": 547 } } }, { "kind": "substitution", "ref": 418, "refBase": "A", "readBase": "T", "read": 456, "common": true, "asSupplied": { "read": 545, "readBase": "A" } }, { "kind": "substitution", "ref": 422, "refBase": "T", "readBase": "A", "read": 460, "common": true, "asSupplied": { "read": 541, "readBase": "T" } }, { "kind": "substitution", "ref": 423, "refBase": "C", "readBase": "G", "read": 461, "common": true, "asSupplied": { "read": 540, "readBase": "C" } }, { "kind": "substitution", "ref": 425, "refBase": "T", "readBase": "A", "read": 463, "common": true, "asSupplied": { "read": 538, "readBase": "T" } }, { "kind": "substitution", "ref": 428, "refBase": "C", "readBase": "A", "read": 466, "common": true, "asSupplied": { "read": 535, "readBase": "T" } }, { "kind": "substitution", "ref": 430, "refBase": "T", "readBase": "G", "read": 468, "common": true, "asSupplied": { "read": 533, "readBase": "C" } }, { "kind": "substitution", "ref": 436, "refBase": "A", "readBase": "T", "read": 474, "common": true, "asSupplied": { "read": 527, "readBase": "A" } }, { "kind": "substitution", "ref": 437, "refBase": "A", "readBase": "C", "read": 475, "common": true, "asSupplied": { "read": 526, "readBase": "G" } }, { "kind": "substitution", "ref": 438, "refBase": "G", "readBase": "T", "read": 476, "common": true, "asSupplied": { "read": 525, "readBase": "A" } }, { "kind": "substitution", "ref": 439, "refBase": "G", "readBase": "T", "read": 477, "common": true, "asSupplied": { "read": 524, "readBase": "A" } }, { "kind": "substitution", "ref": 443, "refBase": "G", "readBase": "A", "read": 481, "common": true, "asSupplied": { "read": 520, "readBase": "T" } }, { "kind": "deletion", "refStart": 445, "refEnd": 446, "length": 2, "bases": "GT", "readAfter": 482, "asSupplied": { "readBetween": [ 518, 519 ] }, "common": true }, { "kind": "deletion", "refStart": 450, "refEnd": 450, "length": 1, "bases": "G", "readAfter": 485, "asSupplied": { "readBetween": [ 515, 516 ] }, "common": true }, { "kind": "insertion", "refAfter": 454, "length": 2, "bases": "GC", "readStart": 490, "readEnd": 491, "asSupplied": { "readStart": 510, "readEnd": 511, "bases": "GC" }, "common": true }, { "kind": "substitution", "ref": 456, "refBase": "A", "readBase": "T", "read": 493, "common": true, "asSupplied": { "read": 508, "readBase": "A" } }, { "kind": "substitution", "ref": 460, "refBase": "T", "readBase": "A", "read": 497, "common": true, "asSupplied": { "read": 504, "readBase": "T" } }, { "kind": "substitution", "ref": 463, "refBase": "T", "readBase": "C", "read": 500, "common": true, "asSupplied": { "read": 501, "readBase": "G" } }, { "kind": "substitution", "ref": 464, "refBase": "T", "readBase": "C", "read": 501, "common": true, "asSupplied": { "read": 500, "readBase": "G" } }, { "kind": "substitution", "ref": 468, "refBase": "G", "readBase": "A", "read": 505, "common": true, "asSupplied": { "read": 496, "readBase": "T" } }, { "kind": "substitution", "ref": 469, "refBase": "G", "readBase": "A", "read": 506, "common": true, "asSupplied": { "read": 495, "readBase": "T" } }, { "kind": "substitution", "ref": 470, "refBase": "G", "readBase": "C", "read": 507, "common": true, "asSupplied": { "read": 494, "readBase": "G" } }, { "kind": "insertion", "refAfter": 473, "length": 4, "bases": "AGCA", "readStart": 511, "readEnd": 514, "asSupplied": { "readStart": 487, "readEnd": 490, "bases": "TGCT" }, "common": false, "notFixed": { "from": { "ref": 473, "read": 510, "readAsSupplied": 491 }, "to": { "ref": 475, "read": 516, "readAsSupplied": 485 } } }, { "kind": "substitution", "ref": 476, "refBase": "T", "readBase": "A", "read": 517, "common": true, "asSupplied": { "read": 484, "readBase": "T" } }, { "kind": "substitution", "ref": 478, "refBase": "G", "readBase": "C", "read": 519, "common": true, "asSupplied": { "read": 482, "readBase": "G" } }, { "kind": "substitution", "ref": 480, "refBase": "G", "readBase": "C", "read": 521, "common": true, "asSupplied": { "read": 480, "readBase": "G" } }, { "kind": "substitution", "ref": 482, "refBase": "T", "readBase": "A", "read": 523, "common": true, "asSupplied": { "read": 478, "readBase": "T" } }, { "kind": "substitution", "ref": 484, "refBase": "A", "readBase": "T", "read": 525, "common": true, "asSupplied": { "read": 476, "readBase": "A" } }, { "kind": "substitution", "ref": 489, "refBase": "C", "readBase": "A", "read": 530, "common": true, "asSupplied": { "read": 471, "readBase": "T" } }, { "kind": "substitution", "ref": 490, "refBase": "C", "readBase": "A", "read": 531, "common": true, "asSupplied": { "read": 470, "readBase": "T" } }, { "kind": "insertion", "refAfter": 491, "length": 1, "bases": "G", "readStart": 533, "readEnd": 533, "asSupplied": { "readStart": 468, "readEnd": 468, "bases": "C" }, "common": true }, { "kind": "insertion", "refAfter": 492, "length": 1, "bases": "A", "readStart": 535, "readEnd": 535, "asSupplied": { "readStart": 466, "readEnd": 466, "bases": "T" }, "common": true }, { "kind": "insertion", "refAfter": 495, "length": 3, "bases": "CCA", "readStart": 539, "readEnd": 541, "asSupplied": { "readStart": 460, "readEnd": 462, "bases": "TGG" }, "common": true }, { "kind": "substitution", "ref": 497, "refBase": "G", "readBase": "C", "read": 543, "common": true, "asSupplied": { "read": 458, "readBase": "G" } }, { "kind": "substitution", "ref": 499, "refBase": "T", "readBase": "A", "read": 545, "common": true, "asSupplied": { "read": 456, "readBase": "T" } }, { "kind": "deletion", "refStart": 501, "refEnd": 501, "length": 1, "bases": "T", "readAfter": 546, "asSupplied": { "readBetween": [ 454, 455 ] }, "common": true }, { "kind": "substitution", "ref": 504, "refBase": "G", "readBase": "A", "read": 549, "common": true, "asSupplied": { "read": 452, "readBase": "T" } }, { "kind": "insertion", "refAfter": 507, "length": 12, "bases": "AAAAAGTAAAGC", "readStart": 553, "readEnd": 564, "asSupplied": { "readStart": 437, "readEnd": 448, "bases": "GCTTTACTTTTT" }, "common": false, "notFixed": { "from": { "ref": 507, "read": 552, "readAsSupplied": 449 }, "to": { "ref": 510, "read": 567, "readAsSupplied": 434 } } }, { "kind": "substitution", "ref": 511, "refBase": "T", "readBase": "A", "read": 568, "common": true, "asSupplied": { "read": 433, "readBase": "T" } }, { "kind": "substitution", "ref": 513, "refBase": "T", "readBase": "C", "read": 570, "common": true, "asSupplied": { "read": 431, "readBase": "G" } }, { "kind": "insertion", "refAfter": 516, "length": 7, "bases": "ACTCACC", "readStart": 574, "readEnd": 580, "asSupplied": { "readStart": 421, "readEnd": 427, "bases": "GGTGAGT" }, "common": true }, { "kind": "insertion", "refAfter": 520, "length": 1, "bases": "C", "readStart": 585, "readEnd": 585, "asSupplied": { "readStart": 416, "readEnd": 416, "bases": "G" }, "common": true }, { "kind": "substitution", "ref": 523, "refBase": "G", "readBase": "C", "read": 588, "common": true, "asSupplied": { "read": 413, "readBase": "G" } }, { "kind": "substitution", "ref": 525, "refBase": "T", "readBase": "G", "read": 590, "common": true, "asSupplied": { "read": 411, "readBase": "C" } }, { "kind": "insertion", "refAfter": 528, "length": 14, "bases": "CTTTCTTCTCTAAT", "readStart": 594, "readEnd": 607, "asSupplied": { "readStart": 394, "readEnd": 407, "bases": "ATTAGAGAAGAAAG" }, "common": true }, { "kind": "substitution", "ref": 530, "refBase": "G", "readBase": "T", "read": 609, "common": true, "asSupplied": { "read": 392, "readBase": "A" } }, { "kind": "substitution", "ref": 532, "refBase": "G", "readBase": "A", "read": 611, "common": true, "asSupplied": { "read": 390, "readBase": "T" } }, { "kind": "substitution", "ref": 534, "refBase": "G", "readBase": "A", "read": 613, "common": true, "asSupplied": { "read": 388, "readBase": "T" } }, { "kind": "substitution", "ref": 536, "refBase": "C", "readBase": "A", "read": 615, "common": true, "asSupplied": { "read": 386, "readBase": "T" } }, { "kind": "substitution", "ref": 537, "refBase": "C", "readBase": "T", "read": 616, "common": true, "asSupplied": { "read": 385, "readBase": "A" } }, { "kind": "insertion", "refAfter": 538, "length": 1, "bases": "G", "readStart": 618, "readEnd": 618, "asSupplied": { "readStart": 383, "readEnd": 383, "bases": "C" }, "common": true }, { "kind": "substitution", "ref": 540, "refBase": "C", "readBase": "G", "read": 620, "common": true, "asSupplied": { "read": 381, "readBase": "C" } }, { "kind": "insertion", "refAfter": 542, "length": 1, "bases": "T", "readStart": 623, "readEnd": 623, "asSupplied": { "readStart": 378, "readEnd": 378, "bases": "A" }, "common": false, "notFixed": { "from": { "ref": 542, "read": 622, "readAsSupplied": 379 }, "to": { "ref": 544, "read": 625, "readAsSupplied": 376 } } }, { "kind": "substitution", "ref": 543, "refBase": "A", "readBase": "T", "read": 624, "common": false, "notFixed": { "from": { "ref": 542, "read": 622, "readAsSupplied": 379 }, "to": { "ref": 544, "read": 625, "readAsSupplied": 376 } }, "asSupplied": { "read": 377, "readBase": "A" } }, { "kind": "substitution", "ref": 547, "refBase": "T", "readBase": "G", "read": 628, "common": true, "asSupplied": { "read": 373, "readBase": "C" } }, { "kind": "substitution", "ref": 548, "refBase": "C", "readBase": "T", "read": 629, "common": true, "asSupplied": { "read": 372, "readBase": "A" } }, { "kind": "substitution", "ref": 550, "refBase": "T", "readBase": "A", "read": 631, "common": true, "asSupplied": { "read": 370, "readBase": "T" } }, { "kind": "substitution", "ref": 554, "refBase": "C", "readBase": "G", "read": 635, "common": true, "asSupplied": { "read": 366, "readBase": "C" } }, { "kind": "insertion", "refAfter": 555, "length": 1, "bases": "A", "readStart": 637, "readEnd": 637, "asSupplied": { "readStart": 364, "readEnd": 364, "bases": "T" }, "common": true }, { "kind": "insertion", "refAfter": 557, "length": 2, "bases": "CT", "readStart": 640, "readEnd": 641, "asSupplied": { "readStart": 360, "readEnd": 361, "bases": "AG" }, "common": true }, { "kind": "substitution", "ref": 561, "refBase": "A", "readBase": "T", "read": 645, "common": true, "asSupplied": { "read": 356, "readBase": "A" } }, { "kind": "substitution", "ref": 562, "refBase": "C", "readBase": "T", "read": 646, "common": true, "asSupplied": { "read": 355, "readBase": "A" } }, { "kind": "substitution", "ref": 564, "refBase": "G", "readBase": "T", "read": 648, "common": true, "asSupplied": { "read": 353, "readBase": "A" } }, { "kind": "substitution", "ref": 565, "refBase": "A", "readBase": "T", "read": 649, "common": true, "asSupplied": { "read": 352, "readBase": "A" } }, { "kind": "substitution", "ref": 566, "refBase": "C", "readBase": "A", "read": 650, "common": true, "asSupplied": { "read": 351, "readBase": "T" } }, { "kind": "substitution", "ref": 569, "refBase": "G", "readBase": "A", "read": 653, "common": true, "asSupplied": { "read": 348, "readBase": "T" } }, { "kind": "substitution", "ref": 570, "refBase": "G", "readBase": "T", "read": 654, "common": true, "asSupplied": { "read": 347, "readBase": "A" } }, { "kind": "insertion", "refAfter": 573, "length": 1, "bases": "A", "readStart": 658, "readEnd": 658, "asSupplied": { "readStart": 343, "readEnd": 343, "bases": "T" }, "common": true }, { "kind": "insertion", "refAfter": 574, "length": 4, "bases": "ATAC", "readStart": 660, "readEnd": 663, "asSupplied": { "readStart": 338, "readEnd": 341, "bases": "GTAT" }, "common": true }, { "kind": "substitution", "ref": 576, "refBase": "G", "readBase": "A", "read": 665, "common": true, "asSupplied": { "read": 336, "readBase": "T" } }, { "kind": "substitution", "ref": 577, "refBase": "G", "readBase": "C", "read": 666, "common": true, "asSupplied": { "read": 335, "readBase": "G" } }, { "kind": "substitution", "ref": 578, "refBase": "T", "readBase": "A", "read": 667, "common": true, "asSupplied": { "read": 334, "readBase": "T" } }, { "kind": "deletion", "refStart": 582, "refEnd": 582, "length": 1, "bases": "G", "readAfter": 670, "asSupplied": { "readBetween": [ 330, 331 ] }, "common": true }, { "kind": "insertion", "refAfter": 584, "length": 2, "bases": "TC", "readStart": 673, "readEnd": 674, "asSupplied": { "readStart": 327, "readEnd": 328, "bases": "GA" }, "common": false, "notFixed": { "from": { "ref": 584, "read": 672, "readAsSupplied": 329 }, "to": { "ref": 586, "read": 676, "readAsSupplied": 325 } } }, { "kind": "substitution", "ref": 585, "refBase": "G", "readBase": "C", "read": 675, "common": false, "notFixed": { "from": { "ref": 584, "read": 672, "readAsSupplied": 329 }, "to": { "ref": 586, "read": 676, "readAsSupplied": 325 } }, "asSupplied": { "read": 326, "readBase": "G" } }, { "kind": "deletion", "refStart": 592, "refEnd": 593, "length": 2, "bases": "TT", "readAfter": 681, "asSupplied": { "readBetween": [ 319, 320 ] }, "common": false, "notFixed": { "from": { "ref": 591, "read": 681, "readAsSupplied": 320 }, "to": { "ref": 599, "read": 695, "readAsSupplied": 306 } } }, { "kind": "insertion", "refAfter": 595, "length": 1, "bases": "C", "readStart": 684, "readEnd": 684, "asSupplied": { "readStart": 317, "readEnd": 317, "bases": "G" }, "common": false, "notFixed": { "from": { "ref": 591, "read": 681, "readAsSupplied": 320 }, "to": { "ref": 599, "read": 695, "readAsSupplied": 306 } } }, { "kind": "substitution", "ref": 597, "refBase": "G", "readBase": "T", "read": 686, "common": false, "notFixed": { "from": { "ref": 591, "read": 681, "readAsSupplied": 320 }, "to": { "ref": 599, "read": 695, "readAsSupplied": 306 } }, "asSupplied": { "read": 315, "readBase": "A" } }, { "kind": "insertion", "refAfter": 598, "length": 7, "bases": "CCCCGTA", "readStart": 688, "readEnd": 694, "asSupplied": { "readStart": 307, "readEnd": 313, "bases": "TACGGGG" }, "common": false, "notFixed": { "from": { "ref": 591, "read": 681, "readAsSupplied": 320 }, "to": { "ref": 599, "read": 695, "readAsSupplied": 306 } } }, { "kind": "insertion", "refAfter": 603, "length": 6, "bases": "CAAGTA", "readStart": 700, "readEnd": 705, "asSupplied": { "readStart": 296, "readEnd": 301, "bases": "TACTTG" }, "common": false, "notFixed": { "from": { "ref": 603, "read": 699, "readAsSupplied": 302 }, "to": { "ref": 605, "read": 707, "readAsSupplied": 294 } } }, { "kind": "insertion", "refAfter": 607, "length": 2, "bases": "GC", "readStart": 710, "readEnd": 711, "asSupplied": { "readStart": 290, "readEnd": 291, "bases": "GC" }, "common": false, "notFixed": { "from": { "ref": 607, "read": 709, "readAsSupplied": 292 }, "to": { "ref": 609, "read": 717, "readAsSupplied": 284 } } }, { "kind": "insertion", "refAfter": 608, "length": 4, "bases": "AACT", "readStart": 713, "readEnd": 716, "asSupplied": { "readStart": 285, "readEnd": 288, "bases": "AGTT" }, "common": false, "notFixed": { "from": { "ref": 607, "read": 709, "readAsSupplied": 292 }, "to": { "ref": 609, "read": 717, "readAsSupplied": 284 } } }, { "kind": "substitution", "ref": 613, "refBase": "C", "readBase": "T", "read": 721, "common": true, "asSupplied": { "read": 280, "readBase": "A" } }, { "kind": "substitution", "ref": 614, "refBase": "T", "readBase": "A", "read": 722, "common": true, "asSupplied": { "read": 279, "readBase": "T" } }, { "kind": "substitution", "ref": 615, "refBase": "T", "readBase": "A", "read": 723, "common": true, "asSupplied": { "read": 278, "readBase": "T" } }, { "kind": "substitution", "ref": 616, "refBase": "T", "readBase": "A", "read": 724, "common": true, "asSupplied": { "read": 277, "readBase": "T" } }, { "kind": "substitution", "ref": 618, "refBase": "T", "readBase": "G", "read": 726, "common": true, "asSupplied": { "read": 275, "readBase": "C" } }, { "kind": "substitution", "ref": 621, "refBase": "C", "readBase": "T", "read": 729, "common": true, "asSupplied": { "read": 272, "readBase": "A" } }, { "kind": "substitution", "ref": 622, "refBase": "T", "readBase": "A", "read": 730, "common": true, "asSupplied": { "read": 271, "readBase": "T" } }, { "kind": "substitution", "ref": 625, "refBase": "G", "readBase": "C", "read": 733, "common": true, "asSupplied": { "read": 268, "readBase": "G" } }, { "kind": "insertion", "refAfter": 626, "length": 1, "bases": "A", "readStart": 735, "readEnd": 735, "asSupplied": { "readStart": 266, "readEnd": 266, "bases": "T" }, "common": true }, { "kind": "substitution", "ref": 629, "refBase": "A", "readBase": "C", "read": 738, "common": true, "asSupplied": { "read": 263, "readBase": "G" } }, { "kind": "insertion", "refAfter": 632, "length": 1, "bases": "A", "readStart": 742, "readEnd": 742, "asSupplied": { "readStart": 259, "readEnd": 259, "bases": "T" }, "common": true }, { "kind": "substitution", "ref": 634, "refBase": "G", "readBase": "A", "read": 744, "common": true, "asSupplied": { "read": 257, "readBase": "T" } }, { "kind": "insertion", "refAfter": 635, "length": 3, "bases": "TTA", "readStart": 746, "readEnd": 748, "asSupplied": { "readStart": 253, "readEnd": 255, "bases": "TAA" }, "common": false, "notFixed": { "from": { "ref": 635, "read": 745, "readAsSupplied": 256 }, "to": { "ref": 637, "read": 750, "readAsSupplied": 251 } } }, { "kind": "insertion", "refAfter": 638, "length": 4, "bases": "ACCG", "readStart": 752, "readEnd": 755, "asSupplied": { "readStart": 246, "readEnd": 249, "bases": "CGGT" }, "common": false, "notFixed": { "from": { "ref": 638, "read": 751, "readAsSupplied": 250 }, "to": { "ref": 640, "read": 757, "readAsSupplied": 244 } } }, { "kind": "substitution", "ref": 639, "refBase": "T", "readBase": "A", "read": 756, "common": false, "notFixed": { "from": { "ref": 638, "read": 751, "readAsSupplied": 250 }, "to": { "ref": 640, "read": 757, "readAsSupplied": 244 } }, "asSupplied": { "read": 245, "readBase": "T" } }, { "kind": "substitution", "ref": 643, "refBase": "A", "readBase": "C", "read": 760, "common": true, "asSupplied": { "read": 241, "readBase": "G" } }, { "kind": "insertion", "refAfter": 646, "length": 5, "bases": "GCATT", "readStart": 764, "readEnd": 768, "asSupplied": { "readStart": 233, "readEnd": 237, "bases": "AATGC" }, "common": true }, { "kind": "substitution", "ref": 652, "refBase": "A", "readBase": "T", "read": 774, "common": true, "asSupplied": { "read": 227, "readBase": "A" } }, { "kind": "substitution", "ref": 654, "refBase": "C", "readBase": "G", "read": 776, "common": true, "asSupplied": { "read": 225, "readBase": "C" } }, { "kind": "substitution", "ref": 657, "refBase": "C", "readBase": "T", "read": 779, "common": true, "asSupplied": { "read": 222, "readBase": "A" } }, { "kind": "deletion", "refStart": 659, "refEnd": 661, "length": 3, "bases": "GCT", "readAfter": 780, "asSupplied": { "readBetween": [ 220, 221 ] }, "common": true }, { "kind": "substitution", "ref": 664, "refBase": "C", "readBase": "G", "read": 783, "common": true, "asSupplied": { "read": 218, "readBase": "C" } }, { "kind": "substitution", "ref": 666, "refBase": "A", "readBase": "T", "read": 785, "common": true, "asSupplied": { "read": 216, "readBase": "A" } }, { "kind": "deletion", "refStart": 669, "refEnd": 670, "length": 2, "bases": "GT", "readAfter": 787, "asSupplied": { "readBetween": [ 213, 214 ] }, "common": false, "notFixed": { "from": { "ref": 668, "read": 787, "readAsSupplied": 214 }, "to": { "ref": 682, "read": 802, "readAsSupplied": 199 } } }, { "kind": "substitution", "ref": 672, "refBase": "G", "readBase": "C", "read": 789, "common": false, "notFixed": { "from": { "ref": 668, "read": 787, "readAsSupplied": 214 }, "to": { "ref": 682, "read": 802, "readAsSupplied": 199 } }, "asSupplied": { "read": 212, "readBase": "G" } }, { "kind": "substitution", "ref": 677, "refBase": "T", "readBase": "C", "read": 794, "common": false, "notFixed": { "from": { "ref": 668, "read": 787, "readAsSupplied": 214 }, "to": { "ref": 682, "read": 802, "readAsSupplied": 199 } }, "asSupplied": { "read": 207, "readBase": "G" } }, { "kind": "insertion", "refAfter": 678, "length": 3, "bases": "GAA", "readStart": 796, "readEnd": 798, "asSupplied": { "readStart": 203, "readEnd": 205, "bases": "TTC" }, "common": false, "notFixed": { "from": { "ref": 668, "read": 787, "readAsSupplied": 214 }, "to": { "ref": 682, "read": 802, "readAsSupplied": 199 } } }, { "kind": "substitution", "ref": 680, "refBase": "G", "readBase": "T", "read": 800, "common": false, "notFixed": { "from": { "ref": 668, "read": 787, "readAsSupplied": 214 }, "to": { "ref": 682, "read": 802, "readAsSupplied": 199 } }, "asSupplied": { "read": 201, "readBase": "A" } }, { "kind": "substitution", "ref": 681, "refBase": "C", "readBase": "T", "read": 801, "common": false, "notFixed": { "from": { "ref": 668, "read": 787, "readAsSupplied": 214 }, "to": { "ref": 682, "read": 802, "readAsSupplied": 199 } }, "asSupplied": { "read": 200, "readBase": "A" } }, { "kind": "substitution", "ref": 683, "refBase": "G", "readBase": "T", "read": 803, "common": true, "asSupplied": { "read": 198, "readBase": "A" } }, { "kind": "substitution", "ref": 684, "refBase": "G", "readBase": "T", "read": 804, "common": true, "asSupplied": { "read": 197, "readBase": "A" } }, { "kind": "substitution", "ref": 687, "refBase": "C", "readBase": "T", "read": 807, "common": true, "asSupplied": { "read": 194, "readBase": "A" } }, { "kind": "substitution", "ref": 688, "refBase": "A", "readBase": "T", "read": 808, "common": true, "asSupplied": { "read": 193, "readBase": "A" } }, { "kind": "substitution", "ref": 690, "refBase": "G", "readBase": "A", "read": 810, "common": true, "asSupplied": { "read": 191, "readBase": "T" } }, { "kind": "substitution", "ref": 692, "refBase": "G", "readBase": "A", "read": 812, "common": true, "asSupplied": { "read": 189, "readBase": "T" } }, { "kind": "substitution", "ref": 694, "refBase": "T", "readBase": "A", "read": 814, "common": true, "asSupplied": { "read": 187, "readBase": "T" } }, { "kind": "substitution", "ref": 695, "refBase": "A", "readBase": "T", "read": 815, "common": true, "asSupplied": { "read": 186, "readBase": "A" } }, { "kind": "substitution", "ref": 698, "refBase": "A", "readBase": "T", "read": 818, "common": true, "asSupplied": { "read": 183, "readBase": "A" } }, { "kind": "substitution", "ref": 699, "refBase": "A", "readBase": "T", "read": 819, "common": true, "asSupplied": { "read": 182, "readBase": "A" } }, { "kind": "substitution", "ref": 700, "refBase": "C", "readBase": "G", "read": 820, "common": true, "asSupplied": { "read": 181, "readBase": "C" } }, { "kind": "substitution", "ref": 702, "refBase": "C", "readBase": "A", "read": 822, "common": true, "asSupplied": { "read": 179, "readBase": "T" } }, { "kind": "deletion", "refStart": 708, "refEnd": 708, "length": 1, "bases": "C", "readAfter": 827, "asSupplied": { "readBetween": [ 173, 174 ] }, "common": false, "notFixed": { "from": { "ref": 707, "read": 827, "readAsSupplied": 174 }, "to": { "ref": 716, "read": 835, "readAsSupplied": 166 } } }, { "kind": "substitution", "ref": 710, "refBase": "G", "readBase": "A", "read": 829, "common": false, "notFixed": { "from": { "ref": 707, "read": 827, "readAsSupplied": 174 }, "to": { "ref": 716, "read": 835, "readAsSupplied": 166 } }, "asSupplied": { "read": 172, "readBase": "T" } }, { "kind": "substitution", "ref": 713, "refBase": "G", "readBase": "A", "read": 832, "common": false, "notFixed": { "from": { "ref": 707, "read": 827, "readAsSupplied": 174 }, "to": { "ref": 716, "read": 835, "readAsSupplied": 166 } }, "asSupplied": { "read": 169, "readBase": "T" } }, { "kind": "substitution", "ref": 715, "refBase": "T", "readBase": "C", "read": 834, "common": false, "notFixed": { "from": { "ref": 707, "read": 827, "readAsSupplied": 174 }, "to": { "ref": 716, "read": 835, "readAsSupplied": 166 } }, "asSupplied": { "read": 167, "readBase": "G" } }, { "kind": "substitution", "ref": 717, "refBase": "A", "readBase": "G", "read": 836, "common": true, "asSupplied": { "read": 165, "readBase": "C" } }, { "kind": "insertion", "refAfter": 718, "length": 1, "bases": "G", "readStart": 838, "readEnd": 838, "asSupplied": { "readStart": 163, "readEnd": 163, "bases": "C" }, "common": false, "notFixed": { "from": { "ref": 718, "read": 837, "readAsSupplied": 164 }, "to": { "ref": 720, "read": 840, "readAsSupplied": 161 } } }, { "kind": "substitution", "ref": 719, "refBase": "T", "readBase": "A", "read": 839, "common": false, "notFixed": { "from": { "ref": 718, "read": 837, "readAsSupplied": 164 }, "to": { "ref": 720, "read": 840, "readAsSupplied": 161 } }, "asSupplied": { "read": 162, "readBase": "T" } }, { "kind": "insertion", "refAfter": 720, "length": 1, "bases": "A", "readStart": 841, "readEnd": 841, "asSupplied": { "readStart": 160, "readEnd": 160, "bases": "T" }, "common": true }, { "kind": "insertion", "refAfter": 726, "length": 1, "bases": "T", "readStart": 848, "readEnd": 848, "asSupplied": { "readStart": 153, "readEnd": 153, "bases": "A" }, "common": false, "notFixed": { "from": { "ref": 726, "read": 847, "readAsSupplied": 154 }, "to": { "ref": 728, "read": 850, "readAsSupplied": 151 } } }, { "kind": "substitution", "ref": 727, "refBase": "G", "readBase": "T", "read": 849, "common": false, "notFixed": { "from": { "ref": 726, "read": 847, "readAsSupplied": 154 }, "to": { "ref": 728, "read": 850, "readAsSupplied": 151 } }, "asSupplied": { "read": 152, "readBase": "A" } }, { "kind": "substitution", "ref": 730, "refBase": "G", "readBase": "C", "read": 852, "common": true, "asSupplied": { "read": 149, "readBase": "G" } }, { "kind": "substitution", "ref": 732, "refBase": "G", "readBase": "T", "read": 854, "common": true, "asSupplied": { "read": 147, "readBase": "A" } }, { "kind": "substitution", "ref": 733, "refBase": "C", "readBase": "T", "read": 855, "common": true, "asSupplied": { "read": 146, "readBase": "A" } }, { "kind": "substitution", "ref": 736, "refBase": "A", "readBase": "C", "read": 858, "common": true, "asSupplied": { "read": 143, "readBase": "G" } }, { "kind": "deletion", "refStart": 740, "refEnd": 744, "length": 5, "bases": "ACCAA", "readAfter": 861, "asSupplied": { "readBetween": [ 139, 140 ] }, "common": false, "notFixed": { "from": { "ref": 739, "read": 861, "readAsSupplied": 140 }, "to": { "ref": 746, "read": 863, "readAsSupplied": 138 } } }, { "kind": "substitution", "ref": 745, "refBase": "A", "readBase": "T", "read": 862, "common": false, "notFixed": { "from": { "ref": 739, "read": 861, "readAsSupplied": 140 }, "to": { "ref": 746, "read": 863, "readAsSupplied": 138 } }, "asSupplied": { "read": 139, "readBase": "A" } }, { "kind": "substitution", "ref": 747, "refBase": "A", "readBase": "T", "read": 864, "common": true, "asSupplied": { "read": 137, "readBase": "A" } }, { "kind": "substitution", "ref": 750, "refBase": "G", "readBase": "T", "read": 867, "common": true, "asSupplied": { "read": 134, "readBase": "A" } }, { "kind": "substitution", "ref": 751, "refBase": "T", "readBase": "A", "read": 868, "common": true, "asSupplied": { "read": 133, "readBase": "T" } }, { "kind": "deletion", "refStart": 756, "refEnd": 756, "length": 1, "bases": "C", "readAfter": 872, "asSupplied": { "readBetween": [ 128, 129 ] }, "common": true }, { "kind": "insertion", "refAfter": 759, "length": 2, "bases": "AC", "readStart": 876, "readEnd": 877, "asSupplied": { "readStart": 124, "readEnd": 125, "bases": "GT" }, "common": true }, { "kind": "deletion", "refStart": 761, "refEnd": 761, "length": 1, "bases": "G", "readAfter": 878, "asSupplied": { "readBetween": [ 122, 123 ] }, "common": true }, { "kind": "substitution", "ref": 764, "refBase": "G", "readBase": "T", "read": 881, "common": true, "asSupplied": { "read": 120, "readBase": "A" } }, { "kind": "substitution", "ref": 766, "refBase": "C", "readBase": "A", "read": 883, "common": true, "asSupplied": { "read": 118, "readBase": "T" } }, { "kind": "insertion", "refAfter": 767, "length": 1, "bases": "C", "readStart": 885, "readEnd": 885, "asSupplied": { "readStart": 116, "readEnd": 116, "bases": "G" }, "common": false, "notFixed": { "from": { "ref": 767, "read": 884, "readAsSupplied": 117 }, "to": { "ref": 770, "read": 888, "readAsSupplied": 113 } } }, { "kind": "substitution", "ref": 768, "refBase": "T", "readBase": "A", "read": 886, "common": false, "notFixed": { "from": { "ref": 767, "read": 884, "readAsSupplied": 117 }, "to": { "ref": 770, "read": 888, "readAsSupplied": 113 } }, "asSupplied": { "read": 115, "readBase": "T" } }, { "kind": "insertion", "refAfter": 770, "length": 1, "bases": "T", "readStart": 889, "readEnd": 889, "asSupplied": { "readStart": 112, "readEnd": 112, "bases": "A" }, "common": false, "notFixed": { "from": { "ref": 770, "read": 888, "readAsSupplied": 113 }, "to": { "ref": 775, "read": 896, "readAsSupplied": 105 } } }, { "kind": "insertion", "refAfter": 772, "length": 2, "bases": "CT", "readStart": 892, "readEnd": 893, "asSupplied": { "readStart": 108, "readEnd": 109, "bases": "AG" }, "common": false, "notFixed": { "from": { "ref": 770, "read": 888, "readAsSupplied": 113 }, "to": { "ref": 775, "read": 896, "readAsSupplied": 105 } } }, { "kind": "substitution", "ref": 774, "refBase": "G", "readBase": "T", "read": 895, "common": false, "notFixed": { "from": { "ref": 770, "read": 888, "readAsSupplied": 113 }, "to": { "ref": 775, "read": 896, "readAsSupplied": 105 } }, "asSupplied": { "read": 106, "readBase": "A" } }, { "kind": "substitution", "ref": 779, "refBase": "C", "readBase": "T", "read": 900, "common": true, "asSupplied": { "read": 101, "readBase": "A" } }, { "kind": "deletion", "refStart": 781, "refEnd": 782, "length": 2, "bases": "AC", "readAfter": 901, "asSupplied": { "readBetween": [ 99, 100 ] }, "common": true }, { "kind": "deletion", "refStart": 786, "refEnd": 787, "length": 2, "bases": "AA", "readAfter": 904, "asSupplied": { "readBetween": [ 96, 97 ] }, "common": true }, { "kind": "deletion", "refStart": 791, "refEnd": 791, "length": 1, "bases": "C", "readAfter": 907, "asSupplied": { "readBetween": [ 93, 94 ] }, "common": true }, { "kind": "substitution", "ref": 793, "refBase": "C", "readBase": "A", "read": 909, "common": true, "asSupplied": { "read": 92, "readBase": "T" } }, { "kind": "substitution", "ref": 795, "refBase": "G", "readBase": "T", "read": 911, "common": true, "asSupplied": { "read": 90, "readBase": "A" } }, { "kind": "substitution", "ref": 797, "refBase": "A", "readBase": "T", "read": 913, "common": true, "asSupplied": { "read": 88, "readBase": "A" } }, { "kind": "substitution", "ref": 798, "refBase": "G", "readBase": "T", "read": 914, "common": true, "asSupplied": { "read": 87, "readBase": "A" } }, { "kind": "substitution", "ref": 803, "refBase": "G", "readBase": "A", "read": 919, "common": true, "asSupplied": { "read": 82, "readBase": "T" } }, { "kind": "insertion", "refAfter": 804, "length": 1, "bases": "A", "readStart": 921, "readEnd": 921, "asSupplied": { "readStart": 80, "readEnd": 80, "bases": "T" }, "common": false, "notFixed": { "from": { "ref": 804, "read": 920, "readAsSupplied": 81 }, "to": { "ref": 813, "read": 930, "readAsSupplied": 71 } } }, { "kind": "substitution", "ref": 807, "refBase": "G", "readBase": "T", "read": 924, "common": false, "notFixed": { "from": { "ref": 804, "read": 920, "readAsSupplied": 81 }, "to": { "ref": 813, "read": 930, "readAsSupplied": 71 } }, "asSupplied": { "read": 77, "readBase": "A" } }, { "kind": "substitution", "ref": 809, "refBase": "G", "readBase": "T", "read": 926, "common": false, "notFixed": { "from": { "ref": 804, "read": 920, "readAsSupplied": 81 }, "to": { "ref": 813, "read": 930, "readAsSupplied": 71 } }, "asSupplied": { "read": 75, "readBase": "A" } }, { "kind": "substitution", "ref": 811, "refBase": "C", "readBase": "A", "read": 928, "common": false, "notFixed": { "from": { "ref": 804, "read": 920, "readAsSupplied": 81 }, "to": { "ref": 813, "read": 930, "readAsSupplied": 71 } }, "asSupplied": { "read": 73, "readBase": "T" } }, { "kind": "substitution", "ref": 812, "refBase": "A", "readBase": "G", "read": 929, "common": false, "notFixed": { "from": { "ref": 804, "read": 920, "readAsSupplied": 81 }, "to": { "ref": 813, "read": 930, "readAsSupplied": 71 } }, "asSupplied": { "read": 72, "readBase": "C" } }, { "kind": "substitution", "ref": 816, "refBase": "T", "readBase": "G", "read": 933, "common": true, "asSupplied": { "read": 68, "readBase": "C" } }, { "kind": "deletion", "refStart": 819, "refEnd": 819, "length": 1, "bases": "C", "readAfter": 935, "asSupplied": { "readBetween": [ 65, 66 ] }, "common": false, "notFixed": { "from": { "ref": 818, "read": 935, "readAsSupplied": 66 }, "to": { "ref": 822, "read": 938, "readAsSupplied": 63 } } }, { "kind": "substitution", "ref": 821, "refBase": "C", "readBase": "T", "read": 937, "common": false, "notFixed": { "from": { "ref": 818, "read": 935, "readAsSupplied": 66 }, "to": { "ref": 822, "read": 938, "readAsSupplied": 63 } }, "asSupplied": { "read": 64, "readBase": "A" } }, { "kind": "substitution", "ref": 824, "refBase": "C", "readBase": "A", "read": 940, "common": true, "asSupplied": { "read": 61, "readBase": "T" } }, { "kind": "deletion", "refStart": 828, "refEnd": 829, "length": 2, "bases": "TC", "readAfter": 943, "asSupplied": { "readBetween": [ 57, 58 ] }, "common": false, "notFixed": { "from": { "ref": 827, "read": 943, "readAsSupplied": 58 }, "to": { "ref": 832, "read": 946, "readAsSupplied": 55 } } }, { "kind": "substitution", "ref": 830, "refBase": "C", "readBase": "A", "read": 944, "common": false, "notFixed": { "from": { "ref": 827, "read": 943, "readAsSupplied": 58 }, "to": { "ref": 832, "read": 946, "readAsSupplied": 55 } }, "asSupplied": { "read": 57, "readBase": "T" } }, { "kind": "substitution", "ref": 831, "refBase": "G", "readBase": "A", "read": 945, "common": false, "notFixed": { "from": { "ref": 827, "read": 943, "readAsSupplied": 58 }, "to": { "ref": 832, "read": 946, "readAsSupplied": 55 } }, "asSupplied": { "read": 56, "readBase": "T" } }, { "kind": "substitution", "ref": 833, "refBase": "T", "readBase": "C", "read": 947, "common": true, "asSupplied": { "read": 54, "readBase": "G" } }, { "kind": "substitution", "ref": 836, "refBase": "C", "readBase": "A", "read": 950, "common": true, "asSupplied": { "read": 51, "readBase": "T" } }, { "kind": "substitution", "ref": 838, "refBase": "A", "readBase": "T", "read": 952, "common": true, "asSupplied": { "read": 49, "readBase": "A" } }, { "kind": "substitution", "ref": 841, "refBase": "G", "readBase": "T", "read": 955, "common": false, "notFixed": { "from": { "ref": 840, "read": 954, "readAsSupplied": 47 }, "to": { "ref": 851, "read": 964, "readAsSupplied": 37 } }, "asSupplied": { "read": 46, "readBase": "A" } }, { "kind": "substitution", "ref": 844, "refBase": "T", "readBase": "A", "read": 958, "common": false, "notFixed": { "from": { "ref": 840, "read": 954, "readAsSupplied": 47 }, "to": { "ref": 851, "read": 964, "readAsSupplied": 37 } }, "asSupplied": { "read": 43, "readBase": "T" } }, { "kind": "substitution", "ref": 845, "refBase": "G", "readBase": "T", "read": 959, "common": false, "notFixed": { "from": { "ref": 840, "read": 954, "readAsSupplied": 47 }, "to": { "ref": 851, "read": 964, "readAsSupplied": 37 } }, "asSupplied": { "read": 42, "readBase": "A" } }, { "kind": "deletion", "refStart": 847, "refEnd": 847, "length": 1, "bases": "T", "readAfter": 960, "asSupplied": { "readBetween": [ 40, 41 ] }, "common": false, "notFixed": { "from": { "ref": 840, "read": 954, "readAsSupplied": 47 }, "to": { "ref": 851, "read": 964, "readAsSupplied": 37 } } }, { "kind": "substitution", "ref": 848, "refBase": "G", "readBase": "A", "read": 961, "common": false, "notFixed": { "from": { "ref": 840, "read": 954, "readAsSupplied": 47 }, "to": { "ref": 851, "read": 964, "readAsSupplied": 37 } }, "asSupplied": { "read": 40, "readBase": "T" } }, { "kind": "substitution", "ref": 849, "refBase": "C", "readBase": "A", "read": 962, "common": false, "notFixed": { "from": { "ref": 840, "read": 954, "readAsSupplied": 47 }, "to": { "ref": 851, "read": 964, "readAsSupplied": 37 } }, "asSupplied": { "read": 39, "readBase": "T" } }, { "kind": "substitution", "ref": 853, "refBase": "T", "readBase": "C", "read": 966, "common": true, "asSupplied": { "read": 35, "readBase": "G" } }, { "kind": "substitution", "ref": 854, "refBase": "G", "readBase": "A", "read": 967, "common": true, "asSupplied": { "read": 34, "readBase": "T" } }, { "kind": "substitution", "ref": 855, "refBase": "G", "readBase": "T", "read": 968, "common": true, "asSupplied": { "read": 33, "readBase": "A" } }, { "kind": "substitution", "ref": 857, "refBase": "G", "readBase": "C", "read": 970, "common": true, "asSupplied": { "read": 31, "readBase": "G" } }, { "kind": "substitution", "ref": 862, "refBase": "G", "readBase": "T", "read": 975, "common": true, "asSupplied": { "read": 26, "readBase": "A" } }, { "kind": "substitution", "ref": 863, "refBase": "G", "readBase": "C", "read": 976, "common": true, "asSupplied": { "read": 25, "readBase": "G" } }, { "kind": "substitution", "ref": 864, "refBase": "C", "readBase": "T", "read": 977, "common": true, "asSupplied": { "read": 24, "readBase": "A" } }, { "kind": "substitution", "ref": 868, "refBase": "C", "readBase": "A", "read": 981, "common": true, "asSupplied": { "read": 20, "readBase": "T" } }, { "kind": "substitution", "ref": 869, "refBase": "C", "readBase": "A", "read": 982, "common": true, "asSupplied": { "read": 19, "readBase": "T" } }, { "kind": "substitution", "ref": 873, "refBase": "C", "readBase": "A", "read": 986, "common": true, "asSupplied": { "read": 15, "readBase": "T" } }, { "kind": "substitution", "ref": 874, "refBase": "C", "readBase": "G", "read": 987, "common": true, "asSupplied": { "read": 14, "readBase": "C" } }, { "kind": "insertion", "refAfter": 875, "length": 1, "bases": "A", "readStart": 989, "readEnd": 989, "asSupplied": { "readStart": 12, "readEnd": 12, "bases": "T" }, "common": false, "notFixed": { "from": { "ref": 875, "read": 988, "readAsSupplied": 13 }, "to": { "ref": 878, "read": 992, "readAsSupplied": 9 } } }, { "kind": "substitution", "ref": 877, "refBase": "G", "readBase": "A", "read": 991, "common": false, "notFixed": { "from": { "ref": 875, "read": 988, "readAsSupplied": 13 }, "to": { "ref": 878, "read": 992, "readAsSupplied": 9 } }, "asSupplied": { "read": 10, "readBase": "T" } }, { "kind": "substitution", "ref": 880, "refBase": "G", "readBase": "A", "read": 994, "common": true, "asSupplied": { "read": 7, "readBase": "T" } }, { "kind": "substitution", "ref": 881, "refBase": "G", "readBase": "T", "read": 995, "common": true, "asSupplied": { "read": 6, "readBase": "A" } }, { "kind": "substitution", "ref": 882, "refBase": "A", "readBase": "T", "read": 996, "common": true, "asSupplied": { "read": 5, "readBase": "A" } }, { "kind": "substitution", "ref": 885, "refBase": "C", "readBase": "G", "read": 999, "common": true, "asSupplied": { "read": 2, "readBase": "C" } }, { "kind": "substitution", "ref": 886, "refBase": "A", "readBase": "T", "read": 1000, "common": true, "asSupplied": { "read": 1, "readBase": "A" } } ] }, "band": { "diagonalMin": 6524, "diagonalMax": 6634, "cellsNeeded": 113113, "unionBandLimited": true, "scope": "every optimal path", "gridCells": 8864856, "searchedBanded": true, "sharedWords": 5, "sharedWordsOverCap": false, "seedGuarantee": { "differencesUpTo": 1210, "guaranteed": false } }, "enumeration": "not-enumerated", "placements": [ { "refStart": 6607, "refEnd": 886, "crossesOrigin": true, "wholeCircle": false, "readStart": 1, "readEnd": 1000, "asSupplied": { "readStart": 1, "readEnd": 1000 } } ] } } ] } }, { "id": "ties-wrap-unlisted", "note": "F3: a tie-dense circle (2,048 co-optimal alignments, over the listing cap) in which only alignments past the first 1,000 can wrap: half the set ends by pairing the reference's first base again after deleting its last, a paired span of n + 1; the state is decided from the whole set, not the listed part.", "input": { "reference": { "residues": "CAGATCCGTCTTGTCGAAAACGATGGCGTCGGATTGAAAACTACCTCCGCCGTAGGAAAACGGCTATACACAAGCGAAAACCCGCACTATGGGCTGAAAACTG", "topology": "circular", "source": "literal, 103 bases" }, "read": { "residues": "CAGATCCGTCTTGTCGAAACGATGGCGTCGGATTGAAACTACCTCCGCCGTAGGAAACGGCTATACACAAGCGAAACCCGCACTATGGGCTGAAACTC", "source": "the reference less its last base, one A deleted in each run of four, then the reference's first base" }, "modes": [ "semiglobal-read", "local" ] }, "expected": { "results": [ { "mode": "semiglobal-read", "region": null, "strand": "+", "strandUndetermined": false, "plus": { "score": 166, "count": 2048, "overCap": true, "state": "wraps-past-one-turn", "biopython": { "score": 166, "count": 4096, "tailScore": 166, "tailCountSubtracted": 2048, "certifiedText": { "extension": 98, "textLength": 298, "reruns": 0, "differencesUpTo": 15 } }, "enumeration": "checked" }, "minus": { "score": -49, "count": 896, "overCap": false, "state": "aligned", "biopython": { "score": -49, "count": 1792, "tailScore": -49, "tailCountSubtracted": 896, "certifiedText": { "extension": 122, "textLength": 322, "reruns": 1, "differencesUpTo": 122 } }, "uniquePairs": [ [ 49, 9 ], [ 53, 14 ], [ 54, 15 ], [ 55, 16 ], [ 56, 18 ], [ 61, 19 ], [ 62, 20 ], [ 63, 21 ], [ 64, 22 ], [ 65, 23 ], [ 69, 26 ], [ 70, 27 ], [ 71, 28 ], [ 72, 29 ], [ 73, 30 ], [ 74, 31 ], [ 75, 32 ], [ 76, 33 ], [ 77, 34 ], [ 78, 35 ], [ 79, 36 ], [ 80, 37 ], [ 81, 38 ], [ 82, 39 ], [ 83, 40 ], [ 84, 41 ], [ 85, 45 ], [ 87, 46 ], [ 88, 47 ], [ 89, 48 ], [ 94, 52 ], [ 95, 53 ], [ 96, 54 ], [ 97, 55 ], [ 99, 59 ], [ 100, 60 ], [ 101, 61 ], [ 102, 62 ], [ 103, 63 ], [ 1, 64 ], [ 2, 65 ], [ 4, 66 ], [ 5, 67 ], [ 6, 68 ], [ 7, 69 ], [ 8, 70 ], [ 9, 77 ], [ 10, 78 ], [ 11, 79 ], [ 12, 80 ], [ 13, 81 ], [ 14, 82 ], [ 15, 83 ], [ 16, 84 ], [ 17, 85 ], [ 18, 86 ], [ 19, 87 ], [ 20, 88 ], [ 22, 89 ], [ 23, 90 ], [ 24, 91 ], [ 25, 92 ], [ 26, 93 ], [ 29, 95 ], [ 30, 96 ], [ 31, 97 ], [ 32, 98 ] ], "uniquePlacement": true, "placementNotDetermined": false, "noCommonColumn": false, "hull": { "refStart": 39, "refEnd": 32, "crossesOrigin": true, "wholeCircle": false }, "selected": { "coordinates": [ [ 0, 41, 43, 43, 49, 49, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 89, 90, 97, 97, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 2, 3, 9, 10, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 48, 48, 55, 57, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], "gappedReference": "TA-CCTCCG-CCGTAG-GAAAACGGCTATACACAAGCGAAAACCCG---CACTATGGGCTGA--AAACTGCAGATCCG------TCTTGTCGAAAACGATGGCGTCGG", "gappedRead": "GAGTTTCAGCCCATAGTG----CGGGT-TTCGCTTGTGTATAGCCGTTTC-CTA-CGGCGGAGGTAGTTTCA-ATCCGACGCCATCGTTTCGACAA-GACGG-ATCTG", "columns": 108, "identical": 58, "mismatches": 26, "ambiguousColumns": 0, "gapColumns": 24, "gapOpens": 13, "identity": { "numerator": 58, "denominator": 108 }, "readAligned": { "bases": 98, "of": 98 }, "referenceCovered": { "bases": 94, "of": 103 }, "placement": { "refStart": 42, "refEnd": 32, "readStart": 1, "readEnd": 98, "crossesOrigin": true, "asSupplied": { "readStart": 1, "readEnd": 98 } }, "overhang": [], "differences": [ { "kind": "substitution", "ref": 42, "refBase": "T", "readBase": "G", "read": 1, "common": false, "notFixed": { "from": null, "to": { "ref": 49, "read": 9, "readAsSupplied": 90 } }, "asSupplied": { "read": 98, "readBase": "C" } }, { "kind": "insertion", "refAfter": 43, "length": 1, "bases": "G", "readStart": 3, "readEnd": 3, "asSupplied": { "readStart": 96, "readEnd": 96, "bases": "C" }, "common": false, "notFixed": { "from": null, "to": { "ref": 49, "read": 9, "readAsSupplied": 90 } } }, { "kind": "substitution", "ref": 44, "refBase": "C", "readBase": "T", "read": 4, "common": false, "notFixed": { "from": null, "to": { "ref": 49, "read": 9, "readAsSupplied": 90 } }, "asSupplied": { "read": 95, "readBase": "A" } }, { "kind": "substitution", "ref": 45, "refBase": "C", "readBase": "T", "read": 5, "common": false, "notFixed": { "from": null, "to": { "ref": 49, "read": 9, "readAsSupplied": 90 } }, "asSupplied": { "read": 94, "readBase": "A" } }, { "kind": "substitution", "ref": 48, "refBase": "C", "readBase": "A", "read": 8, "common": false, "notFixed": { "from": null, "to": { "ref": 49, "read": 9, "readAsSupplied": 90 } }, "asSupplied": { "read": 91, "readBase": "T" } }, { "kind": "insertion", "refAfter": 49, "length": 1, "bases": "C", "readStart": 10, "readEnd": 10, "asSupplied": { "readStart": 89, "readEnd": 89, "bases": "G" }, "common": false, "notFixed": { "from": { "ref": 49, "read": 9, "readAsSupplied": 90 }, "to": { "ref": 53, "read": 14, "readAsSupplied": 85 } } }, { "kind": "substitution", "ref": 52, "refBase": "G", "readBase": "A", "read": 13, "common": false, "notFixed": { "from": { "ref": 49, "read": 9, "readAsSupplied": 90 }, "to": { "ref": 53, "read": 14, "readAsSupplied": 85 } }, "asSupplied": { "read": 86, "readBase": "T" } }, { "kind": "insertion", "refAfter": 55, "length": 1, "bases": "T", "readStart": 17, "readEnd": 17, "asSupplied": { "readStart": 82, "readEnd": 82, "bases": "A" }, "common": true }, { "kind": "deletion", "refStart": 57, "refEnd": 60, "length": 4, "bases": "AAAA", "readAfter": 18, "asSupplied": { "readBetween": [ 80, 81 ] }, "common": true }, { "kind": "substitution", "ref": 64, "refBase": "C", "readBase": "G", "read": 22, "common": true, "asSupplied": { "read": 77, "readBase": "C" } }, { "kind": "deletion", "refStart": 66, "refEnd": 66, "length": 1, "bases": "A", "readAfter": 23, "asSupplied": { "readBetween": [ 75, 76 ] }, "common": false, "notFixed": { "from": { "ref": 65, "read": 23, "readAsSupplied": 76 }, "to": { "ref": 69, "read": 26, "readAsSupplied": 73 } } }, { "kind": "substitution", "ref": 68, "refBase": "A", "readBase": "T", "read": 25, "common": false, "notFixed": { "from": { "ref": 65, "read": 23, "readAsSupplied": 76 }, "to": { "ref": 69, "read": 26, "readAsSupplied": 73 } }, "asSupplied": { "read": 74, "readBase": "A" } }, { "kind": "substitution", "ref": 70, "refBase": "A", "readBase": "G", "read": 27, "common": true, "asSupplied": { "read": 72, "readBase": "C" } }, { "kind": "substitution", "ref": 72, "refBase": "A", "readBase": "T", "read": 29, "common": true, "asSupplied": { "read": 70, "readBase": "A" } }, { "kind": "substitution", "ref": 73, "refBase": "A", "readBase": "T", "read": 30, "common": true, "asSupplied": { "read": 69, "readBase": "A" } }, { "kind": "substitution", "ref": 75, "refBase": "C", "readBase": "T", "read": 32, "common": true, "asSupplied": { "read": 67, "readBase": "A" } }, { "kind": "substitution", "ref": 77, "refBase": "A", "readBase": "T", "read": 34, "common": true, "asSupplied": { "read": 65, "readBase": "A" } }, { "kind": "substitution", "ref": 79, "refBase": "A", "readBase": "T", "read": 36, "common": true, "asSupplied": { "read": 63, "readBase": "A" } }, { "kind": "substitution", "ref": 81, "refBase": "C", "readBase": "G", "read": 38, "common": true, "asSupplied": { "read": 61, "readBase": "C" } }, { "kind": "insertion", "refAfter": 84, "length": 3, "bases": "TTT", "readStart": 42, "readEnd": 44, "asSupplied": { "readStart": 55, "readEnd": 57, "bases": "AAA" }, "common": true }, { "kind": "deletion", "refStart": 86, "refEnd": 86, "length": 1, "bases": "A", "readAfter": 45, "asSupplied": { "readBetween": [ 53, 54 ] }, "common": true }, { "kind": "deletion", "refStart": 90, "refEnd": 90, "length": 1, "bases": "T", "readAfter": 48, "asSupplied": { "readBetween": [ 50, 51 ] }, "common": false, "notFixed": { "from": { "ref": 89, "read": 48, "readAsSupplied": 51 }, "to": { "ref": 94, "read": 52, "readAsSupplied": 47 } } }, { "kind": "substitution", "ref": 91, "refBase": "G", "readBase": "C", "read": 49, "common": false, "notFixed": { "from": { "ref": 89, "read": 48, "readAsSupplied": 51 }, "to": { "ref": 94, "read": 52, "readAsSupplied": 47 } }, "asSupplied": { "read": 50, "readBase": "G" } }, { "kind": "substitution", "ref": 95, "refBase": "T", "readBase": "G", "read": 53, "common": true, "asSupplied": { "read": 46, "readBase": "C" } }, { "kind": "insertion", "refAfter": 97, "length": 2, "bases": "GG", "readStart": 56, "readEnd": 57, "asSupplied": { "readStart": 42, "readEnd": 43, "bases": "CC" }, "common": false, "notFixed": { "from": { "ref": 97, "read": 55, "readAsSupplied": 44 }, "to": { "ref": 99, "read": 59, "readAsSupplied": 40 } } }, { "kind": "substitution", "ref": 98, "refBase": "A", "readBase": "T", "read": 58, "common": false, "notFixed": { "from": { "ref": 97, "read": 55, "readAsSupplied": 44 }, "to": { "ref": 99, "read": 59, "readAsSupplied": 40 } }, "asSupplied": { "read": 41, "readBase": "A" } }, { "kind": "substitution", "ref": 100, "refBase": "A", "readBase": "G", "read": 60, "common": true, "asSupplied": { "read": 39, "readBase": "C" } }, { "kind": "substitution", "ref": 101, "refBase": "C", "readBase": "T", "read": 61, "common": true, "asSupplied": { "read": 38, "readBase": "A" } }, { "kind": "substitution", "ref": 103, "refBase": "G", "readBase": "T", "read": 63, "common": true, "asSupplied": { "read": 36, "readBase": "A" } }, { "kind": "deletion", "refStart": 3, "refEnd": 3, "length": 1, "bases": "G", "readAfter": 65, "asSupplied": { "readBetween": [ 33, 34 ] }, "common": true }, { "kind": "insertion", "refAfter": 8, "length": 6, "bases": "ACGCCA", "readStart": 71, "readEnd": 76, "asSupplied": { "readStart": 23, "readEnd": 28, "bases": "TGGCGT" }, "common": true }, { "kind": "substitution", "ref": 11, "refBase": "T", "readBase": "G", "read": 79, "common": true, "asSupplied": { "read": 20, "readBase": "C" } }, { "kind": "substitution", "ref": 13, "refBase": "G", "readBase": "T", "read": 81, "common": true, "asSupplied": { "read": 18, "readBase": "A" } }, { "kind": "substitution", "ref": 18, "refBase": "A", "readBase": "C", "read": 86, "common": true, "asSupplied": { "read": 13, "readBase": "G" } }, { "kind": "deletion", "refStart": 21, "refEnd": 21, "length": 1, "bases": "C", "readAfter": 88, "asSupplied": { "readBetween": [ 10, 11 ] }, "common": true }, { "kind": "substitution", "ref": 24, "refBase": "T", "readBase": "C", "read": 91, "common": true, "asSupplied": { "read": 8, "readBase": "G" } }, { "kind": "deletion", "refStart": 27, "refEnd": 27, "length": 1, "bases": "C", "readAfter": 93, "asSupplied": { "readBetween": [ 5, 6 ] }, "common": false, "notFixed": { "from": { "ref": 26, "read": 93, "readAsSupplied": 6 }, "to": { "ref": 29, "read": 95, "readAsSupplied": 4 } } }, { "kind": "substitution", "ref": 28, "refBase": "G", "readBase": "A", "read": 94, "common": false, "notFixed": { "from": { "ref": 26, "read": 93, "readAsSupplied": 6 }, "to": { "ref": 29, "read": 95, "readAsSupplied": 4 } }, "asSupplied": { "read": 5, "readBase": "T" } }, { "kind": "substitution", "ref": 31, "refBase": "G", "readBase": "T", "read": 97, "common": true, "asSupplied": { "read": 2, "readBase": "A" } } ] }, "band": { "diagonalMin": 35, "diagonalMax": 43, "cellsNeeded": 1089, "unionBandLimited": false, "scope": "every optimal path", "gridCells": 31977, "searchedBanded": true, "sharedWords": 0, "sharedWordsOverCap": false, "seedGuarantee": { "differencesUpTo": 122, "guaranteed": false } }, "enumeration": "listed", "alignments": [ [ [ 0, 41, 43, 43, 49, 49, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 89, 90, 97, 97, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 2, 3, 9, 10, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 48, 48, 55, 57, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 38, 42, 44, 49, 49, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 89, 90, 97, 97, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 4, 4, 9, 10, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 48, 48, 55, 57, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 44, 44, 49, 49, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 89, 90, 97, 97, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 3, 4, 9, 10, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 48, 48, 55, 57, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 38, 43, 45, 49, 49, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 89, 90, 97, 97, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 5, 5, 9, 10, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 48, 48, 55, 57, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 45, 45, 49, 49, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 89, 90, 97, 97, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 4, 5, 9, 10, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 48, 48, 55, 57, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 46, 46, 49, 49, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 89, 90, 97, 97, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 5, 6, 9, 10, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 48, 48, 55, 57, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 48, 48, 49, 49, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 89, 90, 97, 97, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 7, 8, 9, 10, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 48, 48, 55, 57, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 43, 43, 50, 50, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 89, 90, 97, 97, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 2, 3, 10, 11, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 48, 48, 55, 57, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 38, 42, 44, 50, 50, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 89, 90, 97, 97, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 4, 4, 10, 11, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 48, 48, 55, 57, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 44, 44, 50, 50, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 89, 90, 97, 97, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 3, 4, 10, 11, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 48, 48, 55, 57, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 38, 43, 45, 50, 50, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 89, 90, 97, 97, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 5, 5, 10, 11, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 48, 48, 55, 57, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 45, 45, 50, 50, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 89, 90, 97, 97, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 4, 5, 10, 11, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 48, 48, 55, 57, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 46, 46, 50, 50, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 89, 90, 97, 97, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 5, 6, 10, 11, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 48, 48, 55, 57, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 48, 48, 50, 50, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 89, 90, 97, 97, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 7, 8, 10, 11, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 48, 48, 55, 57, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 43, 43, 51, 51, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 89, 90, 97, 97, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 2, 3, 11, 12, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 48, 48, 55, 57, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 38, 42, 44, 51, 51, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 89, 90, 97, 97, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 4, 4, 11, 12, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 48, 48, 55, 57, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 44, 44, 51, 51, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 89, 90, 97, 97, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 3, 4, 11, 12, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 48, 48, 55, 57, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 38, 43, 45, 51, 51, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 89, 90, 97, 97, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 5, 5, 11, 12, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 48, 48, 55, 57, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 45, 45, 51, 51, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 89, 90, 97, 97, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 4, 5, 11, 12, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 48, 48, 55, 57, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 46, 46, 51, 51, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 89, 90, 97, 97, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 5, 6, 11, 12, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 48, 48, 55, 57, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 48, 48, 51, 51, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 89, 90, 97, 97, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 7, 8, 11, 12, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 48, 48, 55, 57, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 43, 43, 52, 52, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 89, 90, 97, 97, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 2, 3, 12, 13, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 48, 48, 55, 57, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 38, 42, 44, 52, 52, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 89, 90, 97, 97, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 4, 4, 12, 13, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 48, 48, 55, 57, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 44, 44, 52, 52, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 89, 90, 97, 97, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 3, 4, 12, 13, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 48, 48, 55, 57, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 38, 43, 45, 52, 52, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 89, 90, 97, 97, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 5, 5, 12, 13, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 48, 48, 55, 57, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 45, 45, 52, 52, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 89, 90, 97, 97, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 4, 5, 12, 13, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 48, 48, 55, 57, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 46, 46, 52, 52, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 89, 90, 97, 97, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 5, 6, 12, 13, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 48, 48, 55, 57, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 48, 48, 52, 52, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 89, 90, 97, 97, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 7, 8, 12, 13, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 48, 48, 55, 57, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 43, 43, 49, 49, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 89, 90, 97, 97, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 2, 3, 9, 10, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 48, 48, 55, 57, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 38, 42, 44, 49, 49, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 89, 90, 97, 97, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 4, 4, 9, 10, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 48, 48, 55, 57, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 44, 44, 49, 49, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 89, 90, 97, 97, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 3, 4, 9, 10, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 48, 48, 55, 57, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 38, 43, 45, 49, 49, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 89, 90, 97, 97, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 5, 5, 9, 10, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 48, 48, 55, 57, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 45, 45, 49, 49, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 89, 90, 97, 97, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 4, 5, 9, 10, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 48, 48, 55, 57, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 46, 46, 49, 49, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 89, 90, 97, 97, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 5, 6, 9, 10, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 48, 48, 55, 57, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 48, 48, 49, 49, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 89, 90, 97, 97, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 7, 8, 9, 10, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 48, 48, 55, 57, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 43, 43, 50, 50, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 89, 90, 97, 97, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 2, 3, 10, 11, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 48, 48, 55, 57, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 38, 42, 44, 50, 50, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 89, 90, 97, 97, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 4, 4, 10, 11, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 48, 48, 55, 57, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 44, 44, 50, 50, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 89, 90, 97, 97, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 3, 4, 10, 11, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 48, 48, 55, 57, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 38, 43, 45, 50, 50, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 89, 90, 97, 97, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 5, 5, 10, 11, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 48, 48, 55, 57, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 45, 45, 50, 50, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 89, 90, 97, 97, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 4, 5, 10, 11, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 48, 48, 55, 57, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 46, 46, 50, 50, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 89, 90, 97, 97, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 5, 6, 10, 11, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 48, 48, 55, 57, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 48, 48, 50, 50, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 89, 90, 97, 97, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 7, 8, 10, 11, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 48, 48, 55, 57, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 43, 43, 51, 51, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 89, 90, 97, 97, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 2, 3, 11, 12, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 48, 48, 55, 57, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 38, 42, 44, 51, 51, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 89, 90, 97, 97, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 4, 4, 11, 12, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 48, 48, 55, 57, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 44, 44, 51, 51, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 89, 90, 97, 97, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 3, 4, 11, 12, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 48, 48, 55, 57, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 38, 43, 45, 51, 51, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 89, 90, 97, 97, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 5, 5, 11, 12, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 48, 48, 55, 57, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 45, 45, 51, 51, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 89, 90, 97, 97, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 4, 5, 11, 12, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 48, 48, 55, 57, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 46, 46, 51, 51, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 89, 90, 97, 97, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 5, 6, 11, 12, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 48, 48, 55, 57, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 48, 48, 51, 51, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 89, 90, 97, 97, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 7, 8, 11, 12, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 48, 48, 55, 57, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 43, 43, 52, 52, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 89, 90, 97, 97, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 2, 3, 12, 13, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 48, 48, 55, 57, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 38, 42, 44, 52, 52, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 89, 90, 97, 97, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 4, 4, 12, 13, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 48, 48, 55, 57, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 44, 44, 52, 52, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 89, 90, 97, 97, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 3, 4, 12, 13, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 48, 48, 55, 57, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 38, 43, 45, 52, 52, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 89, 90, 97, 97, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 5, 5, 12, 13, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 48, 48, 55, 57, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 45, 45, 52, 52, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 89, 90, 97, 97, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 4, 5, 12, 13, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 48, 48, 55, 57, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 46, 46, 52, 52, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 89, 90, 97, 97, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 5, 6, 12, 13, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 48, 48, 55, 57, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 48, 48, 52, 52, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 89, 90, 97, 97, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 7, 8, 12, 13, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 48, 48, 55, 57, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 43, 43, 49, 49, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 90, 91, 97, 97, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 2, 3, 9, 10, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 49, 49, 55, 57, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 38, 42, 44, 49, 49, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 90, 91, 97, 97, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 4, 4, 9, 10, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 49, 49, 55, 57, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 44, 44, 49, 49, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 90, 91, 97, 97, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 3, 4, 9, 10, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 49, 49, 55, 57, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 38, 43, 45, 49, 49, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 90, 91, 97, 97, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 5, 5, 9, 10, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 49, 49, 55, 57, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 45, 45, 49, 49, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 90, 91, 97, 97, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 4, 5, 9, 10, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 49, 49, 55, 57, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 46, 46, 49, 49, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 90, 91, 97, 97, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 5, 6, 9, 10, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 49, 49, 55, 57, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 48, 48, 49, 49, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 90, 91, 97, 97, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 7, 8, 9, 10, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 49, 49, 55, 57, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 43, 43, 50, 50, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 90, 91, 97, 97, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 2, 3, 10, 11, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 49, 49, 55, 57, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 38, 42, 44, 50, 50, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 90, 91, 97, 97, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 4, 4, 10, 11, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 49, 49, 55, 57, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 44, 44, 50, 50, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 90, 91, 97, 97, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 3, 4, 10, 11, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 49, 49, 55, 57, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 38, 43, 45, 50, 50, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 90, 91, 97, 97, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 5, 5, 10, 11, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 49, 49, 55, 57, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 45, 45, 50, 50, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 90, 91, 97, 97, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 4, 5, 10, 11, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 49, 49, 55, 57, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 46, 46, 50, 50, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 90, 91, 97, 97, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 5, 6, 10, 11, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 49, 49, 55, 57, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 48, 48, 50, 50, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 90, 91, 97, 97, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 7, 8, 10, 11, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 49, 49, 55, 57, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 43, 43, 51, 51, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 90, 91, 97, 97, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 2, 3, 11, 12, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 49, 49, 55, 57, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 38, 42, 44, 51, 51, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 90, 91, 97, 97, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 4, 4, 11, 12, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 49, 49, 55, 57, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 44, 44, 51, 51, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 90, 91, 97, 97, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 3, 4, 11, 12, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 49, 49, 55, 57, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 38, 43, 45, 51, 51, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 90, 91, 97, 97, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 5, 5, 11, 12, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 49, 49, 55, 57, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 45, 45, 51, 51, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 90, 91, 97, 97, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 4, 5, 11, 12, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 49, 49, 55, 57, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 46, 46, 51, 51, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 90, 91, 97, 97, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 5, 6, 11, 12, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 49, 49, 55, 57, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 48, 48, 51, 51, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 90, 91, 97, 97, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 7, 8, 11, 12, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 49, 49, 55, 57, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 43, 43, 52, 52, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 90, 91, 97, 97, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 2, 3, 12, 13, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 49, 49, 55, 57, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 38, 42, 44, 52, 52, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 90, 91, 97, 97, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 4, 4, 12, 13, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 49, 49, 55, 57, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 44, 44, 52, 52, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 90, 91, 97, 97, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 3, 4, 12, 13, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 49, 49, 55, 57, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 38, 43, 45, 52, 52, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 90, 91, 97, 97, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 5, 5, 12, 13, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 49, 49, 55, 57, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 45, 45, 52, 52, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 90, 91, 97, 97, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 4, 5, 12, 13, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 49, 49, 55, 57, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 46, 46, 52, 52, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 90, 91, 97, 97, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 5, 6, 12, 13, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 49, 49, 55, 57, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 48, 48, 52, 52, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 90, 91, 97, 97, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 7, 8, 12, 13, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 49, 49, 55, 57, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 43, 43, 49, 49, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 90, 91, 97, 97, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 2, 3, 9, 10, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 49, 49, 55, 57, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 38, 42, 44, 49, 49, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 90, 91, 97, 97, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 4, 4, 9, 10, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 49, 49, 55, 57, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 44, 44, 49, 49, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 90, 91, 97, 97, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 3, 4, 9, 10, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 49, 49, 55, 57, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 38, 43, 45, 49, 49, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 90, 91, 97, 97, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 5, 5, 9, 10, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 49, 49, 55, 57, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 45, 45, 49, 49, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 90, 91, 97, 97, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 4, 5, 9, 10, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 49, 49, 55, 57, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 46, 46, 49, 49, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 90, 91, 97, 97, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 5, 6, 9, 10, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 49, 49, 55, 57, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 48, 48, 49, 49, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 90, 91, 97, 97, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 7, 8, 9, 10, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 49, 49, 55, 57, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 43, 43, 50, 50, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 90, 91, 97, 97, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 2, 3, 10, 11, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 49, 49, 55, 57, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 38, 42, 44, 50, 50, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 90, 91, 97, 97, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 4, 4, 10, 11, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 49, 49, 55, 57, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 44, 44, 50, 50, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 90, 91, 97, 97, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 3, 4, 10, 11, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 49, 49, 55, 57, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 38, 43, 45, 50, 50, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 90, 91, 97, 97, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 5, 5, 10, 11, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 49, 49, 55, 57, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 45, 45, 50, 50, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 90, 91, 97, 97, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 4, 5, 10, 11, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 49, 49, 55, 57, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 46, 46, 50, 50, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 90, 91, 97, 97, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 5, 6, 10, 11, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 49, 49, 55, 57, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 48, 48, 50, 50, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 90, 91, 97, 97, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 7, 8, 10, 11, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 49, 49, 55, 57, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 43, 43, 51, 51, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 90, 91, 97, 97, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 2, 3, 11, 12, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 49, 49, 55, 57, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 38, 42, 44, 51, 51, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 90, 91, 97, 97, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 4, 4, 11, 12, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 49, 49, 55, 57, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 44, 44, 51, 51, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 90, 91, 97, 97, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 3, 4, 11, 12, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 49, 49, 55, 57, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 38, 43, 45, 51, 51, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 90, 91, 97, 97, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 5, 5, 11, 12, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 49, 49, 55, 57, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 45, 45, 51, 51, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 90, 91, 97, 97, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 4, 5, 11, 12, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 49, 49, 55, 57, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 46, 46, 51, 51, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 90, 91, 97, 97, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 5, 6, 11, 12, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 49, 49, 55, 57, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 48, 48, 51, 51, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 90, 91, 97, 97, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 7, 8, 11, 12, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 49, 49, 55, 57, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 43, 43, 52, 52, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 90, 91, 97, 97, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 2, 3, 12, 13, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 49, 49, 55, 57, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 38, 42, 44, 52, 52, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 90, 91, 97, 97, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 4, 4, 12, 13, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 49, 49, 55, 57, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 44, 44, 52, 52, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 90, 91, 97, 97, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 3, 4, 12, 13, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 49, 49, 55, 57, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 38, 43, 45, 52, 52, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 90, 91, 97, 97, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 5, 5, 12, 13, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 49, 49, 55, 57, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 45, 45, 52, 52, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 90, 91, 97, 97, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 4, 5, 12, 13, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 49, 49, 55, 57, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 46, 46, 52, 52, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 90, 91, 97, 97, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 5, 6, 12, 13, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 49, 49, 55, 57, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 48, 48, 52, 52, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 90, 91, 97, 97, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 7, 8, 12, 13, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 49, 49, 55, 57, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 43, 43, 49, 49, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 91, 92, 97, 97, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 2, 3, 9, 10, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 50, 50, 55, 57, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 38, 42, 44, 49, 49, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 91, 92, 97, 97, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 4, 4, 9, 10, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 50, 50, 55, 57, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 44, 44, 49, 49, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 91, 92, 97, 97, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 3, 4, 9, 10, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 50, 50, 55, 57, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 38, 43, 45, 49, 49, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 91, 92, 97, 97, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 5, 5, 9, 10, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 50, 50, 55, 57, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 45, 45, 49, 49, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 91, 92, 97, 97, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 4, 5, 9, 10, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 50, 50, 55, 57, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 46, 46, 49, 49, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 91, 92, 97, 97, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 5, 6, 9, 10, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 50, 50, 55, 57, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 48, 48, 49, 49, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 91, 92, 97, 97, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 7, 8, 9, 10, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 50, 50, 55, 57, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 43, 43, 50, 50, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 91, 92, 97, 97, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 2, 3, 10, 11, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 50, 50, 55, 57, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 38, 42, 44, 50, 50, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 91, 92, 97, 97, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 4, 4, 10, 11, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 50, 50, 55, 57, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 44, 44, 50, 50, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 91, 92, 97, 97, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 3, 4, 10, 11, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 50, 50, 55, 57, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 38, 43, 45, 50, 50, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 91, 92, 97, 97, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 5, 5, 10, 11, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 50, 50, 55, 57, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 45, 45, 50, 50, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 91, 92, 97, 97, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 4, 5, 10, 11, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 50, 50, 55, 57, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 46, 46, 50, 50, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 91, 92, 97, 97, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 5, 6, 10, 11, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 50, 50, 55, 57, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 48, 48, 50, 50, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 91, 92, 97, 97, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 7, 8, 10, 11, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 50, 50, 55, 57, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 43, 43, 51, 51, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 91, 92, 97, 97, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 2, 3, 11, 12, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 50, 50, 55, 57, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 38, 42, 44, 51, 51, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 91, 92, 97, 97, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 4, 4, 11, 12, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 50, 50, 55, 57, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 44, 44, 51, 51, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 91, 92, 97, 97, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 3, 4, 11, 12, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 50, 50, 55, 57, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 38, 43, 45, 51, 51, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 91, 92, 97, 97, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 5, 5, 11, 12, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 50, 50, 55, 57, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 45, 45, 51, 51, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 91, 92, 97, 97, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 4, 5, 11, 12, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 50, 50, 55, 57, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 46, 46, 51, 51, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 91, 92, 97, 97, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 5, 6, 11, 12, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 50, 50, 55, 57, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 48, 48, 51, 51, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 91, 92, 97, 97, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 7, 8, 11, 12, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 50, 50, 55, 57, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 43, 43, 52, 52, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 91, 92, 97, 97, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 2, 3, 12, 13, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 50, 50, 55, 57, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 38, 42, 44, 52, 52, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 91, 92, 97, 97, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 4, 4, 12, 13, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 50, 50, 55, 57, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 44, 44, 52, 52, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 91, 92, 97, 97, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 3, 4, 12, 13, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 50, 50, 55, 57, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 38, 43, 45, 52, 52, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 91, 92, 97, 97, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 5, 5, 12, 13, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 50, 50, 55, 57, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 45, 45, 52, 52, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 91, 92, 97, 97, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 4, 5, 12, 13, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 50, 50, 55, 57, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 46, 46, 52, 52, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 91, 92, 97, 97, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 5, 6, 12, 13, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 50, 50, 55, 57, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 48, 48, 52, 52, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 91, 92, 97, 97, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 7, 8, 12, 13, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 50, 50, 55, 57, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 43, 43, 49, 49, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 91, 92, 97, 97, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 2, 3, 9, 10, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 50, 50, 55, 57, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 38, 42, 44, 49, 49, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 91, 92, 97, 97, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 4, 4, 9, 10, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 50, 50, 55, 57, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 44, 44, 49, 49, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 91, 92, 97, 97, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 3, 4, 9, 10, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 50, 50, 55, 57, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 38, 43, 45, 49, 49, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 91, 92, 97, 97, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 5, 5, 9, 10, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 50, 50, 55, 57, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 45, 45, 49, 49, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 91, 92, 97, 97, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 4, 5, 9, 10, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 50, 50, 55, 57, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 46, 46, 49, 49, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 91, 92, 97, 97, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 5, 6, 9, 10, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 50, 50, 55, 57, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 48, 48, 49, 49, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 91, 92, 97, 97, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 7, 8, 9, 10, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 50, 50, 55, 57, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 43, 43, 50, 50, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 91, 92, 97, 97, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 2, 3, 10, 11, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 50, 50, 55, 57, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 38, 42, 44, 50, 50, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 91, 92, 97, 97, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 4, 4, 10, 11, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 50, 50, 55, 57, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 44, 44, 50, 50, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 91, 92, 97, 97, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 3, 4, 10, 11, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 50, 50, 55, 57, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 38, 43, 45, 50, 50, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 91, 92, 97, 97, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 5, 5, 10, 11, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 50, 50, 55, 57, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 45, 45, 50, 50, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 91, 92, 97, 97, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 4, 5, 10, 11, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 50, 50, 55, 57, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 46, 46, 50, 50, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 91, 92, 97, 97, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 5, 6, 10, 11, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 50, 50, 55, 57, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 48, 48, 50, 50, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 91, 92, 97, 97, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 7, 8, 10, 11, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 50, 50, 55, 57, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 43, 43, 51, 51, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 91, 92, 97, 97, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 2, 3, 11, 12, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 50, 50, 55, 57, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 38, 42, 44, 51, 51, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 91, 92, 97, 97, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 4, 4, 11, 12, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 50, 50, 55, 57, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 44, 44, 51, 51, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 91, 92, 97, 97, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 3, 4, 11, 12, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 50, 50, 55, 57, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 38, 43, 45, 51, 51, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 91, 92, 97, 97, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 5, 5, 11, 12, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 50, 50, 55, 57, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 45, 45, 51, 51, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 91, 92, 97, 97, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 4, 5, 11, 12, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 50, 50, 55, 57, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 46, 46, 51, 51, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 91, 92, 97, 97, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 5, 6, 11, 12, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 50, 50, 55, 57, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 48, 48, 51, 51, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 91, 92, 97, 97, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 7, 8, 11, 12, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 50, 50, 55, 57, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 43, 43, 52, 52, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 91, 92, 97, 97, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 2, 3, 12, 13, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 50, 50, 55, 57, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 38, 42, 44, 52, 52, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 91, 92, 97, 97, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 4, 4, 12, 13, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 50, 50, 55, 57, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 44, 44, 52, 52, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 91, 92, 97, 97, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 3, 4, 12, 13, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 50, 50, 55, 57, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 38, 43, 45, 52, 52, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 91, 92, 97, 97, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 5, 5, 12, 13, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 50, 50, 55, 57, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 45, 45, 52, 52, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 91, 92, 97, 97, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 4, 5, 12, 13, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 50, 50, 55, 57, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 46, 46, 52, 52, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 91, 92, 97, 97, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 5, 6, 12, 13, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 50, 50, 55, 57, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 48, 48, 52, 52, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 91, 92, 97, 97, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 7, 8, 12, 13, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 50, 50, 55, 57, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 43, 43, 49, 49, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 92, 93, 97, 97, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 2, 3, 9, 10, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 51, 51, 55, 57, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 38, 42, 44, 49, 49, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 92, 93, 97, 97, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 4, 4, 9, 10, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 51, 51, 55, 57, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 44, 44, 49, 49, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 92, 93, 97, 97, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 3, 4, 9, 10, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 51, 51, 55, 57, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 38, 43, 45, 49, 49, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 92, 93, 97, 97, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 5, 5, 9, 10, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 51, 51, 55, 57, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 45, 45, 49, 49, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 92, 93, 97, 97, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 4, 5, 9, 10, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 51, 51, 55, 57, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 46, 46, 49, 49, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 92, 93, 97, 97, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 5, 6, 9, 10, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 51, 51, 55, 57, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 48, 48, 49, 49, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 92, 93, 97, 97, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 7, 8, 9, 10, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 51, 51, 55, 57, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 43, 43, 50, 50, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 92, 93, 97, 97, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 2, 3, 10, 11, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 51, 51, 55, 57, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 38, 42, 44, 50, 50, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 92, 93, 97, 97, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 4, 4, 10, 11, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 51, 51, 55, 57, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 44, 44, 50, 50, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 92, 93, 97, 97, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 3, 4, 10, 11, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 51, 51, 55, 57, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 38, 43, 45, 50, 50, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 92, 93, 97, 97, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 5, 5, 10, 11, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 51, 51, 55, 57, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 45, 45, 50, 50, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 92, 93, 97, 97, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 4, 5, 10, 11, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 51, 51, 55, 57, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 46, 46, 50, 50, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 92, 93, 97, 97, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 5, 6, 10, 11, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 51, 51, 55, 57, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 48, 48, 50, 50, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 92, 93, 97, 97, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 7, 8, 10, 11, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 51, 51, 55, 57, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 43, 43, 51, 51, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 92, 93, 97, 97, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 2, 3, 11, 12, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 51, 51, 55, 57, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 38, 42, 44, 51, 51, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 92, 93, 97, 97, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 4, 4, 11, 12, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 51, 51, 55, 57, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 44, 44, 51, 51, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 92, 93, 97, 97, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 3, 4, 11, 12, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 51, 51, 55, 57, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 38, 43, 45, 51, 51, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 92, 93, 97, 97, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 5, 5, 11, 12, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 51, 51, 55, 57, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 45, 45, 51, 51, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 92, 93, 97, 97, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 4, 5, 11, 12, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 51, 51, 55, 57, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 46, 46, 51, 51, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 92, 93, 97, 97, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 5, 6, 11, 12, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 51, 51, 55, 57, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 48, 48, 51, 51, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 92, 93, 97, 97, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 7, 8, 11, 12, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 51, 51, 55, 57, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 43, 43, 52, 52, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 92, 93, 97, 97, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 2, 3, 12, 13, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 51, 51, 55, 57, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 38, 42, 44, 52, 52, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 92, 93, 97, 97, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 4, 4, 12, 13, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 51, 51, 55, 57, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 44, 44, 52, 52, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 92, 93, 97, 97, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 3, 4, 12, 13, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 51, 51, 55, 57, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 38, 43, 45, 52, 52, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 92, 93, 97, 97, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 5, 5, 12, 13, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 51, 51, 55, 57, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 45, 45, 52, 52, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 92, 93, 97, 97, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 4, 5, 12, 13, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 51, 51, 55, 57, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 46, 46, 52, 52, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 92, 93, 97, 97, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 5, 6, 12, 13, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 51, 51, 55, 57, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 48, 48, 52, 52, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 92, 93, 97, 97, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 7, 8, 12, 13, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 51, 51, 55, 57, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 43, 43, 49, 49, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 92, 93, 97, 97, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 2, 3, 9, 10, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 51, 51, 55, 57, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 38, 42, 44, 49, 49, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 92, 93, 97, 97, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 4, 4, 9, 10, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 51, 51, 55, 57, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 44, 44, 49, 49, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 92, 93, 97, 97, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 3, 4, 9, 10, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 51, 51, 55, 57, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 38, 43, 45, 49, 49, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 92, 93, 97, 97, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 5, 5, 9, 10, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 51, 51, 55, 57, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 45, 45, 49, 49, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 92, 93, 97, 97, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 4, 5, 9, 10, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 51, 51, 55, 57, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 46, 46, 49, 49, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 92, 93, 97, 97, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 5, 6, 9, 10, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 51, 51, 55, 57, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 48, 48, 49, 49, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 92, 93, 97, 97, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 7, 8, 9, 10, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 51, 51, 55, 57, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 43, 43, 50, 50, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 92, 93, 97, 97, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 2, 3, 10, 11, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 51, 51, 55, 57, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 38, 42, 44, 50, 50, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 92, 93, 97, 97, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 4, 4, 10, 11, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 51, 51, 55, 57, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 44, 44, 50, 50, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 92, 93, 97, 97, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 3, 4, 10, 11, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 51, 51, 55, 57, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 38, 43, 45, 50, 50, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 92, 93, 97, 97, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 5, 5, 10, 11, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 51, 51, 55, 57, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 45, 45, 50, 50, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 92, 93, 97, 97, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 4, 5, 10, 11, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 51, 51, 55, 57, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 46, 46, 50, 50, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 92, 93, 97, 97, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 5, 6, 10, 11, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 51, 51, 55, 57, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 48, 48, 50, 50, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 92, 93, 97, 97, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 7, 8, 10, 11, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 51, 51, 55, 57, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 43, 43, 51, 51, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 92, 93, 97, 97, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 2, 3, 11, 12, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 51, 51, 55, 57, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 38, 42, 44, 51, 51, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 92, 93, 97, 97, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 4, 4, 11, 12, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 51, 51, 55, 57, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 44, 44, 51, 51, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 92, 93, 97, 97, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 3, 4, 11, 12, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 51, 51, 55, 57, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 38, 43, 45, 51, 51, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 92, 93, 97, 97, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 5, 5, 11, 12, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 51, 51, 55, 57, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 45, 45, 51, 51, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 92, 93, 97, 97, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 4, 5, 11, 12, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 51, 51, 55, 57, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 46, 46, 51, 51, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 92, 93, 97, 97, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 5, 6, 11, 12, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 51, 51, 55, 57, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 48, 48, 51, 51, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 92, 93, 97, 97, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 7, 8, 11, 12, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 51, 51, 55, 57, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 43, 43, 52, 52, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 92, 93, 97, 97, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 2, 3, 12, 13, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 51, 51, 55, 57, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 38, 42, 44, 52, 52, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 92, 93, 97, 97, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 4, 4, 12, 13, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 51, 51, 55, 57, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 44, 44, 52, 52, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 92, 93, 97, 97, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 3, 4, 12, 13, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 51, 51, 55, 57, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 38, 43, 45, 52, 52, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 92, 93, 97, 97, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 5, 5, 12, 13, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 51, 51, 55, 57, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 45, 45, 52, 52, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 92, 93, 97, 97, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 4, 5, 12, 13, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 51, 51, 55, 57, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 46, 46, 52, 52, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 92, 93, 97, 97, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 5, 6, 12, 13, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 51, 51, 55, 57, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 48, 48, 52, 52, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 92, 93, 97, 97, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 7, 8, 12, 13, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 51, 51, 55, 57, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 43, 43, 49, 49, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 89, 90, 98, 98, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 2, 3, 9, 10, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 48, 48, 56, 58, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 38, 42, 44, 49, 49, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 89, 90, 98, 98, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 4, 4, 9, 10, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 48, 48, 56, 58, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 44, 44, 49, 49, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 89, 90, 98, 98, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 3, 4, 9, 10, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 48, 48, 56, 58, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 38, 43, 45, 49, 49, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 89, 90, 98, 98, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 5, 5, 9, 10, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 48, 48, 56, 58, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 45, 45, 49, 49, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 89, 90, 98, 98, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 4, 5, 9, 10, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 48, 48, 56, 58, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 46, 46, 49, 49, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 89, 90, 98, 98, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 5, 6, 9, 10, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 48, 48, 56, 58, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 48, 48, 49, 49, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 89, 90, 98, 98, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 7, 8, 9, 10, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 48, 48, 56, 58, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 43, 43, 50, 50, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 89, 90, 98, 98, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 2, 3, 10, 11, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 48, 48, 56, 58, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 38, 42, 44, 50, 50, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 89, 90, 98, 98, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 4, 4, 10, 11, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 48, 48, 56, 58, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 44, 44, 50, 50, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 89, 90, 98, 98, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 3, 4, 10, 11, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 48, 48, 56, 58, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 38, 43, 45, 50, 50, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 89, 90, 98, 98, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 5, 5, 10, 11, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 48, 48, 56, 58, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 45, 45, 50, 50, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 89, 90, 98, 98, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 4, 5, 10, 11, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 48, 48, 56, 58, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 46, 46, 50, 50, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 89, 90, 98, 98, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 5, 6, 10, 11, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 48, 48, 56, 58, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 48, 48, 50, 50, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 89, 90, 98, 98, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 7, 8, 10, 11, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 48, 48, 56, 58, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 43, 43, 51, 51, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 89, 90, 98, 98, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 2, 3, 11, 12, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 48, 48, 56, 58, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 38, 42, 44, 51, 51, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 89, 90, 98, 98, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 4, 4, 11, 12, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 48, 48, 56, 58, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 44, 44, 51, 51, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 89, 90, 98, 98, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 3, 4, 11, 12, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 48, 48, 56, 58, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 38, 43, 45, 51, 51, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 89, 90, 98, 98, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 5, 5, 11, 12, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 48, 48, 56, 58, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 45, 45, 51, 51, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 89, 90, 98, 98, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 4, 5, 11, 12, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 48, 48, 56, 58, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 46, 46, 51, 51, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 89, 90, 98, 98, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 5, 6, 11, 12, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 48, 48, 56, 58, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 48, 48, 51, 51, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 89, 90, 98, 98, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 7, 8, 11, 12, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 48, 48, 56, 58, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 43, 43, 52, 52, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 89, 90, 98, 98, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 2, 3, 12, 13, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 48, 48, 56, 58, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 38, 42, 44, 52, 52, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 89, 90, 98, 98, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 4, 4, 12, 13, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 48, 48, 56, 58, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 44, 44, 52, 52, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 89, 90, 98, 98, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 3, 4, 12, 13, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 48, 48, 56, 58, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 38, 43, 45, 52, 52, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 89, 90, 98, 98, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 5, 5, 12, 13, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 48, 48, 56, 58, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 45, 45, 52, 52, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 89, 90, 98, 98, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 4, 5, 12, 13, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 48, 48, 56, 58, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 46, 46, 52, 52, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 89, 90, 98, 98, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 5, 6, 12, 13, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 48, 48, 56, 58, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 48, 48, 52, 52, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 89, 90, 98, 98, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 7, 8, 12, 13, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 48, 48, 56, 58, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 43, 43, 49, 49, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 89, 90, 98, 98, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 2, 3, 9, 10, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 48, 48, 56, 58, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 38, 42, 44, 49, 49, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 89, 90, 98, 98, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 4, 4, 9, 10, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 48, 48, 56, 58, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 44, 44, 49, 49, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 89, 90, 98, 98, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 3, 4, 9, 10, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 48, 48, 56, 58, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 38, 43, 45, 49, 49, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 89, 90, 98, 98, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 5, 5, 9, 10, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 48, 48, 56, 58, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 45, 45, 49, 49, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 89, 90, 98, 98, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 4, 5, 9, 10, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 48, 48, 56, 58, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 46, 46, 49, 49, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 89, 90, 98, 98, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 5, 6, 9, 10, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 48, 48, 56, 58, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 48, 48, 49, 49, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 89, 90, 98, 98, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 7, 8, 9, 10, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 48, 48, 56, 58, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 43, 43, 50, 50, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 89, 90, 98, 98, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 2, 3, 10, 11, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 48, 48, 56, 58, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 38, 42, 44, 50, 50, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 89, 90, 98, 98, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 4, 4, 10, 11, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 48, 48, 56, 58, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 44, 44, 50, 50, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 89, 90, 98, 98, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 3, 4, 10, 11, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 48, 48, 56, 58, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 38, 43, 45, 50, 50, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 89, 90, 98, 98, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 5, 5, 10, 11, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 48, 48, 56, 58, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 45, 45, 50, 50, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 89, 90, 98, 98, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 4, 5, 10, 11, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 48, 48, 56, 58, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 46, 46, 50, 50, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 89, 90, 98, 98, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 5, 6, 10, 11, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 48, 48, 56, 58, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 48, 48, 50, 50, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 89, 90, 98, 98, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 7, 8, 10, 11, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 48, 48, 56, 58, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 43, 43, 51, 51, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 89, 90, 98, 98, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 2, 3, 11, 12, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 48, 48, 56, 58, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 38, 42, 44, 51, 51, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 89, 90, 98, 98, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 4, 4, 11, 12, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 48, 48, 56, 58, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 44, 44, 51, 51, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 89, 90, 98, 98, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 3, 4, 11, 12, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 48, 48, 56, 58, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 38, 43, 45, 51, 51, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 89, 90, 98, 98, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 5, 5, 11, 12, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 48, 48, 56, 58, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 45, 45, 51, 51, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 89, 90, 98, 98, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 4, 5, 11, 12, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 48, 48, 56, 58, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 46, 46, 51, 51, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 89, 90, 98, 98, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 5, 6, 11, 12, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 48, 48, 56, 58, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 48, 48, 51, 51, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 89, 90, 98, 98, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 7, 8, 11, 12, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 48, 48, 56, 58, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 43, 43, 52, 52, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 89, 90, 98, 98, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 2, 3, 12, 13, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 48, 48, 56, 58, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 38, 42, 44, 52, 52, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 89, 90, 98, 98, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 4, 4, 12, 13, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 48, 48, 56, 58, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 44, 44, 52, 52, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 89, 90, 98, 98, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 3, 4, 12, 13, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 48, 48, 56, 58, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 38, 43, 45, 52, 52, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 89, 90, 98, 98, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 5, 5, 12, 13, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 48, 48, 56, 58, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 45, 45, 52, 52, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 89, 90, 98, 98, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 4, 5, 12, 13, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 48, 48, 56, 58, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 46, 46, 52, 52, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 89, 90, 98, 98, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 5, 6, 12, 13, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 48, 48, 56, 58, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 48, 48, 52, 52, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 89, 90, 98, 98, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 7, 8, 12, 13, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 48, 48, 56, 58, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 43, 43, 49, 49, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 90, 91, 98, 98, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 2, 3, 9, 10, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 49, 49, 56, 58, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 38, 42, 44, 49, 49, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 90, 91, 98, 98, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 4, 4, 9, 10, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 49, 49, 56, 58, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 44, 44, 49, 49, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 90, 91, 98, 98, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 3, 4, 9, 10, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 49, 49, 56, 58, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 38, 43, 45, 49, 49, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 90, 91, 98, 98, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 5, 5, 9, 10, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 49, 49, 56, 58, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 45, 45, 49, 49, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 90, 91, 98, 98, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 4, 5, 9, 10, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 49, 49, 56, 58, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 46, 46, 49, 49, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 90, 91, 98, 98, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 5, 6, 9, 10, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 49, 49, 56, 58, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 48, 48, 49, 49, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 90, 91, 98, 98, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 7, 8, 9, 10, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 49, 49, 56, 58, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 43, 43, 50, 50, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 90, 91, 98, 98, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 2, 3, 10, 11, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 49, 49, 56, 58, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 38, 42, 44, 50, 50, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 90, 91, 98, 98, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 4, 4, 10, 11, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 49, 49, 56, 58, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 44, 44, 50, 50, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 90, 91, 98, 98, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 3, 4, 10, 11, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 49, 49, 56, 58, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 38, 43, 45, 50, 50, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 90, 91, 98, 98, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 5, 5, 10, 11, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 49, 49, 56, 58, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 45, 45, 50, 50, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 90, 91, 98, 98, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 4, 5, 10, 11, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 49, 49, 56, 58, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 46, 46, 50, 50, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 90, 91, 98, 98, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 5, 6, 10, 11, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 49, 49, 56, 58, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 48, 48, 50, 50, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 90, 91, 98, 98, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 7, 8, 10, 11, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 49, 49, 56, 58, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 43, 43, 51, 51, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 90, 91, 98, 98, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 2, 3, 11, 12, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 49, 49, 56, 58, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 38, 42, 44, 51, 51, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 90, 91, 98, 98, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 4, 4, 11, 12, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 49, 49, 56, 58, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 44, 44, 51, 51, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 90, 91, 98, 98, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 3, 4, 11, 12, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 49, 49, 56, 58, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 38, 43, 45, 51, 51, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 90, 91, 98, 98, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 5, 5, 11, 12, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 49, 49, 56, 58, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 45, 45, 51, 51, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 90, 91, 98, 98, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 4, 5, 11, 12, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 49, 49, 56, 58, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 46, 46, 51, 51, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 90, 91, 98, 98, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 5, 6, 11, 12, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 49, 49, 56, 58, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 48, 48, 51, 51, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 90, 91, 98, 98, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 7, 8, 11, 12, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 49, 49, 56, 58, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 43, 43, 52, 52, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 90, 91, 98, 98, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 2, 3, 12, 13, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 49, 49, 56, 58, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 38, 42, 44, 52, 52, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 90, 91, 98, 98, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 4, 4, 12, 13, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 49, 49, 56, 58, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 44, 44, 52, 52, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 90, 91, 98, 98, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 3, 4, 12, 13, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 49, 49, 56, 58, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 38, 43, 45, 52, 52, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 90, 91, 98, 98, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 5, 5, 12, 13, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 49, 49, 56, 58, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 45, 45, 52, 52, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 90, 91, 98, 98, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 4, 5, 12, 13, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 49, 49, 56, 58, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 46, 46, 52, 52, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 90, 91, 98, 98, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 5, 6, 12, 13, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 49, 49, 56, 58, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 48, 48, 52, 52, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 90, 91, 98, 98, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 7, 8, 12, 13, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 49, 49, 56, 58, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 43, 43, 49, 49, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 90, 91, 98, 98, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 2, 3, 9, 10, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 49, 49, 56, 58, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 38, 42, 44, 49, 49, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 90, 91, 98, 98, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 4, 4, 9, 10, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 49, 49, 56, 58, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 44, 44, 49, 49, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 90, 91, 98, 98, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 3, 4, 9, 10, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 49, 49, 56, 58, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 38, 43, 45, 49, 49, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 90, 91, 98, 98, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 5, 5, 9, 10, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 49, 49, 56, 58, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 45, 45, 49, 49, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 90, 91, 98, 98, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 4, 5, 9, 10, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 49, 49, 56, 58, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 46, 46, 49, 49, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 90, 91, 98, 98, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 5, 6, 9, 10, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 49, 49, 56, 58, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 48, 48, 49, 49, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 90, 91, 98, 98, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 7, 8, 9, 10, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 49, 49, 56, 58, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 43, 43, 50, 50, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 90, 91, 98, 98, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 2, 3, 10, 11, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 49, 49, 56, 58, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 38, 42, 44, 50, 50, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 90, 91, 98, 98, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 4, 4, 10, 11, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 49, 49, 56, 58, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 44, 44, 50, 50, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 90, 91, 98, 98, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 3, 4, 10, 11, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 49, 49, 56, 58, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 38, 43, 45, 50, 50, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 90, 91, 98, 98, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 5, 5, 10, 11, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 49, 49, 56, 58, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 45, 45, 50, 50, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 90, 91, 98, 98, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 4, 5, 10, 11, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 49, 49, 56, 58, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 46, 46, 50, 50, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 90, 91, 98, 98, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 5, 6, 10, 11, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 49, 49, 56, 58, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 48, 48, 50, 50, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 90, 91, 98, 98, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 7, 8, 10, 11, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 49, 49, 56, 58, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 43, 43, 51, 51, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 90, 91, 98, 98, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 2, 3, 11, 12, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 49, 49, 56, 58, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 38, 42, 44, 51, 51, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 90, 91, 98, 98, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 4, 4, 11, 12, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 49, 49, 56, 58, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 44, 44, 51, 51, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 90, 91, 98, 98, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 3, 4, 11, 12, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 49, 49, 56, 58, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 38, 43, 45, 51, 51, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 90, 91, 98, 98, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 5, 5, 11, 12, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 49, 49, 56, 58, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 45, 45, 51, 51, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 90, 91, 98, 98, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 4, 5, 11, 12, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 49, 49, 56, 58, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 46, 46, 51, 51, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 90, 91, 98, 98, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 5, 6, 11, 12, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 49, 49, 56, 58, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 48, 48, 51, 51, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 90, 91, 98, 98, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 7, 8, 11, 12, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 49, 49, 56, 58, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 43, 43, 52, 52, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 90, 91, 98, 98, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 2, 3, 12, 13, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 49, 49, 56, 58, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 38, 42, 44, 52, 52, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 90, 91, 98, 98, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 4, 4, 12, 13, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 49, 49, 56, 58, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 44, 44, 52, 52, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 90, 91, 98, 98, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 3, 4, 12, 13, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 49, 49, 56, 58, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 38, 43, 45, 52, 52, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 90, 91, 98, 98, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 5, 5, 12, 13, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 49, 49, 56, 58, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 45, 45, 52, 52, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 90, 91, 98, 98, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 4, 5, 12, 13, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 49, 49, 56, 58, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 46, 46, 52, 52, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 90, 91, 98, 98, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 5, 6, 12, 13, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 49, 49, 56, 58, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 48, 48, 52, 52, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 90, 91, 98, 98, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 7, 8, 12, 13, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 49, 49, 56, 58, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 43, 43, 49, 49, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 91, 92, 98, 98, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 2, 3, 9, 10, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 50, 50, 56, 58, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 38, 42, 44, 49, 49, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 91, 92, 98, 98, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 4, 4, 9, 10, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 50, 50, 56, 58, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 44, 44, 49, 49, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 91, 92, 98, 98, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 3, 4, 9, 10, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 50, 50, 56, 58, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 38, 43, 45, 49, 49, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 91, 92, 98, 98, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 5, 5, 9, 10, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 50, 50, 56, 58, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 45, 45, 49, 49, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 91, 92, 98, 98, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 4, 5, 9, 10, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 50, 50, 56, 58, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 46, 46, 49, 49, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 91, 92, 98, 98, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 5, 6, 9, 10, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 50, 50, 56, 58, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 48, 48, 49, 49, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 91, 92, 98, 98, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 7, 8, 9, 10, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 50, 50, 56, 58, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 43, 43, 50, 50, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 91, 92, 98, 98, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 2, 3, 10, 11, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 50, 50, 56, 58, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 38, 42, 44, 50, 50, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 91, 92, 98, 98, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 4, 4, 10, 11, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 50, 50, 56, 58, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 44, 44, 50, 50, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 91, 92, 98, 98, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 3, 4, 10, 11, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 50, 50, 56, 58, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 38, 43, 45, 50, 50, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 91, 92, 98, 98, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 5, 5, 10, 11, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 50, 50, 56, 58, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 45, 45, 50, 50, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 91, 92, 98, 98, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 4, 5, 10, 11, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 50, 50, 56, 58, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 46, 46, 50, 50, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 91, 92, 98, 98, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 5, 6, 10, 11, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 50, 50, 56, 58, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 48, 48, 50, 50, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 91, 92, 98, 98, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 7, 8, 10, 11, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 50, 50, 56, 58, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 43, 43, 51, 51, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 91, 92, 98, 98, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 2, 3, 11, 12, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 50, 50, 56, 58, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 38, 42, 44, 51, 51, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 91, 92, 98, 98, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 4, 4, 11, 12, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 50, 50, 56, 58, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 44, 44, 51, 51, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 91, 92, 98, 98, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 3, 4, 11, 12, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 50, 50, 56, 58, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 38, 43, 45, 51, 51, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 91, 92, 98, 98, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 5, 5, 11, 12, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 50, 50, 56, 58, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 45, 45, 51, 51, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 91, 92, 98, 98, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 4, 5, 11, 12, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 50, 50, 56, 58, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 46, 46, 51, 51, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 91, 92, 98, 98, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 5, 6, 11, 12, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 50, 50, 56, 58, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 48, 48, 51, 51, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 91, 92, 98, 98, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 7, 8, 11, 12, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 50, 50, 56, 58, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 43, 43, 52, 52, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 91, 92, 98, 98, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 2, 3, 12, 13, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 50, 50, 56, 58, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 38, 42, 44, 52, 52, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 91, 92, 98, 98, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 4, 4, 12, 13, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 50, 50, 56, 58, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 44, 44, 52, 52, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 91, 92, 98, 98, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 3, 4, 12, 13, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 50, 50, 56, 58, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 38, 43, 45, 52, 52, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 91, 92, 98, 98, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 5, 5, 12, 13, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 50, 50, 56, 58, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 45, 45, 52, 52, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 91, 92, 98, 98, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 4, 5, 12, 13, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 50, 50, 56, 58, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 46, 46, 52, 52, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 91, 92, 98, 98, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 5, 6, 12, 13, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 50, 50, 56, 58, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 48, 48, 52, 52, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 91, 92, 98, 98, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 7, 8, 12, 13, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 50, 50, 56, 58, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 43, 43, 49, 49, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 91, 92, 98, 98, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 2, 3, 9, 10, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 50, 50, 56, 58, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 38, 42, 44, 49, 49, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 91, 92, 98, 98, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 4, 4, 9, 10, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 50, 50, 56, 58, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 44, 44, 49, 49, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 91, 92, 98, 98, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 3, 4, 9, 10, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 50, 50, 56, 58, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 38, 43, 45, 49, 49, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 91, 92, 98, 98, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 5, 5, 9, 10, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 50, 50, 56, 58, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 45, 45, 49, 49, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 91, 92, 98, 98, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 4, 5, 9, 10, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 50, 50, 56, 58, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 46, 46, 49, 49, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 91, 92, 98, 98, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 5, 6, 9, 10, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 50, 50, 56, 58, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 48, 48, 49, 49, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 91, 92, 98, 98, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 7, 8, 9, 10, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 50, 50, 56, 58, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 43, 43, 50, 50, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 91, 92, 98, 98, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 2, 3, 10, 11, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 50, 50, 56, 58, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 38, 42, 44, 50, 50, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 91, 92, 98, 98, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 4, 4, 10, 11, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 50, 50, 56, 58, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 44, 44, 50, 50, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 91, 92, 98, 98, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 3, 4, 10, 11, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 50, 50, 56, 58, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 38, 43, 45, 50, 50, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 91, 92, 98, 98, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 5, 5, 10, 11, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 50, 50, 56, 58, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 45, 45, 50, 50, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 91, 92, 98, 98, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 4, 5, 10, 11, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 50, 50, 56, 58, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 46, 46, 50, 50, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 91, 92, 98, 98, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 5, 6, 10, 11, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 50, 50, 56, 58, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 48, 48, 50, 50, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 91, 92, 98, 98, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 7, 8, 10, 11, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 50, 50, 56, 58, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 43, 43, 51, 51, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 91, 92, 98, 98, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 2, 3, 11, 12, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 50, 50, 56, 58, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 38, 42, 44, 51, 51, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 91, 92, 98, 98, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 4, 4, 11, 12, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 50, 50, 56, 58, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 44, 44, 51, 51, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 91, 92, 98, 98, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 3, 4, 11, 12, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 50, 50, 56, 58, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 38, 43, 45, 51, 51, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 91, 92, 98, 98, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 5, 5, 11, 12, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 50, 50, 56, 58, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 45, 45, 51, 51, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 91, 92, 98, 98, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 4, 5, 11, 12, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 50, 50, 56, 58, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 46, 46, 51, 51, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 91, 92, 98, 98, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 5, 6, 11, 12, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 50, 50, 56, 58, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 48, 48, 51, 51, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 91, 92, 98, 98, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 7, 8, 11, 12, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 50, 50, 56, 58, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 43, 43, 52, 52, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 91, 92, 98, 98, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 2, 3, 12, 13, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 50, 50, 56, 58, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 38, 42, 44, 52, 52, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 91, 92, 98, 98, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 4, 4, 12, 13, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 50, 50, 56, 58, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 44, 44, 52, 52, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 91, 92, 98, 98, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 3, 4, 12, 13, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 50, 50, 56, 58, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 38, 43, 45, 52, 52, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 91, 92, 98, 98, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 5, 5, 12, 13, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 50, 50, 56, 58, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 45, 45, 52, 52, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 91, 92, 98, 98, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 4, 5, 12, 13, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 50, 50, 56, 58, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 46, 46, 52, 52, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 91, 92, 98, 98, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 5, 6, 12, 13, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 50, 50, 56, 58, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 48, 48, 52, 52, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 91, 92, 98, 98, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 7, 8, 12, 13, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 50, 50, 56, 58, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 43, 43, 49, 49, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 92, 93, 98, 98, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 2, 3, 9, 10, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 51, 51, 56, 58, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 38, 42, 44, 49, 49, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 92, 93, 98, 98, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 4, 4, 9, 10, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 51, 51, 56, 58, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 44, 44, 49, 49, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 92, 93, 98, 98, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 3, 4, 9, 10, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 51, 51, 56, 58, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 38, 43, 45, 49, 49, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 92, 93, 98, 98, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 5, 5, 9, 10, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 51, 51, 56, 58, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 45, 45, 49, 49, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 92, 93, 98, 98, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 4, 5, 9, 10, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 51, 51, 56, 58, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 46, 46, 49, 49, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 92, 93, 98, 98, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 5, 6, 9, 10, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 51, 51, 56, 58, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 48, 48, 49, 49, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 92, 93, 98, 98, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 7, 8, 9, 10, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 51, 51, 56, 58, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 43, 43, 50, 50, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 92, 93, 98, 98, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 2, 3, 10, 11, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 51, 51, 56, 58, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 38, 42, 44, 50, 50, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 92, 93, 98, 98, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 4, 4, 10, 11, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 51, 51, 56, 58, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 44, 44, 50, 50, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 92, 93, 98, 98, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 3, 4, 10, 11, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 51, 51, 56, 58, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 38, 43, 45, 50, 50, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 92, 93, 98, 98, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 5, 5, 10, 11, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 51, 51, 56, 58, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 45, 45, 50, 50, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 92, 93, 98, 98, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 4, 5, 10, 11, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 51, 51, 56, 58, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 46, 46, 50, 50, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 92, 93, 98, 98, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 5, 6, 10, 11, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 51, 51, 56, 58, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 48, 48, 50, 50, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 92, 93, 98, 98, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 7, 8, 10, 11, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 51, 51, 56, 58, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 43, 43, 51, 51, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 92, 93, 98, 98, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 2, 3, 11, 12, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 51, 51, 56, 58, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 38, 42, 44, 51, 51, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 92, 93, 98, 98, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 4, 4, 11, 12, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 51, 51, 56, 58, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 44, 44, 51, 51, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 92, 93, 98, 98, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 3, 4, 11, 12, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 51, 51, 56, 58, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 38, 43, 45, 51, 51, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 92, 93, 98, 98, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 5, 5, 11, 12, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 51, 51, 56, 58, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 45, 45, 51, 51, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 92, 93, 98, 98, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 4, 5, 11, 12, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 51, 51, 56, 58, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 46, 46, 51, 51, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 92, 93, 98, 98, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 5, 6, 11, 12, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 51, 51, 56, 58, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 48, 48, 51, 51, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 92, 93, 98, 98, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 7, 8, 11, 12, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 51, 51, 56, 58, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 43, 43, 52, 52, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 92, 93, 98, 98, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 2, 3, 12, 13, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 51, 51, 56, 58, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 38, 42, 44, 52, 52, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 92, 93, 98, 98, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 4, 4, 12, 13, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 51, 51, 56, 58, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 44, 44, 52, 52, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 92, 93, 98, 98, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 3, 4, 12, 13, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 51, 51, 56, 58, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 38, 43, 45, 52, 52, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 92, 93, 98, 98, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 5, 5, 12, 13, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 51, 51, 56, 58, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 45, 45, 52, 52, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 92, 93, 98, 98, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 4, 5, 12, 13, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 51, 51, 56, 58, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 46, 46, 52, 52, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 92, 93, 98, 98, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 5, 6, 12, 13, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 51, 51, 56, 58, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 48, 48, 52, 52, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 92, 93, 98, 98, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 7, 8, 12, 13, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 51, 51, 56, 58, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 43, 43, 49, 49, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 92, 93, 98, 98, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 2, 3, 9, 10, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 51, 51, 56, 58, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 38, 42, 44, 49, 49, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 92, 93, 98, 98, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 4, 4, 9, 10, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 51, 51, 56, 58, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 44, 44, 49, 49, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 92, 93, 98, 98, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 3, 4, 9, 10, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 51, 51, 56, 58, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 38, 43, 45, 49, 49, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 92, 93, 98, 98, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 5, 5, 9, 10, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 51, 51, 56, 58, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 45, 45, 49, 49, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 92, 93, 98, 98, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 4, 5, 9, 10, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 51, 51, 56, 58, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 46, 46, 49, 49, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 92, 93, 98, 98, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 5, 6, 9, 10, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 51, 51, 56, 58, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 48, 48, 49, 49, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 92, 93, 98, 98, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 7, 8, 9, 10, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 51, 51, 56, 58, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 43, 43, 50, 50, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 92, 93, 98, 98, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 2, 3, 10, 11, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 51, 51, 56, 58, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 38, 42, 44, 50, 50, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 92, 93, 98, 98, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 4, 4, 10, 11, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 51, 51, 56, 58, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 44, 44, 50, 50, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 92, 93, 98, 98, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 3, 4, 10, 11, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 51, 51, 56, 58, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 38, 43, 45, 50, 50, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 92, 93, 98, 98, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 5, 5, 10, 11, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 51, 51, 56, 58, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 45, 45, 50, 50, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 92, 93, 98, 98, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 4, 5, 10, 11, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 51, 51, 56, 58, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 46, 46, 50, 50, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 92, 93, 98, 98, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 5, 6, 10, 11, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 51, 51, 56, 58, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 48, 48, 50, 50, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 92, 93, 98, 98, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 7, 8, 10, 11, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 51, 51, 56, 58, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 43, 43, 51, 51, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 92, 93, 98, 98, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 2, 3, 11, 12, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 51, 51, 56, 58, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 38, 42, 44, 51, 51, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 92, 93, 98, 98, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 4, 4, 11, 12, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 51, 51, 56, 58, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 44, 44, 51, 51, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 92, 93, 98, 98, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 3, 4, 11, 12, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 51, 51, 56, 58, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 38, 43, 45, 51, 51, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 92, 93, 98, 98, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 5, 5, 11, 12, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 51, 51, 56, 58, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 45, 45, 51, 51, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 92, 93, 98, 98, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 4, 5, 11, 12, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 51, 51, 56, 58, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 46, 46, 51, 51, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 92, 93, 98, 98, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 5, 6, 11, 12, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 51, 51, 56, 58, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 48, 48, 51, 51, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 92, 93, 98, 98, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 7, 8, 11, 12, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 51, 51, 56, 58, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 43, 43, 52, 52, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 92, 93, 98, 98, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 2, 3, 12, 13, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 51, 51, 56, 58, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 38, 42, 44, 52, 52, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 92, 93, 98, 98, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 4, 4, 12, 13, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 51, 51, 56, 58, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 44, 44, 52, 52, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 92, 93, 98, 98, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 3, 4, 12, 13, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 51, 51, 56, 58, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 38, 43, 45, 52, 52, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 92, 93, 98, 98, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 5, 5, 12, 13, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 51, 51, 56, 58, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 45, 45, 52, 52, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 92, 93, 98, 98, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 4, 5, 12, 13, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 51, 51, 56, 58, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 46, 46, 52, 52, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 92, 93, 98, 98, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 5, 6, 12, 13, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 51, 51, 56, 58, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 48, 48, 52, 52, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 92, 93, 98, 98, 105, 106, 111, 111, 123, 124, 129, 130, 135 ], [ 0, 0, 7, 8, 12, 13, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 51, 51, 56, 58, 65, 65, 70, 76, 88, 88, 93, 93, 98 ] ], [ [ 0, 41, 43, 43, 49, 49, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 89, 90, 97, 97, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 2, 3, 9, 10, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 48, 48, 55, 57, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 38, 42, 44, 49, 49, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 89, 90, 97, 97, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 4, 4, 9, 10, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 48, 48, 55, 57, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 44, 44, 49, 49, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 89, 90, 97, 97, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 3, 4, 9, 10, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 48, 48, 55, 57, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 38, 43, 45, 49, 49, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 89, 90, 97, 97, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 5, 5, 9, 10, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 48, 48, 55, 57, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 45, 45, 49, 49, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 89, 90, 97, 97, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 4, 5, 9, 10, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 48, 48, 55, 57, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 46, 46, 49, 49, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 89, 90, 97, 97, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 5, 6, 9, 10, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 48, 48, 55, 57, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 48, 48, 49, 49, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 89, 90, 97, 97, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 7, 8, 9, 10, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 48, 48, 55, 57, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 43, 43, 50, 50, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 89, 90, 97, 97, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 2, 3, 10, 11, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 48, 48, 55, 57, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 38, 42, 44, 50, 50, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 89, 90, 97, 97, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 4, 4, 10, 11, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 48, 48, 55, 57, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 44, 44, 50, 50, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 89, 90, 97, 97, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 3, 4, 10, 11, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 48, 48, 55, 57, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 38, 43, 45, 50, 50, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 89, 90, 97, 97, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 5, 5, 10, 11, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 48, 48, 55, 57, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 45, 45, 50, 50, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 89, 90, 97, 97, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 4, 5, 10, 11, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 48, 48, 55, 57, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 46, 46, 50, 50, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 89, 90, 97, 97, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 5, 6, 10, 11, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 48, 48, 55, 57, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 48, 48, 50, 50, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 89, 90, 97, 97, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 7, 8, 10, 11, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 48, 48, 55, 57, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 43, 43, 51, 51, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 89, 90, 97, 97, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 2, 3, 11, 12, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 48, 48, 55, 57, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 38, 42, 44, 51, 51, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 89, 90, 97, 97, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 4, 4, 11, 12, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 48, 48, 55, 57, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 44, 44, 51, 51, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 89, 90, 97, 97, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 3, 4, 11, 12, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 48, 48, 55, 57, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 38, 43, 45, 51, 51, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 89, 90, 97, 97, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 5, 5, 11, 12, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 48, 48, 55, 57, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 45, 45, 51, 51, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 89, 90, 97, 97, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 4, 5, 11, 12, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 48, 48, 55, 57, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 46, 46, 51, 51, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 89, 90, 97, 97, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 5, 6, 11, 12, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 48, 48, 55, 57, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 48, 48, 51, 51, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 89, 90, 97, 97, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 7, 8, 11, 12, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 48, 48, 55, 57, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 43, 43, 52, 52, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 89, 90, 97, 97, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 2, 3, 12, 13, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 48, 48, 55, 57, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 38, 42, 44, 52, 52, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 89, 90, 97, 97, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 4, 4, 12, 13, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 48, 48, 55, 57, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 44, 44, 52, 52, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 89, 90, 97, 97, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 3, 4, 12, 13, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 48, 48, 55, 57, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 38, 43, 45, 52, 52, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 89, 90, 97, 97, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 5, 5, 12, 13, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 48, 48, 55, 57, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 45, 45, 52, 52, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 89, 90, 97, 97, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 4, 5, 12, 13, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 48, 48, 55, 57, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 46, 46, 52, 52, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 89, 90, 97, 97, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 5, 6, 12, 13, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 48, 48, 55, 57, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 48, 48, 52, 52, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 89, 90, 97, 97, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 7, 8, 12, 13, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 48, 48, 55, 57, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 43, 43, 49, 49, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 89, 90, 97, 97, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 2, 3, 9, 10, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 48, 48, 55, 57, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 38, 42, 44, 49, 49, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 89, 90, 97, 97, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 4, 4, 9, 10, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 48, 48, 55, 57, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 44, 44, 49, 49, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 89, 90, 97, 97, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 3, 4, 9, 10, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 48, 48, 55, 57, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 38, 43, 45, 49, 49, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 89, 90, 97, 97, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 5, 5, 9, 10, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 48, 48, 55, 57, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 45, 45, 49, 49, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 89, 90, 97, 97, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 4, 5, 9, 10, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 48, 48, 55, 57, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 46, 46, 49, 49, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 89, 90, 97, 97, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 5, 6, 9, 10, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 48, 48, 55, 57, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 48, 48, 49, 49, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 89, 90, 97, 97, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 7, 8, 9, 10, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 48, 48, 55, 57, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 43, 43, 50, 50, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 89, 90, 97, 97, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 2, 3, 10, 11, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 48, 48, 55, 57, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 38, 42, 44, 50, 50, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 89, 90, 97, 97, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 4, 4, 10, 11, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 48, 48, 55, 57, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 44, 44, 50, 50, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 89, 90, 97, 97, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 3, 4, 10, 11, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 48, 48, 55, 57, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 38, 43, 45, 50, 50, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 89, 90, 97, 97, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 5, 5, 10, 11, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 48, 48, 55, 57, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 45, 45, 50, 50, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 89, 90, 97, 97, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 4, 5, 10, 11, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 48, 48, 55, 57, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 46, 46, 50, 50, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 89, 90, 97, 97, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 5, 6, 10, 11, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 48, 48, 55, 57, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 48, 48, 50, 50, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 89, 90, 97, 97, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 7, 8, 10, 11, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 48, 48, 55, 57, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 43, 43, 51, 51, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 89, 90, 97, 97, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 2, 3, 11, 12, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 48, 48, 55, 57, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 38, 42, 44, 51, 51, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 89, 90, 97, 97, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 4, 4, 11, 12, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 48, 48, 55, 57, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 44, 44, 51, 51, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 89, 90, 97, 97, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 3, 4, 11, 12, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 48, 48, 55, 57, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 38, 43, 45, 51, 51, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 89, 90, 97, 97, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 5, 5, 11, 12, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 48, 48, 55, 57, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 45, 45, 51, 51, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 89, 90, 97, 97, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 4, 5, 11, 12, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 48, 48, 55, 57, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 46, 46, 51, 51, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 89, 90, 97, 97, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 5, 6, 11, 12, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 48, 48, 55, 57, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 48, 48, 51, 51, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 89, 90, 97, 97, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 7, 8, 11, 12, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 48, 48, 55, 57, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 43, 43, 52, 52, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 89, 90, 97, 97, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 2, 3, 12, 13, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 48, 48, 55, 57, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 38, 42, 44, 52, 52, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 89, 90, 97, 97, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 4, 4, 12, 13, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 48, 48, 55, 57, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 44, 44, 52, 52, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 89, 90, 97, 97, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 3, 4, 12, 13, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 48, 48, 55, 57, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 38, 43, 45, 52, 52, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 89, 90, 97, 97, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 5, 5, 12, 13, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 48, 48, 55, 57, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 45, 45, 52, 52, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 89, 90, 97, 97, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 4, 5, 12, 13, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 48, 48, 55, 57, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 46, 46, 52, 52, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 89, 90, 97, 97, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 5, 6, 12, 13, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 48, 48, 55, 57, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 48, 48, 52, 52, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 89, 90, 97, 97, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 7, 8, 12, 13, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 48, 48, 55, 57, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 43, 43, 49, 49, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 90, 91, 97, 97, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 2, 3, 9, 10, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 49, 49, 55, 57, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 38, 42, 44, 49, 49, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 90, 91, 97, 97, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 4, 4, 9, 10, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 49, 49, 55, 57, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 44, 44, 49, 49, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 90, 91, 97, 97, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 3, 4, 9, 10, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 49, 49, 55, 57, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 38, 43, 45, 49, 49, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 90, 91, 97, 97, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 5, 5, 9, 10, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 49, 49, 55, 57, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 45, 45, 49, 49, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 90, 91, 97, 97, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 4, 5, 9, 10, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 49, 49, 55, 57, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 46, 46, 49, 49, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 90, 91, 97, 97, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 5, 6, 9, 10, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 49, 49, 55, 57, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 48, 48, 49, 49, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 90, 91, 97, 97, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 7, 8, 9, 10, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 49, 49, 55, 57, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 43, 43, 50, 50, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 90, 91, 97, 97, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 2, 3, 10, 11, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 49, 49, 55, 57, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 38, 42, 44, 50, 50, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 90, 91, 97, 97, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 4, 4, 10, 11, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 49, 49, 55, 57, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 44, 44, 50, 50, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 90, 91, 97, 97, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 3, 4, 10, 11, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 49, 49, 55, 57, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 38, 43, 45, 50, 50, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 90, 91, 97, 97, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 5, 5, 10, 11, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 49, 49, 55, 57, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 45, 45, 50, 50, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 90, 91, 97, 97, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 4, 5, 10, 11, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 49, 49, 55, 57, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 46, 46, 50, 50, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 90, 91, 97, 97, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 5, 6, 10, 11, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 49, 49, 55, 57, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 48, 48, 50, 50, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 90, 91, 97, 97, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 7, 8, 10, 11, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 49, 49, 55, 57, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 43, 43, 51, 51, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 90, 91, 97, 97, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 2, 3, 11, 12, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 49, 49, 55, 57, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 38, 42, 44, 51, 51, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 90, 91, 97, 97, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 4, 4, 11, 12, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 49, 49, 55, 57, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 44, 44, 51, 51, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 90, 91, 97, 97, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 3, 4, 11, 12, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 49, 49, 55, 57, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 38, 43, 45, 51, 51, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 90, 91, 97, 97, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 5, 5, 11, 12, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 49, 49, 55, 57, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 45, 45, 51, 51, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 90, 91, 97, 97, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 4, 5, 11, 12, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 49, 49, 55, 57, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 46, 46, 51, 51, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 90, 91, 97, 97, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 5, 6, 11, 12, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 49, 49, 55, 57, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 48, 48, 51, 51, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 90, 91, 97, 97, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 7, 8, 11, 12, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 49, 49, 55, 57, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 43, 43, 52, 52, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 90, 91, 97, 97, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 2, 3, 12, 13, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 49, 49, 55, 57, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 38, 42, 44, 52, 52, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 90, 91, 97, 97, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 4, 4, 12, 13, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 49, 49, 55, 57, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 44, 44, 52, 52, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 90, 91, 97, 97, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 3, 4, 12, 13, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 49, 49, 55, 57, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 38, 43, 45, 52, 52, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 90, 91, 97, 97, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 5, 5, 12, 13, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 49, 49, 55, 57, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 45, 45, 52, 52, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 90, 91, 97, 97, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 4, 5, 12, 13, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 49, 49, 55, 57, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 46, 46, 52, 52, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 90, 91, 97, 97, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 5, 6, 12, 13, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 49, 49, 55, 57, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 48, 48, 52, 52, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 90, 91, 97, 97, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 7, 8, 12, 13, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 49, 49, 55, 57, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 43, 43, 49, 49, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 90, 91, 97, 97, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 2, 3, 9, 10, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 49, 49, 55, 57, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 38, 42, 44, 49, 49, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 90, 91, 97, 97, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 4, 4, 9, 10, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 49, 49, 55, 57, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 44, 44, 49, 49, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 90, 91, 97, 97, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 3, 4, 9, 10, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 49, 49, 55, 57, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 38, 43, 45, 49, 49, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 90, 91, 97, 97, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 5, 5, 9, 10, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 49, 49, 55, 57, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 45, 45, 49, 49, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 90, 91, 97, 97, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 4, 5, 9, 10, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 49, 49, 55, 57, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 46, 46, 49, 49, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 90, 91, 97, 97, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 5, 6, 9, 10, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 49, 49, 55, 57, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 48, 48, 49, 49, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 90, 91, 97, 97, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 7, 8, 9, 10, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 49, 49, 55, 57, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 43, 43, 50, 50, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 90, 91, 97, 97, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 2, 3, 10, 11, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 49, 49, 55, 57, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 38, 42, 44, 50, 50, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 90, 91, 97, 97, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 4, 4, 10, 11, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 49, 49, 55, 57, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 44, 44, 50, 50, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 90, 91, 97, 97, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 3, 4, 10, 11, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 49, 49, 55, 57, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 38, 43, 45, 50, 50, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 90, 91, 97, 97, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 5, 5, 10, 11, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 49, 49, 55, 57, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 45, 45, 50, 50, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 90, 91, 97, 97, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 4, 5, 10, 11, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 49, 49, 55, 57, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 46, 46, 50, 50, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 90, 91, 97, 97, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 5, 6, 10, 11, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 49, 49, 55, 57, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 48, 48, 50, 50, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 90, 91, 97, 97, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 7, 8, 10, 11, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 49, 49, 55, 57, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 43, 43, 51, 51, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 90, 91, 97, 97, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 2, 3, 11, 12, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 49, 49, 55, 57, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 38, 42, 44, 51, 51, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 90, 91, 97, 97, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 4, 4, 11, 12, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 49, 49, 55, 57, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 44, 44, 51, 51, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 90, 91, 97, 97, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 3, 4, 11, 12, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 49, 49, 55, 57, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 38, 43, 45, 51, 51, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 90, 91, 97, 97, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 5, 5, 11, 12, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 49, 49, 55, 57, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 45, 45, 51, 51, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 90, 91, 97, 97, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 4, 5, 11, 12, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 49, 49, 55, 57, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 46, 46, 51, 51, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 90, 91, 97, 97, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 5, 6, 11, 12, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 49, 49, 55, 57, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 48, 48, 51, 51, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 90, 91, 97, 97, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 7, 8, 11, 12, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 49, 49, 55, 57, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 43, 43, 52, 52, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 90, 91, 97, 97, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 2, 3, 12, 13, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 49, 49, 55, 57, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 38, 42, 44, 52, 52, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 90, 91, 97, 97, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 4, 4, 12, 13, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 49, 49, 55, 57, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 44, 44, 52, 52, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 90, 91, 97, 97, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 3, 4, 12, 13, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 49, 49, 55, 57, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 38, 43, 45, 52, 52, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 90, 91, 97, 97, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 5, 5, 12, 13, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 49, 49, 55, 57, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 45, 45, 52, 52, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 90, 91, 97, 97, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 4, 5, 12, 13, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 49, 49, 55, 57, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 46, 46, 52, 52, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 90, 91, 97, 97, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 5, 6, 12, 13, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 49, 49, 55, 57, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 48, 48, 52, 52, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 90, 91, 97, 97, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 7, 8, 12, 13, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 49, 49, 55, 57, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 43, 43, 49, 49, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 91, 92, 97, 97, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 2, 3, 9, 10, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 50, 50, 55, 57, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 38, 42, 44, 49, 49, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 91, 92, 97, 97, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 4, 4, 9, 10, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 50, 50, 55, 57, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 44, 44, 49, 49, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 91, 92, 97, 97, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 3, 4, 9, 10, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 50, 50, 55, 57, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 38, 43, 45, 49, 49, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 91, 92, 97, 97, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 5, 5, 9, 10, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 50, 50, 55, 57, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 45, 45, 49, 49, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 91, 92, 97, 97, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 4, 5, 9, 10, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 50, 50, 55, 57, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 46, 46, 49, 49, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 91, 92, 97, 97, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 5, 6, 9, 10, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 50, 50, 55, 57, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 48, 48, 49, 49, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 91, 92, 97, 97, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 7, 8, 9, 10, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 50, 50, 55, 57, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 43, 43, 50, 50, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 91, 92, 97, 97, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 2, 3, 10, 11, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 50, 50, 55, 57, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 38, 42, 44, 50, 50, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 91, 92, 97, 97, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 4, 4, 10, 11, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 50, 50, 55, 57, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 44, 44, 50, 50, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 91, 92, 97, 97, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 3, 4, 10, 11, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 50, 50, 55, 57, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 38, 43, 45, 50, 50, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 91, 92, 97, 97, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 5, 5, 10, 11, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 50, 50, 55, 57, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 45, 45, 50, 50, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 91, 92, 97, 97, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 4, 5, 10, 11, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 50, 50, 55, 57, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 46, 46, 50, 50, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 91, 92, 97, 97, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 5, 6, 10, 11, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 50, 50, 55, 57, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 48, 48, 50, 50, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 91, 92, 97, 97, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 7, 8, 10, 11, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 50, 50, 55, 57, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 43, 43, 51, 51, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 91, 92, 97, 97, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 2, 3, 11, 12, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 50, 50, 55, 57, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 38, 42, 44, 51, 51, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 91, 92, 97, 97, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 4, 4, 11, 12, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 50, 50, 55, 57, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 44, 44, 51, 51, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 91, 92, 97, 97, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 3, 4, 11, 12, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 50, 50, 55, 57, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 38, 43, 45, 51, 51, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 91, 92, 97, 97, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 5, 5, 11, 12, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 50, 50, 55, 57, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 45, 45, 51, 51, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 91, 92, 97, 97, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 4, 5, 11, 12, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 50, 50, 55, 57, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 46, 46, 51, 51, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 91, 92, 97, 97, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 5, 6, 11, 12, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 50, 50, 55, 57, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 48, 48, 51, 51, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 91, 92, 97, 97, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 7, 8, 11, 12, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 50, 50, 55, 57, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 43, 43, 52, 52, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 91, 92, 97, 97, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 2, 3, 12, 13, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 50, 50, 55, 57, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 38, 42, 44, 52, 52, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 91, 92, 97, 97, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 4, 4, 12, 13, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 50, 50, 55, 57, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 44, 44, 52, 52, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 91, 92, 97, 97, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 3, 4, 12, 13, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 50, 50, 55, 57, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 38, 43, 45, 52, 52, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 91, 92, 97, 97, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 5, 5, 12, 13, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 50, 50, 55, 57, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 45, 45, 52, 52, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 91, 92, 97, 97, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 4, 5, 12, 13, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 50, 50, 55, 57, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 46, 46, 52, 52, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 91, 92, 97, 97, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 5, 6, 12, 13, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 50, 50, 55, 57, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 48, 48, 52, 52, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 91, 92, 97, 97, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 7, 8, 12, 13, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 50, 50, 55, 57, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 43, 43, 49, 49, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 91, 92, 97, 97, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 2, 3, 9, 10, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 50, 50, 55, 57, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 38, 42, 44, 49, 49, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 91, 92, 97, 97, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 4, 4, 9, 10, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 50, 50, 55, 57, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 44, 44, 49, 49, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 91, 92, 97, 97, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 3, 4, 9, 10, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 50, 50, 55, 57, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 38, 43, 45, 49, 49, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 91, 92, 97, 97, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 5, 5, 9, 10, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 50, 50, 55, 57, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 45, 45, 49, 49, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 91, 92, 97, 97, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 4, 5, 9, 10, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 50, 50, 55, 57, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 46, 46, 49, 49, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 91, 92, 97, 97, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 5, 6, 9, 10, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 50, 50, 55, 57, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 48, 48, 49, 49, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 91, 92, 97, 97, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 7, 8, 9, 10, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 50, 50, 55, 57, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 43, 43, 50, 50, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 91, 92, 97, 97, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 2, 3, 10, 11, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 50, 50, 55, 57, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 38, 42, 44, 50, 50, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 91, 92, 97, 97, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 4, 4, 10, 11, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 50, 50, 55, 57, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 44, 44, 50, 50, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 91, 92, 97, 97, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 3, 4, 10, 11, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 50, 50, 55, 57, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 38, 43, 45, 50, 50, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 91, 92, 97, 97, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 5, 5, 10, 11, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 50, 50, 55, 57, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 45, 45, 50, 50, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 91, 92, 97, 97, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 4, 5, 10, 11, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 50, 50, 55, 57, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 46, 46, 50, 50, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 91, 92, 97, 97, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 5, 6, 10, 11, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 50, 50, 55, 57, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 48, 48, 50, 50, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 91, 92, 97, 97, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 7, 8, 10, 11, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 50, 50, 55, 57, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 43, 43, 51, 51, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 91, 92, 97, 97, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 2, 3, 11, 12, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 50, 50, 55, 57, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 38, 42, 44, 51, 51, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 91, 92, 97, 97, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 4, 4, 11, 12, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 50, 50, 55, 57, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 44, 44, 51, 51, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 91, 92, 97, 97, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 3, 4, 11, 12, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 50, 50, 55, 57, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 38, 43, 45, 51, 51, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 91, 92, 97, 97, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 5, 5, 11, 12, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 50, 50, 55, 57, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 45, 45, 51, 51, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 91, 92, 97, 97, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 4, 5, 11, 12, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 50, 50, 55, 57, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 46, 46, 51, 51, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 91, 92, 97, 97, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 5, 6, 11, 12, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 50, 50, 55, 57, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 48, 48, 51, 51, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 91, 92, 97, 97, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 7, 8, 11, 12, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 50, 50, 55, 57, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 43, 43, 52, 52, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 91, 92, 97, 97, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 2, 3, 12, 13, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 50, 50, 55, 57, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 38, 42, 44, 52, 52, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 91, 92, 97, 97, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 4, 4, 12, 13, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 50, 50, 55, 57, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 44, 44, 52, 52, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 91, 92, 97, 97, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 3, 4, 12, 13, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 50, 50, 55, 57, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 38, 43, 45, 52, 52, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 91, 92, 97, 97, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 5, 5, 12, 13, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 50, 50, 55, 57, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 45, 45, 52, 52, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 91, 92, 97, 97, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 4, 5, 12, 13, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 50, 50, 55, 57, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 46, 46, 52, 52, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 91, 92, 97, 97, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 5, 6, 12, 13, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 50, 50, 55, 57, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 48, 48, 52, 52, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 91, 92, 97, 97, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 7, 8, 12, 13, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 50, 50, 55, 57, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 43, 43, 49, 49, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 92, 93, 97, 97, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 2, 3, 9, 10, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 51, 51, 55, 57, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 38, 42, 44, 49, 49, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 92, 93, 97, 97, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 4, 4, 9, 10, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 51, 51, 55, 57, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 44, 44, 49, 49, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 92, 93, 97, 97, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 3, 4, 9, 10, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 51, 51, 55, 57, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 38, 43, 45, 49, 49, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 92, 93, 97, 97, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 5, 5, 9, 10, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 51, 51, 55, 57, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 45, 45, 49, 49, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 92, 93, 97, 97, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 4, 5, 9, 10, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 51, 51, 55, 57, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 46, 46, 49, 49, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 92, 93, 97, 97, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 5, 6, 9, 10, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 51, 51, 55, 57, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 48, 48, 49, 49, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 92, 93, 97, 97, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 7, 8, 9, 10, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 51, 51, 55, 57, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 43, 43, 50, 50, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 92, 93, 97, 97, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 2, 3, 10, 11, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 51, 51, 55, 57, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 38, 42, 44, 50, 50, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 92, 93, 97, 97, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 4, 4, 10, 11, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 51, 51, 55, 57, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 44, 44, 50, 50, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 92, 93, 97, 97, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 3, 4, 10, 11, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 51, 51, 55, 57, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 38, 43, 45, 50, 50, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 92, 93, 97, 97, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 5, 5, 10, 11, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 51, 51, 55, 57, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 45, 45, 50, 50, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 92, 93, 97, 97, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 4, 5, 10, 11, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 51, 51, 55, 57, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 46, 46, 50, 50, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 92, 93, 97, 97, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 5, 6, 10, 11, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 51, 51, 55, 57, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 48, 48, 50, 50, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 92, 93, 97, 97, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 7, 8, 10, 11, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 51, 51, 55, 57, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 43, 43, 51, 51, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 92, 93, 97, 97, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 2, 3, 11, 12, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 51, 51, 55, 57, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 38, 42, 44, 51, 51, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 92, 93, 97, 97, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 4, 4, 11, 12, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 51, 51, 55, 57, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 44, 44, 51, 51, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 92, 93, 97, 97, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 3, 4, 11, 12, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 51, 51, 55, 57, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 38, 43, 45, 51, 51, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 92, 93, 97, 97, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 5, 5, 11, 12, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 51, 51, 55, 57, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 45, 45, 51, 51, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 92, 93, 97, 97, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 4, 5, 11, 12, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 51, 51, 55, 57, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 46, 46, 51, 51, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 92, 93, 97, 97, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 5, 6, 11, 12, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 51, 51, 55, 57, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 48, 48, 51, 51, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 92, 93, 97, 97, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 7, 8, 11, 12, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 51, 51, 55, 57, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 43, 43, 52, 52, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 92, 93, 97, 97, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 2, 3, 12, 13, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 51, 51, 55, 57, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 38, 42, 44, 52, 52, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 92, 93, 97, 97, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 4, 4, 12, 13, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 51, 51, 55, 57, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 44, 44, 52, 52, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 92, 93, 97, 97, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 3, 4, 12, 13, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 51, 51, 55, 57, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 38, 43, 45, 52, 52, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 92, 93, 97, 97, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 5, 5, 12, 13, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 51, 51, 55, 57, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 45, 45, 52, 52, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 92, 93, 97, 97, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 4, 5, 12, 13, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 51, 51, 55, 57, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 46, 46, 52, 52, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 92, 93, 97, 97, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 5, 6, 12, 13, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 51, 51, 55, 57, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 48, 48, 52, 52, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 92, 93, 97, 97, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 7, 8, 12, 13, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 51, 51, 55, 57, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 43, 43, 49, 49, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 92, 93, 97, 97, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 2, 3, 9, 10, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 51, 51, 55, 57, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 38, 42, 44, 49, 49, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 92, 93, 97, 97, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 4, 4, 9, 10, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 51, 51, 55, 57, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 44, 44, 49, 49, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 92, 93, 97, 97, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 3, 4, 9, 10, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 51, 51, 55, 57, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 38, 43, 45, 49, 49, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 92, 93, 97, 97, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 5, 5, 9, 10, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 51, 51, 55, 57, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 45, 45, 49, 49, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 92, 93, 97, 97, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 4, 5, 9, 10, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 51, 51, 55, 57, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 46, 46, 49, 49, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 92, 93, 97, 97, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 5, 6, 9, 10, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 51, 51, 55, 57, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 48, 48, 49, 49, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 92, 93, 97, 97, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 7, 8, 9, 10, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 51, 51, 55, 57, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 43, 43, 50, 50, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 92, 93, 97, 97, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 2, 3, 10, 11, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 51, 51, 55, 57, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 38, 42, 44, 50, 50, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 92, 93, 97, 97, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 4, 4, 10, 11, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 51, 51, 55, 57, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 44, 44, 50, 50, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 92, 93, 97, 97, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 3, 4, 10, 11, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 51, 51, 55, 57, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 38, 43, 45, 50, 50, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 92, 93, 97, 97, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 5, 5, 10, 11, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 51, 51, 55, 57, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 45, 45, 50, 50, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 92, 93, 97, 97, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 4, 5, 10, 11, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 51, 51, 55, 57, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 46, 46, 50, 50, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 92, 93, 97, 97, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 5, 6, 10, 11, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 51, 51, 55, 57, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 48, 48, 50, 50, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 92, 93, 97, 97, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 7, 8, 10, 11, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 51, 51, 55, 57, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 43, 43, 51, 51, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 92, 93, 97, 97, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 2, 3, 11, 12, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 51, 51, 55, 57, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 38, 42, 44, 51, 51, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 92, 93, 97, 97, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 4, 4, 11, 12, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 51, 51, 55, 57, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 44, 44, 51, 51, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 92, 93, 97, 97, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 3, 4, 11, 12, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 51, 51, 55, 57, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 38, 43, 45, 51, 51, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 92, 93, 97, 97, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 5, 5, 11, 12, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 51, 51, 55, 57, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 45, 45, 51, 51, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 92, 93, 97, 97, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 4, 5, 11, 12, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 51, 51, 55, 57, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 46, 46, 51, 51, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 92, 93, 97, 97, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 5, 6, 11, 12, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 51, 51, 55, 57, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 48, 48, 51, 51, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 92, 93, 97, 97, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 7, 8, 11, 12, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 51, 51, 55, 57, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 43, 43, 52, 52, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 92, 93, 97, 97, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 2, 3, 12, 13, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 51, 51, 55, 57, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 38, 42, 44, 52, 52, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 92, 93, 97, 97, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 4, 4, 12, 13, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 51, 51, 55, 57, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 44, 44, 52, 52, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 92, 93, 97, 97, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 3, 4, 12, 13, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 51, 51, 55, 57, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 38, 43, 45, 52, 52, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 92, 93, 97, 97, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 5, 5, 12, 13, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 51, 51, 55, 57, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 45, 45, 52, 52, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 92, 93, 97, 97, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 4, 5, 12, 13, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 51, 51, 55, 57, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 46, 46, 52, 52, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 92, 93, 97, 97, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 5, 6, 12, 13, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 51, 51, 55, 57, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 48, 48, 52, 52, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 92, 93, 97, 97, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 7, 8, 12, 13, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 51, 51, 55, 57, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 43, 43, 49, 49, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 89, 90, 98, 98, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 2, 3, 9, 10, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 48, 48, 56, 58, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 38, 42, 44, 49, 49, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 89, 90, 98, 98, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 4, 4, 9, 10, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 48, 48, 56, 58, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 44, 44, 49, 49, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 89, 90, 98, 98, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 3, 4, 9, 10, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 48, 48, 56, 58, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 38, 43, 45, 49, 49, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 89, 90, 98, 98, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 5, 5, 9, 10, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 48, 48, 56, 58, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 45, 45, 49, 49, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 89, 90, 98, 98, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 4, 5, 9, 10, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 48, 48, 56, 58, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 46, 46, 49, 49, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 89, 90, 98, 98, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 5, 6, 9, 10, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 48, 48, 56, 58, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 48, 48, 49, 49, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 89, 90, 98, 98, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 7, 8, 9, 10, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 48, 48, 56, 58, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 43, 43, 50, 50, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 89, 90, 98, 98, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 2, 3, 10, 11, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 48, 48, 56, 58, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 38, 42, 44, 50, 50, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 89, 90, 98, 98, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 4, 4, 10, 11, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 48, 48, 56, 58, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 44, 44, 50, 50, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 89, 90, 98, 98, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 3, 4, 10, 11, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 48, 48, 56, 58, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 38, 43, 45, 50, 50, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 89, 90, 98, 98, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 5, 5, 10, 11, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 48, 48, 56, 58, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 45, 45, 50, 50, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 89, 90, 98, 98, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 4, 5, 10, 11, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 48, 48, 56, 58, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 46, 46, 50, 50, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 89, 90, 98, 98, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 5, 6, 10, 11, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 48, 48, 56, 58, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 48, 48, 50, 50, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 89, 90, 98, 98, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 7, 8, 10, 11, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 48, 48, 56, 58, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 43, 43, 51, 51, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 89, 90, 98, 98, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 2, 3, 11, 12, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 48, 48, 56, 58, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 38, 42, 44, 51, 51, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 89, 90, 98, 98, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 4, 4, 11, 12, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 48, 48, 56, 58, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 44, 44, 51, 51, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 89, 90, 98, 98, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 3, 4, 11, 12, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 48, 48, 56, 58, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 38, 43, 45, 51, 51, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 89, 90, 98, 98, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 5, 5, 11, 12, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 48, 48, 56, 58, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 45, 45, 51, 51, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 89, 90, 98, 98, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 4, 5, 11, 12, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 48, 48, 56, 58, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 46, 46, 51, 51, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 89, 90, 98, 98, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 5, 6, 11, 12, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 48, 48, 56, 58, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 48, 48, 51, 51, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 89, 90, 98, 98, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 7, 8, 11, 12, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 48, 48, 56, 58, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 43, 43, 52, 52, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 89, 90, 98, 98, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 2, 3, 12, 13, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 48, 48, 56, 58, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 38, 42, 44, 52, 52, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 89, 90, 98, 98, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 4, 4, 12, 13, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 48, 48, 56, 58, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 44, 44, 52, 52, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 89, 90, 98, 98, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 3, 4, 12, 13, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 48, 48, 56, 58, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 38, 43, 45, 52, 52, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 89, 90, 98, 98, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 5, 5, 12, 13, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 48, 48, 56, 58, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 45, 45, 52, 52, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 89, 90, 98, 98, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 4, 5, 12, 13, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 48, 48, 56, 58, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 46, 46, 52, 52, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 89, 90, 98, 98, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 5, 6, 12, 13, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 48, 48, 56, 58, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 48, 48, 52, 52, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 89, 90, 98, 98, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 7, 8, 12, 13, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 48, 48, 56, 58, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 43, 43, 49, 49, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 89, 90, 98, 98, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 2, 3, 9, 10, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 48, 48, 56, 58, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 38, 42, 44, 49, 49, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 89, 90, 98, 98, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 4, 4, 9, 10, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 48, 48, 56, 58, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 44, 44, 49, 49, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 89, 90, 98, 98, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 3, 4, 9, 10, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 48, 48, 56, 58, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 38, 43, 45, 49, 49, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 89, 90, 98, 98, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 5, 5, 9, 10, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 48, 48, 56, 58, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 45, 45, 49, 49, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 89, 90, 98, 98, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 4, 5, 9, 10, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 48, 48, 56, 58, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 46, 46, 49, 49, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 89, 90, 98, 98, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 5, 6, 9, 10, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 48, 48, 56, 58, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 48, 48, 49, 49, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 89, 90, 98, 98, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 7, 8, 9, 10, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 48, 48, 56, 58, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 43, 43, 50, 50, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 89, 90, 98, 98, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 2, 3, 10, 11, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 48, 48, 56, 58, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 38, 42, 44, 50, 50, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 89, 90, 98, 98, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 4, 4, 10, 11, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 48, 48, 56, 58, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 44, 44, 50, 50, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 89, 90, 98, 98, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 3, 4, 10, 11, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 48, 48, 56, 58, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 38, 43, 45, 50, 50, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 89, 90, 98, 98, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 5, 5, 10, 11, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 48, 48, 56, 58, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 45, 45, 50, 50, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 89, 90, 98, 98, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 4, 5, 10, 11, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 48, 48, 56, 58, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 46, 46, 50, 50, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 89, 90, 98, 98, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 5, 6, 10, 11, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 48, 48, 56, 58, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 48, 48, 50, 50, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 89, 90, 98, 98, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 7, 8, 10, 11, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 48, 48, 56, 58, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 43, 43, 51, 51, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 89, 90, 98, 98, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 2, 3, 11, 12, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 48, 48, 56, 58, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 38, 42, 44, 51, 51, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 89, 90, 98, 98, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 4, 4, 11, 12, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 48, 48, 56, 58, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 44, 44, 51, 51, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 89, 90, 98, 98, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 3, 4, 11, 12, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 48, 48, 56, 58, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 38, 43, 45, 51, 51, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 89, 90, 98, 98, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 5, 5, 11, 12, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 48, 48, 56, 58, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 45, 45, 51, 51, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 89, 90, 98, 98, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 4, 5, 11, 12, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 48, 48, 56, 58, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 46, 46, 51, 51, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 89, 90, 98, 98, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 5, 6, 11, 12, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 48, 48, 56, 58, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 48, 48, 51, 51, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 89, 90, 98, 98, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 7, 8, 11, 12, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 48, 48, 56, 58, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 43, 43, 52, 52, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 89, 90, 98, 98, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 2, 3, 12, 13, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 48, 48, 56, 58, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 38, 42, 44, 52, 52, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 89, 90, 98, 98, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 4, 4, 12, 13, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 48, 48, 56, 58, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 44, 44, 52, 52, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 89, 90, 98, 98, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 3, 4, 12, 13, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 48, 48, 56, 58, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 38, 43, 45, 52, 52, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 89, 90, 98, 98, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 5, 5, 12, 13, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 48, 48, 56, 58, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 45, 45, 52, 52, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 89, 90, 98, 98, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 4, 5, 12, 13, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 48, 48, 56, 58, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 46, 46, 52, 52, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 89, 90, 98, 98, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 5, 6, 12, 13, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 48, 48, 56, 58, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 48, 48, 52, 52, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 89, 90, 98, 98, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 7, 8, 12, 13, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 48, 48, 56, 58, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 43, 43, 49, 49, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 90, 91, 98, 98, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 2, 3, 9, 10, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 49, 49, 56, 58, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 38, 42, 44, 49, 49, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 90, 91, 98, 98, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 4, 4, 9, 10, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 49, 49, 56, 58, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 44, 44, 49, 49, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 90, 91, 98, 98, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 3, 4, 9, 10, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 49, 49, 56, 58, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 38, 43, 45, 49, 49, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 90, 91, 98, 98, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 5, 5, 9, 10, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 49, 49, 56, 58, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 45, 45, 49, 49, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 90, 91, 98, 98, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 4, 5, 9, 10, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 49, 49, 56, 58, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 46, 46, 49, 49, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 90, 91, 98, 98, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 5, 6, 9, 10, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 49, 49, 56, 58, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 48, 48, 49, 49, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 90, 91, 98, 98, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 7, 8, 9, 10, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 49, 49, 56, 58, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 43, 43, 50, 50, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 90, 91, 98, 98, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 2, 3, 10, 11, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 49, 49, 56, 58, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 38, 42, 44, 50, 50, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 90, 91, 98, 98, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 4, 4, 10, 11, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 49, 49, 56, 58, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 44, 44, 50, 50, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 90, 91, 98, 98, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 3, 4, 10, 11, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 49, 49, 56, 58, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 38, 43, 45, 50, 50, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 90, 91, 98, 98, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 5, 5, 10, 11, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 49, 49, 56, 58, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 45, 45, 50, 50, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 90, 91, 98, 98, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 4, 5, 10, 11, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 49, 49, 56, 58, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 46, 46, 50, 50, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 90, 91, 98, 98, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 5, 6, 10, 11, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 49, 49, 56, 58, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 48, 48, 50, 50, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 90, 91, 98, 98, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 7, 8, 10, 11, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 49, 49, 56, 58, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 43, 43, 51, 51, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 90, 91, 98, 98, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 2, 3, 11, 12, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 49, 49, 56, 58, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 38, 42, 44, 51, 51, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 90, 91, 98, 98, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 4, 4, 11, 12, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 49, 49, 56, 58, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 44, 44, 51, 51, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 90, 91, 98, 98, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 3, 4, 11, 12, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 49, 49, 56, 58, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 38, 43, 45, 51, 51, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 90, 91, 98, 98, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 5, 5, 11, 12, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 49, 49, 56, 58, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 45, 45, 51, 51, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 90, 91, 98, 98, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 4, 5, 11, 12, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 49, 49, 56, 58, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 46, 46, 51, 51, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 90, 91, 98, 98, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 5, 6, 11, 12, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 49, 49, 56, 58, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 48, 48, 51, 51, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 90, 91, 98, 98, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 7, 8, 11, 12, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 49, 49, 56, 58, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 43, 43, 52, 52, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 90, 91, 98, 98, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 2, 3, 12, 13, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 49, 49, 56, 58, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 38, 42, 44, 52, 52, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 90, 91, 98, 98, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 4, 4, 12, 13, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 49, 49, 56, 58, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 44, 44, 52, 52, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 90, 91, 98, 98, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 3, 4, 12, 13, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 49, 49, 56, 58, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 38, 43, 45, 52, 52, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 90, 91, 98, 98, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 5, 5, 12, 13, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 49, 49, 56, 58, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 45, 45, 52, 52, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 90, 91, 98, 98, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 4, 5, 12, 13, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 49, 49, 56, 58, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 46, 46, 52, 52, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 90, 91, 98, 98, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 5, 6, 12, 13, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 49, 49, 56, 58, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 48, 48, 52, 52, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 90, 91, 98, 98, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 7, 8, 12, 13, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 49, 49, 56, 58, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 43, 43, 49, 49, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 90, 91, 98, 98, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 2, 3, 9, 10, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 49, 49, 56, 58, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 38, 42, 44, 49, 49, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 90, 91, 98, 98, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 4, 4, 9, 10, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 49, 49, 56, 58, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 44, 44, 49, 49, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 90, 91, 98, 98, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 3, 4, 9, 10, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 49, 49, 56, 58, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 38, 43, 45, 49, 49, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 90, 91, 98, 98, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 5, 5, 9, 10, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 49, 49, 56, 58, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 45, 45, 49, 49, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 90, 91, 98, 98, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 4, 5, 9, 10, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 49, 49, 56, 58, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 46, 46, 49, 49, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 90, 91, 98, 98, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 5, 6, 9, 10, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 49, 49, 56, 58, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 48, 48, 49, 49, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 90, 91, 98, 98, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 7, 8, 9, 10, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 49, 49, 56, 58, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 43, 43, 50, 50, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 90, 91, 98, 98, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 2, 3, 10, 11, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 49, 49, 56, 58, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 38, 42, 44, 50, 50, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 90, 91, 98, 98, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 4, 4, 10, 11, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 49, 49, 56, 58, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 44, 44, 50, 50, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 90, 91, 98, 98, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 3, 4, 10, 11, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 49, 49, 56, 58, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 38, 43, 45, 50, 50, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 90, 91, 98, 98, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 5, 5, 10, 11, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 49, 49, 56, 58, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 45, 45, 50, 50, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 90, 91, 98, 98, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 4, 5, 10, 11, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 49, 49, 56, 58, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 46, 46, 50, 50, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 90, 91, 98, 98, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 5, 6, 10, 11, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 49, 49, 56, 58, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 48, 48, 50, 50, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 90, 91, 98, 98, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 7, 8, 10, 11, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 49, 49, 56, 58, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 43, 43, 51, 51, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 90, 91, 98, 98, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 2, 3, 11, 12, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 49, 49, 56, 58, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 38, 42, 44, 51, 51, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 90, 91, 98, 98, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 4, 4, 11, 12, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 49, 49, 56, 58, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 44, 44, 51, 51, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 90, 91, 98, 98, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 3, 4, 11, 12, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 49, 49, 56, 58, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 38, 43, 45, 51, 51, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 90, 91, 98, 98, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 5, 5, 11, 12, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 49, 49, 56, 58, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 45, 45, 51, 51, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 90, 91, 98, 98, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 4, 5, 11, 12, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 49, 49, 56, 58, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 46, 46, 51, 51, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 90, 91, 98, 98, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 5, 6, 11, 12, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 49, 49, 56, 58, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 48, 48, 51, 51, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 90, 91, 98, 98, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 7, 8, 11, 12, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 49, 49, 56, 58, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 43, 43, 52, 52, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 90, 91, 98, 98, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 2, 3, 12, 13, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 49, 49, 56, 58, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 38, 42, 44, 52, 52, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 90, 91, 98, 98, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 4, 4, 12, 13, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 49, 49, 56, 58, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 44, 44, 52, 52, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 90, 91, 98, 98, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 3, 4, 12, 13, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 49, 49, 56, 58, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 38, 43, 45, 52, 52, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 90, 91, 98, 98, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 5, 5, 12, 13, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 49, 49, 56, 58, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 45, 45, 52, 52, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 90, 91, 98, 98, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 4, 5, 12, 13, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 49, 49, 56, 58, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 46, 46, 52, 52, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 90, 91, 98, 98, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 5, 6, 12, 13, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 49, 49, 56, 58, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 48, 48, 52, 52, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 90, 91, 98, 98, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 7, 8, 12, 13, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 49, 49, 56, 58, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 43, 43, 49, 49, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 91, 92, 98, 98, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 2, 3, 9, 10, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 50, 50, 56, 58, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 38, 42, 44, 49, 49, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 91, 92, 98, 98, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 4, 4, 9, 10, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 50, 50, 56, 58, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 44, 44, 49, 49, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 91, 92, 98, 98, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 3, 4, 9, 10, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 50, 50, 56, 58, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 38, 43, 45, 49, 49, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 91, 92, 98, 98, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 5, 5, 9, 10, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 50, 50, 56, 58, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 45, 45, 49, 49, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 91, 92, 98, 98, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 4, 5, 9, 10, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 50, 50, 56, 58, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 46, 46, 49, 49, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 91, 92, 98, 98, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 5, 6, 9, 10, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 50, 50, 56, 58, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 48, 48, 49, 49, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 91, 92, 98, 98, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 7, 8, 9, 10, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 50, 50, 56, 58, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 43, 43, 50, 50, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 91, 92, 98, 98, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 2, 3, 10, 11, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 50, 50, 56, 58, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 38, 42, 44, 50, 50, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 91, 92, 98, 98, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 4, 4, 10, 11, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 50, 50, 56, 58, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 44, 44, 50, 50, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 91, 92, 98, 98, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 3, 4, 10, 11, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 50, 50, 56, 58, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 38, 43, 45, 50, 50, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 91, 92, 98, 98, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 5, 5, 10, 11, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 50, 50, 56, 58, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 45, 45, 50, 50, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 91, 92, 98, 98, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 4, 5, 10, 11, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 50, 50, 56, 58, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 46, 46, 50, 50, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 91, 92, 98, 98, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 5, 6, 10, 11, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 50, 50, 56, 58, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 48, 48, 50, 50, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 91, 92, 98, 98, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 7, 8, 10, 11, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 50, 50, 56, 58, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 43, 43, 51, 51, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 91, 92, 98, 98, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 2, 3, 11, 12, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 50, 50, 56, 58, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 38, 42, 44, 51, 51, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 91, 92, 98, 98, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 4, 4, 11, 12, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 50, 50, 56, 58, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 44, 44, 51, 51, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 91, 92, 98, 98, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 3, 4, 11, 12, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 50, 50, 56, 58, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 38, 43, 45, 51, 51, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 91, 92, 98, 98, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 5, 5, 11, 12, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 50, 50, 56, 58, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 45, 45, 51, 51, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 91, 92, 98, 98, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 4, 5, 11, 12, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 50, 50, 56, 58, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 46, 46, 51, 51, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 91, 92, 98, 98, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 5, 6, 11, 12, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 50, 50, 56, 58, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 48, 48, 51, 51, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 91, 92, 98, 98, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 7, 8, 11, 12, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 50, 50, 56, 58, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 43, 43, 52, 52, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 91, 92, 98, 98, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 2, 3, 12, 13, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 50, 50, 56, 58, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 38, 42, 44, 52, 52, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 91, 92, 98, 98, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 4, 4, 12, 13, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 50, 50, 56, 58, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 44, 44, 52, 52, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 91, 92, 98, 98, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 3, 4, 12, 13, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 50, 50, 56, 58, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 38, 43, 45, 52, 52, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 91, 92, 98, 98, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 5, 5, 12, 13, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 50, 50, 56, 58, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 45, 45, 52, 52, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 91, 92, 98, 98, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 4, 5, 12, 13, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 50, 50, 56, 58, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 46, 46, 52, 52, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 91, 92, 98, 98, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 5, 6, 12, 13, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 50, 50, 56, 58, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 48, 48, 52, 52, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 91, 92, 98, 98, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 7, 8, 12, 13, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 50, 50, 56, 58, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 43, 43, 49, 49, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 91, 92, 98, 98, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 2, 3, 9, 10, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 50, 50, 56, 58, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 38, 42, 44, 49, 49, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 91, 92, 98, 98, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 4, 4, 9, 10, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 50, 50, 56, 58, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 44, 44, 49, 49, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 91, 92, 98, 98, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 3, 4, 9, 10, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 50, 50, 56, 58, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 38, 43, 45, 49, 49, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 91, 92, 98, 98, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 5, 5, 9, 10, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 50, 50, 56, 58, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 45, 45, 49, 49, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 91, 92, 98, 98, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 4, 5, 9, 10, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 50, 50, 56, 58, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 46, 46, 49, 49, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 91, 92, 98, 98, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 5, 6, 9, 10, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 50, 50, 56, 58, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 48, 48, 49, 49, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 91, 92, 98, 98, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 7, 8, 9, 10, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 50, 50, 56, 58, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 43, 43, 50, 50, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 91, 92, 98, 98, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 2, 3, 10, 11, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 50, 50, 56, 58, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 38, 42, 44, 50, 50, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 91, 92, 98, 98, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 4, 4, 10, 11, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 50, 50, 56, 58, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 44, 44, 50, 50, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 91, 92, 98, 98, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 3, 4, 10, 11, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 50, 50, 56, 58, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 38, 43, 45, 50, 50, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 91, 92, 98, 98, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 5, 5, 10, 11, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 50, 50, 56, 58, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 45, 45, 50, 50, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 91, 92, 98, 98, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 4, 5, 10, 11, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 50, 50, 56, 58, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 46, 46, 50, 50, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 91, 92, 98, 98, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 5, 6, 10, 11, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 50, 50, 56, 58, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 48, 48, 50, 50, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 91, 92, 98, 98, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 7, 8, 10, 11, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 50, 50, 56, 58, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 43, 43, 51, 51, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 91, 92, 98, 98, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 2, 3, 11, 12, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 50, 50, 56, 58, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 38, 42, 44, 51, 51, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 91, 92, 98, 98, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 4, 4, 11, 12, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 50, 50, 56, 58, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 44, 44, 51, 51, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 91, 92, 98, 98, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 3, 4, 11, 12, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 50, 50, 56, 58, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 38, 43, 45, 51, 51, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 91, 92, 98, 98, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 5, 5, 11, 12, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 50, 50, 56, 58, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 45, 45, 51, 51, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 91, 92, 98, 98, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 4, 5, 11, 12, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 50, 50, 56, 58, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 46, 46, 51, 51, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 91, 92, 98, 98, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 5, 6, 11, 12, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 50, 50, 56, 58, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 48, 48, 51, 51, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 91, 92, 98, 98, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 7, 8, 11, 12, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 50, 50, 56, 58, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 43, 43, 52, 52, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 91, 92, 98, 98, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 2, 3, 12, 13, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 50, 50, 56, 58, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 38, 42, 44, 52, 52, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 91, 92, 98, 98, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 4, 4, 12, 13, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 50, 50, 56, 58, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 44, 44, 52, 52, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 91, 92, 98, 98, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 3, 4, 12, 13, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 50, 50, 56, 58, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 38, 43, 45, 52, 52, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 91, 92, 98, 98, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 5, 5, 12, 13, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 50, 50, 56, 58, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 45, 45, 52, 52, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 91, 92, 98, 98, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 4, 5, 12, 13, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 50, 50, 56, 58, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 46, 46, 52, 52, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 91, 92, 98, 98, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 5, 6, 12, 13, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 50, 50, 56, 58, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 48, 48, 52, 52, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 91, 92, 98, 98, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 7, 8, 12, 13, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 50, 50, 56, 58, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 43, 43, 49, 49, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 92, 93, 98, 98, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 2, 3, 9, 10, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 51, 51, 56, 58, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 38, 42, 44, 49, 49, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 92, 93, 98, 98, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 4, 4, 9, 10, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 51, 51, 56, 58, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 44, 44, 49, 49, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 92, 93, 98, 98, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 3, 4, 9, 10, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 51, 51, 56, 58, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 38, 43, 45, 49, 49, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 92, 93, 98, 98, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 5, 5, 9, 10, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 51, 51, 56, 58, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 45, 45, 49, 49, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 92, 93, 98, 98, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 4, 5, 9, 10, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 51, 51, 56, 58, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 46, 46, 49, 49, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 92, 93, 98, 98, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 5, 6, 9, 10, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 51, 51, 56, 58, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 48, 48, 49, 49, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 92, 93, 98, 98, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 7, 8, 9, 10, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 51, 51, 56, 58, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 43, 43, 50, 50, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 92, 93, 98, 98, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 2, 3, 10, 11, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 51, 51, 56, 58, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 38, 42, 44, 50, 50, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 92, 93, 98, 98, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 4, 4, 10, 11, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 51, 51, 56, 58, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 44, 44, 50, 50, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 92, 93, 98, 98, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 3, 4, 10, 11, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 51, 51, 56, 58, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 38, 43, 45, 50, 50, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 92, 93, 98, 98, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 5, 5, 10, 11, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 51, 51, 56, 58, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 45, 45, 50, 50, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 92, 93, 98, 98, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 4, 5, 10, 11, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 51, 51, 56, 58, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 46, 46, 50, 50, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 92, 93, 98, 98, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 5, 6, 10, 11, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 51, 51, 56, 58, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 48, 48, 50, 50, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 92, 93, 98, 98, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 7, 8, 10, 11, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 51, 51, 56, 58, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 43, 43, 51, 51, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 92, 93, 98, 98, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 2, 3, 11, 12, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 51, 51, 56, 58, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 38, 42, 44, 51, 51, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 92, 93, 98, 98, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 4, 4, 11, 12, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 51, 51, 56, 58, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 44, 44, 51, 51, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 92, 93, 98, 98, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 3, 4, 11, 12, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 51, 51, 56, 58, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 38, 43, 45, 51, 51, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 92, 93, 98, 98, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 5, 5, 11, 12, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 51, 51, 56, 58, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 45, 45, 51, 51, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 92, 93, 98, 98, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 4, 5, 11, 12, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 51, 51, 56, 58, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 46, 46, 51, 51, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 92, 93, 98, 98, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 5, 6, 11, 12, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 51, 51, 56, 58, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 48, 48, 51, 51, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 92, 93, 98, 98, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 7, 8, 11, 12, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 51, 51, 56, 58, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 43, 43, 52, 52, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 92, 93, 98, 98, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 2, 3, 12, 13, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 51, 51, 56, 58, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 38, 42, 44, 52, 52, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 92, 93, 98, 98, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 4, 4, 12, 13, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 51, 51, 56, 58, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 44, 44, 52, 52, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 92, 93, 98, 98, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 3, 4, 12, 13, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 51, 51, 56, 58, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 38, 43, 45, 52, 52, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 92, 93, 98, 98, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 5, 5, 12, 13, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 51, 51, 56, 58, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 45, 45, 52, 52, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 92, 93, 98, 98, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 4, 5, 12, 13, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 51, 51, 56, 58, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 46, 46, 52, 52, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 92, 93, 98, 98, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 5, 6, 12, 13, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 51, 51, 56, 58, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 48, 48, 52, 52, 55, 55, 56, 60, 65, 66, 84, 84, 85, 86, 92, 93, 98, 98, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 7, 8, 12, 13, 16, 17, 18, 18, 23, 23, 41, 44, 45, 45, 51, 51, 56, 58, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 43, 43, 49, 49, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 92, 93, 98, 98, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 2, 3, 9, 10, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 51, 51, 56, 58, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 38, 42, 44, 49, 49, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 92, 93, 98, 98, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 4, 4, 9, 10, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 51, 51, 56, 58, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 44, 44, 49, 49, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 92, 93, 98, 98, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 3, 4, 9, 10, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 51, 51, 56, 58, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 38, 43, 45, 49, 49, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 92, 93, 98, 98, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 5, 5, 9, 10, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 51, 51, 56, 58, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 45, 45, 49, 49, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 92, 93, 98, 98, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 4, 5, 9, 10, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 51, 51, 56, 58, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 46, 46, 49, 49, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 92, 93, 98, 98, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 5, 6, 9, 10, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 51, 51, 56, 58, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 48, 48, 49, 49, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 92, 93, 98, 98, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 7, 8, 9, 10, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 51, 51, 56, 58, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 43, 43, 50, 50, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 92, 93, 98, 98, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 2, 3, 10, 11, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 51, 51, 56, 58, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 38, 42, 44, 50, 50, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 92, 93, 98, 98, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 4, 4, 10, 11, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 51, 51, 56, 58, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 44, 44, 50, 50, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 92, 93, 98, 98, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 3, 4, 10, 11, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 51, 51, 56, 58, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 38, 43, 45, 50, 50, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 92, 93, 98, 98, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 5, 5, 10, 11, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 51, 51, 56, 58, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 45, 45, 50, 50, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 92, 93, 98, 98, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 4, 5, 10, 11, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 51, 51, 56, 58, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 46, 46, 50, 50, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 92, 93, 98, 98, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 5, 6, 10, 11, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 51, 51, 56, 58, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 48, 48, 50, 50, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 92, 93, 98, 98, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 7, 8, 10, 11, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 51, 51, 56, 58, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 43, 43, 51, 51, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 92, 93, 98, 98, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 2, 3, 11, 12, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 51, 51, 56, 58, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 38, 42, 44, 51, 51, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 92, 93, 98, 98, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 4, 4, 11, 12, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 51, 51, 56, 58, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 44, 44, 51, 51, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 92, 93, 98, 98, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 3, 4, 11, 12, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 51, 51, 56, 58, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 38, 43, 45, 51, 51, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 92, 93, 98, 98, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 5, 5, 11, 12, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 51, 51, 56, 58, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 45, 45, 51, 51, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 92, 93, 98, 98, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 4, 5, 11, 12, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 51, 51, 56, 58, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 46, 46, 51, 51, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 92, 93, 98, 98, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 5, 6, 11, 12, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 51, 51, 56, 58, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 48, 48, 51, 51, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 92, 93, 98, 98, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 7, 8, 11, 12, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 51, 51, 56, 58, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 43, 43, 52, 52, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 92, 93, 98, 98, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 2, 3, 12, 13, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 51, 51, 56, 58, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 38, 42, 44, 52, 52, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 92, 93, 98, 98, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 4, 4, 12, 13, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 51, 51, 56, 58, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 44, 44, 52, 52, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 92, 93, 98, 98, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 3, 4, 12, 13, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 51, 51, 56, 58, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 38, 43, 45, 52, 52, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 92, 93, 98, 98, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 5, 5, 12, 13, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 51, 51, 56, 58, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 45, 45, 52, 52, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 92, 93, 98, 98, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 4, 5, 12, 13, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 51, 51, 56, 58, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 46, 46, 52, 52, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 92, 93, 98, 98, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 5, 6, 12, 13, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 51, 51, 56, 58, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ], [ [ 0, 41, 48, 48, 52, 52, 55, 55, 56, 60, 67, 68, 84, 84, 85, 86, 92, 93, 98, 98, 105, 106, 111, 111, 123, 124, 130, 131, 135 ], [ 0, 0, 7, 8, 12, 13, 16, 17, 18, 18, 25, 25, 41, 44, 45, 45, 51, 51, 56, 58, 65, 65, 70, 76, 88, 88, 94, 94, 98 ] ] ], "tuples": [ [ 58, 0, 108, 26, 24, 13, 98, 94 ], [ 59, 0, 110, 26, 25, 13, 98, 97 ] ], "tupleFields": [ "identical", "ambiguousColumns", "columns", "mismatches", "gapColumns", "gapOpens", "readAligned", "referenceCovered" ], "variation": { "readAligned": { "shared": true, "min": 98, "max": 98 }, "referenceCovered": { "shared": false, "min": 94, "max": 97 }, "identity": { "shared": false, "min": { "numerator": 59, "denominator": 110 }, "max": { "numerator": 29, "denominator": 54 } }, "overhangStart": { "shared": true, "min": 0, "max": 0 }, "overhangEnd": { "shared": true, "min": 0, "max": 0 } }, "placements": [ { "refStart": 39, "refEnd": 32, "crossesOrigin": true, "wholeCircle": false, "readStart": 1, "readEnd": 98, "asSupplied": { "readStart": 1, "readEnd": 98 }, "alignments": 896, "band": { "diagonalMin": 35, "diagonalMax": 43, "cellsNeeded": 1089, "bandLimited": false } } ] } }, { "mode": "local", "region": null, "strand": "+", "strandUndetermined": false, "plus": { "score": 170, "count": 256, "overCap": false, "state": "aligned", "biopython": { "score": 170, "count": 512, "tailScore": 170, "tailCountSubtracted": 256, "certifiedText": { "extension": 98, "textLength": 298, "reruns": 0, "differencesUpTo": 13 } }, "uniquePairs": [ [ 1, 1 ], [ 2, 2 ], [ 3, 3 ], [ 4, 4 ], [ 5, 5 ], [ 6, 6 ], [ 7, 7 ], [ 8, 8 ], [ 9, 9 ], [ 10, 10 ], [ 11, 11 ], [ 12, 12 ], [ 13, 13 ], [ 14, 14 ], [ 15, 15 ], [ 16, 16 ], [ 21, 20 ], [ 22, 21 ], [ 23, 22 ], [ 24, 23 ], [ 25, 24 ], [ 26, 25 ], [ 27, 26 ], [ 28, 27 ], [ 29, 28 ], [ 30, 29 ], [ 31, 30 ], [ 32, 31 ], [ 33, 32 ], [ 34, 33 ], [ 35, 34 ], [ 36, 35 ], [ 41, 39 ], [ 42, 40 ], [ 43, 41 ], [ 44, 42 ], [ 45, 43 ], [ 46, 44 ], [ 47, 45 ], [ 48, 46 ], [ 49, 47 ], [ 50, 48 ], [ 51, 49 ], [ 52, 50 ], [ 53, 51 ], [ 54, 52 ], [ 55, 53 ], [ 56, 54 ], [ 61, 58 ], [ 62, 59 ], [ 63, 60 ], [ 64, 61 ], [ 65, 62 ], [ 66, 63 ], [ 67, 64 ], [ 68, 65 ], [ 69, 66 ], [ 70, 67 ], [ 71, 68 ], [ 72, 69 ], [ 73, 70 ], [ 74, 71 ], [ 75, 72 ], [ 76, 73 ], [ 81, 77 ], [ 82, 78 ], [ 83, 79 ], [ 84, 80 ], [ 85, 81 ], [ 86, 82 ], [ 87, 83 ], [ 88, 84 ], [ 89, 85 ], [ 90, 86 ], [ 91, 87 ], [ 92, 88 ], [ 93, 89 ], [ 94, 90 ], [ 95, 91 ], [ 96, 92 ], [ 97, 93 ], [ 98, 94 ], [ 99, 95 ] ], "uniquePlacement": true, "placementNotDetermined": false, "noCommonColumn": false, "hull": { "refStart": 1, "refEnd": 99, "crossesOrigin": false, "wholeCircle": false }, "selected": { "coordinates": [ [ 0, 16, 17, 36, 37, 56, 57, 76, 77, 99 ], [ 0, 16, 16, 35, 35, 54, 54, 73, 73, 95 ] ], "gappedReference": "CAGATCCGTCTTGTCGAAAACGATGGCGTCGGATTGAAAACTACCTCCGCCGTAGGAAAACGGCTATACACAAGCGAAAACCCGCACTATGGGCTGAAA", "gappedRead": "CAGATCCGTCTTGTCG-AAACGATGGCGTCGGATTG-AAACTACCTCCGCCGTAGG-AAACGGCTATACACAAGCG-AAACCCGCACTATGGGCTGAAA", "columns": 99, "identical": 95, "mismatches": 0, "ambiguousColumns": 0, "gapColumns": 4, "gapOpens": 4, "identity": { "numerator": 95, "denominator": 99 }, "readAligned": { "bases": 95, "of": 98 }, "referenceCovered": { "bases": 99, "of": 103 }, "placement": { "refStart": 1, "refEnd": 99, "readStart": 1, "readEnd": 95, "crossesOrigin": false }, "overhang": [], "differences": [ { "kind": "deletion", "refStart": 17, "refEnd": 17, "length": 1, "bases": "A", "readAfter": 16, "common": false, "notFixed": { "from": { "ref": 16, "read": 16 }, "to": { "ref": 21, "read": 20 } } }, { "kind": "deletion", "refStart": 37, "refEnd": 37, "length": 1, "bases": "A", "readAfter": 35, "common": false, "notFixed": { "from": { "ref": 36, "read": 35 }, "to": { "ref": 41, "read": 39 } } }, { "kind": "deletion", "refStart": 57, "refEnd": 57, "length": 1, "bases": "A", "readAfter": 54, "common": false, "notFixed": { "from": { "ref": 56, "read": 54 }, "to": { "ref": 61, "read": 58 } } }, { "kind": "deletion", "refStart": 77, "refEnd": 77, "length": 1, "bases": "A", "readAfter": 73, "common": false, "notFixed": { "from": { "ref": 76, "read": 73 }, "to": { "ref": 81, "read": 77 } } } ] }, "band": { "diagonalMin": 0, "diagonalMax": 4, "cellsNeeded": 692, "unionBandLimited": false, "scope": "every optimal path", "gridCells": 29601, "searchedBanded": true, "sharedWords": 52, "sharedWordsOverCap": false, "seedGuarantee": { "differencesUpTo": 13, "guaranteed": false } }, "enumeration": "listed", "alignments": [ [ [ 0, 16, 17, 36, 37, 56, 57, 76, 77, 99 ], [ 0, 16, 16, 35, 35, 54, 54, 73, 73, 95 ] ], [ [ 0, 17, 18, 36, 37, 56, 57, 76, 77, 99 ], [ 0, 17, 17, 35, 35, 54, 54, 73, 73, 95 ] ], [ [ 0, 18, 19, 36, 37, 56, 57, 76, 77, 99 ], [ 0, 18, 18, 35, 35, 54, 54, 73, 73, 95 ] ], [ [ 0, 19, 20, 36, 37, 56, 57, 76, 77, 99 ], [ 0, 19, 19, 35, 35, 54, 54, 73, 73, 95 ] ], [ [ 0, 16, 17, 37, 38, 56, 57, 76, 77, 99 ], [ 0, 16, 16, 36, 36, 54, 54, 73, 73, 95 ] ], [ [ 0, 17, 18, 37, 38, 56, 57, 76, 77, 99 ], [ 0, 17, 17, 36, 36, 54, 54, 73, 73, 95 ] ], [ [ 0, 18, 19, 37, 38, 56, 57, 76, 77, 99 ], [ 0, 18, 18, 36, 36, 54, 54, 73, 73, 95 ] ], [ [ 0, 19, 20, 37, 38, 56, 57, 76, 77, 99 ], [ 0, 19, 19, 36, 36, 54, 54, 73, 73, 95 ] ], [ [ 0, 16, 17, 38, 39, 56, 57, 76, 77, 99 ], [ 0, 16, 16, 37, 37, 54, 54, 73, 73, 95 ] ], [ [ 0, 17, 18, 38, 39, 56, 57, 76, 77, 99 ], [ 0, 17, 17, 37, 37, 54, 54, 73, 73, 95 ] ], [ [ 0, 18, 19, 38, 39, 56, 57, 76, 77, 99 ], [ 0, 18, 18, 37, 37, 54, 54, 73, 73, 95 ] ], [ [ 0, 19, 20, 38, 39, 56, 57, 76, 77, 99 ], [ 0, 19, 19, 37, 37, 54, 54, 73, 73, 95 ] ], [ [ 0, 16, 17, 39, 40, 56, 57, 76, 77, 99 ], [ 0, 16, 16, 38, 38, 54, 54, 73, 73, 95 ] ], [ [ 0, 17, 18, 39, 40, 56, 57, 76, 77, 99 ], [ 0, 17, 17, 38, 38, 54, 54, 73, 73, 95 ] ], [ [ 0, 18, 19, 39, 40, 56, 57, 76, 77, 99 ], [ 0, 18, 18, 38, 38, 54, 54, 73, 73, 95 ] ], [ [ 0, 19, 20, 39, 40, 56, 57, 76, 77, 99 ], [ 0, 19, 19, 38, 38, 54, 54, 73, 73, 95 ] ], [ [ 0, 16, 17, 36, 37, 57, 58, 76, 77, 99 ], [ 0, 16, 16, 35, 35, 55, 55, 73, 73, 95 ] ], [ [ 0, 17, 18, 36, 37, 57, 58, 76, 77, 99 ], [ 0, 17, 17, 35, 35, 55, 55, 73, 73, 95 ] ], [ [ 0, 18, 19, 36, 37, 57, 58, 76, 77, 99 ], [ 0, 18, 18, 35, 35, 55, 55, 73, 73, 95 ] ], [ [ 0, 19, 20, 36, 37, 57, 58, 76, 77, 99 ], [ 0, 19, 19, 35, 35, 55, 55, 73, 73, 95 ] ], [ [ 0, 16, 17, 37, 38, 57, 58, 76, 77, 99 ], [ 0, 16, 16, 36, 36, 55, 55, 73, 73, 95 ] ], [ [ 0, 17, 18, 37, 38, 57, 58, 76, 77, 99 ], [ 0, 17, 17, 36, 36, 55, 55, 73, 73, 95 ] ], [ [ 0, 18, 19, 37, 38, 57, 58, 76, 77, 99 ], [ 0, 18, 18, 36, 36, 55, 55, 73, 73, 95 ] ], [ [ 0, 19, 20, 37, 38, 57, 58, 76, 77, 99 ], [ 0, 19, 19, 36, 36, 55, 55, 73, 73, 95 ] ], [ [ 0, 16, 17, 38, 39, 57, 58, 76, 77, 99 ], [ 0, 16, 16, 37, 37, 55, 55, 73, 73, 95 ] ], [ [ 0, 17, 18, 38, 39, 57, 58, 76, 77, 99 ], [ 0, 17, 17, 37, 37, 55, 55, 73, 73, 95 ] ], [ [ 0, 18, 19, 38, 39, 57, 58, 76, 77, 99 ], [ 0, 18, 18, 37, 37, 55, 55, 73, 73, 95 ] ], [ [ 0, 19, 20, 38, 39, 57, 58, 76, 77, 99 ], [ 0, 19, 19, 37, 37, 55, 55, 73, 73, 95 ] ], [ [ 0, 16, 17, 39, 40, 57, 58, 76, 77, 99 ], [ 0, 16, 16, 38, 38, 55, 55, 73, 73, 95 ] ], [ [ 0, 17, 18, 39, 40, 57, 58, 76, 77, 99 ], [ 0, 17, 17, 38, 38, 55, 55, 73, 73, 95 ] ], [ [ 0, 18, 19, 39, 40, 57, 58, 76, 77, 99 ], [ 0, 18, 18, 38, 38, 55, 55, 73, 73, 95 ] ], [ [ 0, 19, 20, 39, 40, 57, 58, 76, 77, 99 ], [ 0, 19, 19, 38, 38, 55, 55, 73, 73, 95 ] ], [ [ 0, 16, 17, 36, 37, 58, 59, 76, 77, 99 ], [ 0, 16, 16, 35, 35, 56, 56, 73, 73, 95 ] ], [ [ 0, 17, 18, 36, 37, 58, 59, 76, 77, 99 ], [ 0, 17, 17, 35, 35, 56, 56, 73, 73, 95 ] ], [ [ 0, 18, 19, 36, 37, 58, 59, 76, 77, 99 ], [ 0, 18, 18, 35, 35, 56, 56, 73, 73, 95 ] ], [ [ 0, 19, 20, 36, 37, 58, 59, 76, 77, 99 ], [ 0, 19, 19, 35, 35, 56, 56, 73, 73, 95 ] ], [ [ 0, 16, 17, 37, 38, 58, 59, 76, 77, 99 ], [ 0, 16, 16, 36, 36, 56, 56, 73, 73, 95 ] ], [ [ 0, 17, 18, 37, 38, 58, 59, 76, 77, 99 ], [ 0, 17, 17, 36, 36, 56, 56, 73, 73, 95 ] ], [ [ 0, 18, 19, 37, 38, 58, 59, 76, 77, 99 ], [ 0, 18, 18, 36, 36, 56, 56, 73, 73, 95 ] ], [ [ 0, 19, 20, 37, 38, 58, 59, 76, 77, 99 ], [ 0, 19, 19, 36, 36, 56, 56, 73, 73, 95 ] ], [ [ 0, 16, 17, 38, 39, 58, 59, 76, 77, 99 ], [ 0, 16, 16, 37, 37, 56, 56, 73, 73, 95 ] ], [ [ 0, 17, 18, 38, 39, 58, 59, 76, 77, 99 ], [ 0, 17, 17, 37, 37, 56, 56, 73, 73, 95 ] ], [ [ 0, 18, 19, 38, 39, 58, 59, 76, 77, 99 ], [ 0, 18, 18, 37, 37, 56, 56, 73, 73, 95 ] ], [ [ 0, 19, 20, 38, 39, 58, 59, 76, 77, 99 ], [ 0, 19, 19, 37, 37, 56, 56, 73, 73, 95 ] ], [ [ 0, 16, 17, 39, 40, 58, 59, 76, 77, 99 ], [ 0, 16, 16, 38, 38, 56, 56, 73, 73, 95 ] ], [ [ 0, 17, 18, 39, 40, 58, 59, 76, 77, 99 ], [ 0, 17, 17, 38, 38, 56, 56, 73, 73, 95 ] ], [ [ 0, 18, 19, 39, 40, 58, 59, 76, 77, 99 ], [ 0, 18, 18, 38, 38, 56, 56, 73, 73, 95 ] ], [ [ 0, 19, 20, 39, 40, 58, 59, 76, 77, 99 ], [ 0, 19, 19, 38, 38, 56, 56, 73, 73, 95 ] ], [ [ 0, 16, 17, 36, 37, 59, 60, 76, 77, 99 ], [ 0, 16, 16, 35, 35, 57, 57, 73, 73, 95 ] ], [ [ 0, 17, 18, 36, 37, 59, 60, 76, 77, 99 ], [ 0, 17, 17, 35, 35, 57, 57, 73, 73, 95 ] ], [ [ 0, 18, 19, 36, 37, 59, 60, 76, 77, 99 ], [ 0, 18, 18, 35, 35, 57, 57, 73, 73, 95 ] ], [ [ 0, 19, 20, 36, 37, 59, 60, 76, 77, 99 ], [ 0, 19, 19, 35, 35, 57, 57, 73, 73, 95 ] ], [ [ 0, 16, 17, 37, 38, 59, 60, 76, 77, 99 ], [ 0, 16, 16, 36, 36, 57, 57, 73, 73, 95 ] ], [ [ 0, 17, 18, 37, 38, 59, 60, 76, 77, 99 ], [ 0, 17, 17, 36, 36, 57, 57, 73, 73, 95 ] ], [ [ 0, 18, 19, 37, 38, 59, 60, 76, 77, 99 ], [ 0, 18, 18, 36, 36, 57, 57, 73, 73, 95 ] ], [ [ 0, 19, 20, 37, 38, 59, 60, 76, 77, 99 ], [ 0, 19, 19, 36, 36, 57, 57, 73, 73, 95 ] ], [ [ 0, 16, 17, 38, 39, 59, 60, 76, 77, 99 ], [ 0, 16, 16, 37, 37, 57, 57, 73, 73, 95 ] ], [ [ 0, 17, 18, 38, 39, 59, 60, 76, 77, 99 ], [ 0, 17, 17, 37, 37, 57, 57, 73, 73, 95 ] ], [ [ 0, 18, 19, 38, 39, 59, 60, 76, 77, 99 ], [ 0, 18, 18, 37, 37, 57, 57, 73, 73, 95 ] ], [ [ 0, 19, 20, 38, 39, 59, 60, 76, 77, 99 ], [ 0, 19, 19, 37, 37, 57, 57, 73, 73, 95 ] ], [ [ 0, 16, 17, 39, 40, 59, 60, 76, 77, 99 ], [ 0, 16, 16, 38, 38, 57, 57, 73, 73, 95 ] ], [ [ 0, 17, 18, 39, 40, 59, 60, 76, 77, 99 ], [ 0, 17, 17, 38, 38, 57, 57, 73, 73, 95 ] ], [ [ 0, 18, 19, 39, 40, 59, 60, 76, 77, 99 ], [ 0, 18, 18, 38, 38, 57, 57, 73, 73, 95 ] ], [ [ 0, 19, 20, 39, 40, 59, 60, 76, 77, 99 ], [ 0, 19, 19, 38, 38, 57, 57, 73, 73, 95 ] ], [ [ 0, 16, 17, 36, 37, 56, 57, 77, 78, 99 ], [ 0, 16, 16, 35, 35, 54, 54, 74, 74, 95 ] ], [ [ 0, 17, 18, 36, 37, 56, 57, 77, 78, 99 ], [ 0, 17, 17, 35, 35, 54, 54, 74, 74, 95 ] ], [ [ 0, 18, 19, 36, 37, 56, 57, 77, 78, 99 ], [ 0, 18, 18, 35, 35, 54, 54, 74, 74, 95 ] ], [ [ 0, 19, 20, 36, 37, 56, 57, 77, 78, 99 ], [ 0, 19, 19, 35, 35, 54, 54, 74, 74, 95 ] ], [ [ 0, 16, 17, 37, 38, 56, 57, 77, 78, 99 ], [ 0, 16, 16, 36, 36, 54, 54, 74, 74, 95 ] ], [ [ 0, 17, 18, 37, 38, 56, 57, 77, 78, 99 ], [ 0, 17, 17, 36, 36, 54, 54, 74, 74, 95 ] ], [ [ 0, 18, 19, 37, 38, 56, 57, 77, 78, 99 ], [ 0, 18, 18, 36, 36, 54, 54, 74, 74, 95 ] ], [ [ 0, 19, 20, 37, 38, 56, 57, 77, 78, 99 ], [ 0, 19, 19, 36, 36, 54, 54, 74, 74, 95 ] ], [ [ 0, 16, 17, 38, 39, 56, 57, 77, 78, 99 ], [ 0, 16, 16, 37, 37, 54, 54, 74, 74, 95 ] ], [ [ 0, 17, 18, 38, 39, 56, 57, 77, 78, 99 ], [ 0, 17, 17, 37, 37, 54, 54, 74, 74, 95 ] ], [ [ 0, 18, 19, 38, 39, 56, 57, 77, 78, 99 ], [ 0, 18, 18, 37, 37, 54, 54, 74, 74, 95 ] ], [ [ 0, 19, 20, 38, 39, 56, 57, 77, 78, 99 ], [ 0, 19, 19, 37, 37, 54, 54, 74, 74, 95 ] ], [ [ 0, 16, 17, 39, 40, 56, 57, 77, 78, 99 ], [ 0, 16, 16, 38, 38, 54, 54, 74, 74, 95 ] ], [ [ 0, 17, 18, 39, 40, 56, 57, 77, 78, 99 ], [ 0, 17, 17, 38, 38, 54, 54, 74, 74, 95 ] ], [ [ 0, 18, 19, 39, 40, 56, 57, 77, 78, 99 ], [ 0, 18, 18, 38, 38, 54, 54, 74, 74, 95 ] ], [ [ 0, 19, 20, 39, 40, 56, 57, 77, 78, 99 ], [ 0, 19, 19, 38, 38, 54, 54, 74, 74, 95 ] ], [ [ 0, 16, 17, 36, 37, 57, 58, 77, 78, 99 ], [ 0, 16, 16, 35, 35, 55, 55, 74, 74, 95 ] ], [ [ 0, 17, 18, 36, 37, 57, 58, 77, 78, 99 ], [ 0, 17, 17, 35, 35, 55, 55, 74, 74, 95 ] ], [ [ 0, 18, 19, 36, 37, 57, 58, 77, 78, 99 ], [ 0, 18, 18, 35, 35, 55, 55, 74, 74, 95 ] ], [ [ 0, 19, 20, 36, 37, 57, 58, 77, 78, 99 ], [ 0, 19, 19, 35, 35, 55, 55, 74, 74, 95 ] ], [ [ 0, 16, 17, 37, 38, 57, 58, 77, 78, 99 ], [ 0, 16, 16, 36, 36, 55, 55, 74, 74, 95 ] ], [ [ 0, 17, 18, 37, 38, 57, 58, 77, 78, 99 ], [ 0, 17, 17, 36, 36, 55, 55, 74, 74, 95 ] ], [ [ 0, 18, 19, 37, 38, 57, 58, 77, 78, 99 ], [ 0, 18, 18, 36, 36, 55, 55, 74, 74, 95 ] ], [ [ 0, 19, 20, 37, 38, 57, 58, 77, 78, 99 ], [ 0, 19, 19, 36, 36, 55, 55, 74, 74, 95 ] ], [ [ 0, 16, 17, 38, 39, 57, 58, 77, 78, 99 ], [ 0, 16, 16, 37, 37, 55, 55, 74, 74, 95 ] ], [ [ 0, 17, 18, 38, 39, 57, 58, 77, 78, 99 ], [ 0, 17, 17, 37, 37, 55, 55, 74, 74, 95 ] ], [ [ 0, 18, 19, 38, 39, 57, 58, 77, 78, 99 ], [ 0, 18, 18, 37, 37, 55, 55, 74, 74, 95 ] ], [ [ 0, 19, 20, 38, 39, 57, 58, 77, 78, 99 ], [ 0, 19, 19, 37, 37, 55, 55, 74, 74, 95 ] ], [ [ 0, 16, 17, 39, 40, 57, 58, 77, 78, 99 ], [ 0, 16, 16, 38, 38, 55, 55, 74, 74, 95 ] ], [ [ 0, 17, 18, 39, 40, 57, 58, 77, 78, 99 ], [ 0, 17, 17, 38, 38, 55, 55, 74, 74, 95 ] ], [ [ 0, 18, 19, 39, 40, 57, 58, 77, 78, 99 ], [ 0, 18, 18, 38, 38, 55, 55, 74, 74, 95 ] ], [ [ 0, 19, 20, 39, 40, 57, 58, 77, 78, 99 ], [ 0, 19, 19, 38, 38, 55, 55, 74, 74, 95 ] ], [ [ 0, 16, 17, 36, 37, 58, 59, 77, 78, 99 ], [ 0, 16, 16, 35, 35, 56, 56, 74, 74, 95 ] ], [ [ 0, 17, 18, 36, 37, 58, 59, 77, 78, 99 ], [ 0, 17, 17, 35, 35, 56, 56, 74, 74, 95 ] ], [ [ 0, 18, 19, 36, 37, 58, 59, 77, 78, 99 ], [ 0, 18, 18, 35, 35, 56, 56, 74, 74, 95 ] ], [ [ 0, 19, 20, 36, 37, 58, 59, 77, 78, 99 ], [ 0, 19, 19, 35, 35, 56, 56, 74, 74, 95 ] ], [ [ 0, 16, 17, 37, 38, 58, 59, 77, 78, 99 ], [ 0, 16, 16, 36, 36, 56, 56, 74, 74, 95 ] ], [ [ 0, 17, 18, 37, 38, 58, 59, 77, 78, 99 ], [ 0, 17, 17, 36, 36, 56, 56, 74, 74, 95 ] ], [ [ 0, 18, 19, 37, 38, 58, 59, 77, 78, 99 ], [ 0, 18, 18, 36, 36, 56, 56, 74, 74, 95 ] ], [ [ 0, 19, 20, 37, 38, 58, 59, 77, 78, 99 ], [ 0, 19, 19, 36, 36, 56, 56, 74, 74, 95 ] ], [ [ 0, 16, 17, 38, 39, 58, 59, 77, 78, 99 ], [ 0, 16, 16, 37, 37, 56, 56, 74, 74, 95 ] ], [ [ 0, 17, 18, 38, 39, 58, 59, 77, 78, 99 ], [ 0, 17, 17, 37, 37, 56, 56, 74, 74, 95 ] ], [ [ 0, 18, 19, 38, 39, 58, 59, 77, 78, 99 ], [ 0, 18, 18, 37, 37, 56, 56, 74, 74, 95 ] ], [ [ 0, 19, 20, 38, 39, 58, 59, 77, 78, 99 ], [ 0, 19, 19, 37, 37, 56, 56, 74, 74, 95 ] ], [ [ 0, 16, 17, 39, 40, 58, 59, 77, 78, 99 ], [ 0, 16, 16, 38, 38, 56, 56, 74, 74, 95 ] ], [ [ 0, 17, 18, 39, 40, 58, 59, 77, 78, 99 ], [ 0, 17, 17, 38, 38, 56, 56, 74, 74, 95 ] ], [ [ 0, 18, 19, 39, 40, 58, 59, 77, 78, 99 ], [ 0, 18, 18, 38, 38, 56, 56, 74, 74, 95 ] ], [ [ 0, 19, 20, 39, 40, 58, 59, 77, 78, 99 ], [ 0, 19, 19, 38, 38, 56, 56, 74, 74, 95 ] ], [ [ 0, 16, 17, 36, 37, 59, 60, 77, 78, 99 ], [ 0, 16, 16, 35, 35, 57, 57, 74, 74, 95 ] ], [ [ 0, 17, 18, 36, 37, 59, 60, 77, 78, 99 ], [ 0, 17, 17, 35, 35, 57, 57, 74, 74, 95 ] ], [ [ 0, 18, 19, 36, 37, 59, 60, 77, 78, 99 ], [ 0, 18, 18, 35, 35, 57, 57, 74, 74, 95 ] ], [ [ 0, 19, 20, 36, 37, 59, 60, 77, 78, 99 ], [ 0, 19, 19, 35, 35, 57, 57, 74, 74, 95 ] ], [ [ 0, 16, 17, 37, 38, 59, 60, 77, 78, 99 ], [ 0, 16, 16, 36, 36, 57, 57, 74, 74, 95 ] ], [ [ 0, 17, 18, 37, 38, 59, 60, 77, 78, 99 ], [ 0, 17, 17, 36, 36, 57, 57, 74, 74, 95 ] ], [ [ 0, 18, 19, 37, 38, 59, 60, 77, 78, 99 ], [ 0, 18, 18, 36, 36, 57, 57, 74, 74, 95 ] ], [ [ 0, 19, 20, 37, 38, 59, 60, 77, 78, 99 ], [ 0, 19, 19, 36, 36, 57, 57, 74, 74, 95 ] ], [ [ 0, 16, 17, 38, 39, 59, 60, 77, 78, 99 ], [ 0, 16, 16, 37, 37, 57, 57, 74, 74, 95 ] ], [ [ 0, 17, 18, 38, 39, 59, 60, 77, 78, 99 ], [ 0, 17, 17, 37, 37, 57, 57, 74, 74, 95 ] ], [ [ 0, 18, 19, 38, 39, 59, 60, 77, 78, 99 ], [ 0, 18, 18, 37, 37, 57, 57, 74, 74, 95 ] ], [ [ 0, 19, 20, 38, 39, 59, 60, 77, 78, 99 ], [ 0, 19, 19, 37, 37, 57, 57, 74, 74, 95 ] ], [ [ 0, 16, 17, 39, 40, 59, 60, 77, 78, 99 ], [ 0, 16, 16, 38, 38, 57, 57, 74, 74, 95 ] ], [ [ 0, 17, 18, 39, 40, 59, 60, 77, 78, 99 ], [ 0, 17, 17, 38, 38, 57, 57, 74, 74, 95 ] ], [ [ 0, 18, 19, 39, 40, 59, 60, 77, 78, 99 ], [ 0, 18, 18, 38, 38, 57, 57, 74, 74, 95 ] ], [ [ 0, 19, 20, 39, 40, 59, 60, 77, 78, 99 ], [ 0, 19, 19, 38, 38, 57, 57, 74, 74, 95 ] ], [ [ 0, 16, 17, 36, 37, 56, 57, 78, 79, 99 ], [ 0, 16, 16, 35, 35, 54, 54, 75, 75, 95 ] ], [ [ 0, 17, 18, 36, 37, 56, 57, 78, 79, 99 ], [ 0, 17, 17, 35, 35, 54, 54, 75, 75, 95 ] ], [ [ 0, 18, 19, 36, 37, 56, 57, 78, 79, 99 ], [ 0, 18, 18, 35, 35, 54, 54, 75, 75, 95 ] ], [ [ 0, 19, 20, 36, 37, 56, 57, 78, 79, 99 ], [ 0, 19, 19, 35, 35, 54, 54, 75, 75, 95 ] ], [ [ 0, 16, 17, 37, 38, 56, 57, 78, 79, 99 ], [ 0, 16, 16, 36, 36, 54, 54, 75, 75, 95 ] ], [ [ 0, 17, 18, 37, 38, 56, 57, 78, 79, 99 ], [ 0, 17, 17, 36, 36, 54, 54, 75, 75, 95 ] ], [ [ 0, 18, 19, 37, 38, 56, 57, 78, 79, 99 ], [ 0, 18, 18, 36, 36, 54, 54, 75, 75, 95 ] ], [ [ 0, 19, 20, 37, 38, 56, 57, 78, 79, 99 ], [ 0, 19, 19, 36, 36, 54, 54, 75, 75, 95 ] ], [ [ 0, 16, 17, 38, 39, 56, 57, 78, 79, 99 ], [ 0, 16, 16, 37, 37, 54, 54, 75, 75, 95 ] ], [ [ 0, 17, 18, 38, 39, 56, 57, 78, 79, 99 ], [ 0, 17, 17, 37, 37, 54, 54, 75, 75, 95 ] ], [ [ 0, 18, 19, 38, 39, 56, 57, 78, 79, 99 ], [ 0, 18, 18, 37, 37, 54, 54, 75, 75, 95 ] ], [ [ 0, 19, 20, 38, 39, 56, 57, 78, 79, 99 ], [ 0, 19, 19, 37, 37, 54, 54, 75, 75, 95 ] ], [ [ 0, 16, 17, 39, 40, 56, 57, 78, 79, 99 ], [ 0, 16, 16, 38, 38, 54, 54, 75, 75, 95 ] ], [ [ 0, 17, 18, 39, 40, 56, 57, 78, 79, 99 ], [ 0, 17, 17, 38, 38, 54, 54, 75, 75, 95 ] ], [ [ 0, 18, 19, 39, 40, 56, 57, 78, 79, 99 ], [ 0, 18, 18, 38, 38, 54, 54, 75, 75, 95 ] ], [ [ 0, 19, 20, 39, 40, 56, 57, 78, 79, 99 ], [ 0, 19, 19, 38, 38, 54, 54, 75, 75, 95 ] ], [ [ 0, 16, 17, 36, 37, 57, 58, 78, 79, 99 ], [ 0, 16, 16, 35, 35, 55, 55, 75, 75, 95 ] ], [ [ 0, 17, 18, 36, 37, 57, 58, 78, 79, 99 ], [ 0, 17, 17, 35, 35, 55, 55, 75, 75, 95 ] ], [ [ 0, 18, 19, 36, 37, 57, 58, 78, 79, 99 ], [ 0, 18, 18, 35, 35, 55, 55, 75, 75, 95 ] ], [ [ 0, 19, 20, 36, 37, 57, 58, 78, 79, 99 ], [ 0, 19, 19, 35, 35, 55, 55, 75, 75, 95 ] ], [ [ 0, 16, 17, 37, 38, 57, 58, 78, 79, 99 ], [ 0, 16, 16, 36, 36, 55, 55, 75, 75, 95 ] ], [ [ 0, 17, 18, 37, 38, 57, 58, 78, 79, 99 ], [ 0, 17, 17, 36, 36, 55, 55, 75, 75, 95 ] ], [ [ 0, 18, 19, 37, 38, 57, 58, 78, 79, 99 ], [ 0, 18, 18, 36, 36, 55, 55, 75, 75, 95 ] ], [ [ 0, 19, 20, 37, 38, 57, 58, 78, 79, 99 ], [ 0, 19, 19, 36, 36, 55, 55, 75, 75, 95 ] ], [ [ 0, 16, 17, 38, 39, 57, 58, 78, 79, 99 ], [ 0, 16, 16, 37, 37, 55, 55, 75, 75, 95 ] ], [ [ 0, 17, 18, 38, 39, 57, 58, 78, 79, 99 ], [ 0, 17, 17, 37, 37, 55, 55, 75, 75, 95 ] ], [ [ 0, 18, 19, 38, 39, 57, 58, 78, 79, 99 ], [ 0, 18, 18, 37, 37, 55, 55, 75, 75, 95 ] ], [ [ 0, 19, 20, 38, 39, 57, 58, 78, 79, 99 ], [ 0, 19, 19, 37, 37, 55, 55, 75, 75, 95 ] ], [ [ 0, 16, 17, 39, 40, 57, 58, 78, 79, 99 ], [ 0, 16, 16, 38, 38, 55, 55, 75, 75, 95 ] ], [ [ 0, 17, 18, 39, 40, 57, 58, 78, 79, 99 ], [ 0, 17, 17, 38, 38, 55, 55, 75, 75, 95 ] ], [ [ 0, 18, 19, 39, 40, 57, 58, 78, 79, 99 ], [ 0, 18, 18, 38, 38, 55, 55, 75, 75, 95 ] ], [ [ 0, 19, 20, 39, 40, 57, 58, 78, 79, 99 ], [ 0, 19, 19, 38, 38, 55, 55, 75, 75, 95 ] ], [ [ 0, 16, 17, 36, 37, 58, 59, 78, 79, 99 ], [ 0, 16, 16, 35, 35, 56, 56, 75, 75, 95 ] ], [ [ 0, 17, 18, 36, 37, 58, 59, 78, 79, 99 ], [ 0, 17, 17, 35, 35, 56, 56, 75, 75, 95 ] ], [ [ 0, 18, 19, 36, 37, 58, 59, 78, 79, 99 ], [ 0, 18, 18, 35, 35, 56, 56, 75, 75, 95 ] ], [ [ 0, 19, 20, 36, 37, 58, 59, 78, 79, 99 ], [ 0, 19, 19, 35, 35, 56, 56, 75, 75, 95 ] ], [ [ 0, 16, 17, 37, 38, 58, 59, 78, 79, 99 ], [ 0, 16, 16, 36, 36, 56, 56, 75, 75, 95 ] ], [ [ 0, 17, 18, 37, 38, 58, 59, 78, 79, 99 ], [ 0, 17, 17, 36, 36, 56, 56, 75, 75, 95 ] ], [ [ 0, 18, 19, 37, 38, 58, 59, 78, 79, 99 ], [ 0, 18, 18, 36, 36, 56, 56, 75, 75, 95 ] ], [ [ 0, 19, 20, 37, 38, 58, 59, 78, 79, 99 ], [ 0, 19, 19, 36, 36, 56, 56, 75, 75, 95 ] ], [ [ 0, 16, 17, 38, 39, 58, 59, 78, 79, 99 ], [ 0, 16, 16, 37, 37, 56, 56, 75, 75, 95 ] ], [ [ 0, 17, 18, 38, 39, 58, 59, 78, 79, 99 ], [ 0, 17, 17, 37, 37, 56, 56, 75, 75, 95 ] ], [ [ 0, 18, 19, 38, 39, 58, 59, 78, 79, 99 ], [ 0, 18, 18, 37, 37, 56, 56, 75, 75, 95 ] ], [ [ 0, 19, 20, 38, 39, 58, 59, 78, 79, 99 ], [ 0, 19, 19, 37, 37, 56, 56, 75, 75, 95 ] ], [ [ 0, 16, 17, 39, 40, 58, 59, 78, 79, 99 ], [ 0, 16, 16, 38, 38, 56, 56, 75, 75, 95 ] ], [ [ 0, 17, 18, 39, 40, 58, 59, 78, 79, 99 ], [ 0, 17, 17, 38, 38, 56, 56, 75, 75, 95 ] ], [ [ 0, 18, 19, 39, 40, 58, 59, 78, 79, 99 ], [ 0, 18, 18, 38, 38, 56, 56, 75, 75, 95 ] ], [ [ 0, 19, 20, 39, 40, 58, 59, 78, 79, 99 ], [ 0, 19, 19, 38, 38, 56, 56, 75, 75, 95 ] ], [ [ 0, 16, 17, 36, 37, 59, 60, 78, 79, 99 ], [ 0, 16, 16, 35, 35, 57, 57, 75, 75, 95 ] ], [ [ 0, 17, 18, 36, 37, 59, 60, 78, 79, 99 ], [ 0, 17, 17, 35, 35, 57, 57, 75, 75, 95 ] ], [ [ 0, 18, 19, 36, 37, 59, 60, 78, 79, 99 ], [ 0, 18, 18, 35, 35, 57, 57, 75, 75, 95 ] ], [ [ 0, 19, 20, 36, 37, 59, 60, 78, 79, 99 ], [ 0, 19, 19, 35, 35, 57, 57, 75, 75, 95 ] ], [ [ 0, 16, 17, 37, 38, 59, 60, 78, 79, 99 ], [ 0, 16, 16, 36, 36, 57, 57, 75, 75, 95 ] ], [ [ 0, 17, 18, 37, 38, 59, 60, 78, 79, 99 ], [ 0, 17, 17, 36, 36, 57, 57, 75, 75, 95 ] ], [ [ 0, 18, 19, 37, 38, 59, 60, 78, 79, 99 ], [ 0, 18, 18, 36, 36, 57, 57, 75, 75, 95 ] ], [ [ 0, 19, 20, 37, 38, 59, 60, 78, 79, 99 ], [ 0, 19, 19, 36, 36, 57, 57, 75, 75, 95 ] ], [ [ 0, 16, 17, 38, 39, 59, 60, 78, 79, 99 ], [ 0, 16, 16, 37, 37, 57, 57, 75, 75, 95 ] ], [ [ 0, 17, 18, 38, 39, 59, 60, 78, 79, 99 ], [ 0, 17, 17, 37, 37, 57, 57, 75, 75, 95 ] ], [ [ 0, 18, 19, 38, 39, 59, 60, 78, 79, 99 ], [ 0, 18, 18, 37, 37, 57, 57, 75, 75, 95 ] ], [ [ 0, 19, 20, 38, 39, 59, 60, 78, 79, 99 ], [ 0, 19, 19, 37, 37, 57, 57, 75, 75, 95 ] ], [ [ 0, 16, 17, 39, 40, 59, 60, 78, 79, 99 ], [ 0, 16, 16, 38, 38, 57, 57, 75, 75, 95 ] ], [ [ 0, 17, 18, 39, 40, 59, 60, 78, 79, 99 ], [ 0, 17, 17, 38, 38, 57, 57, 75, 75, 95 ] ], [ [ 0, 18, 19, 39, 40, 59, 60, 78, 79, 99 ], [ 0, 18, 18, 38, 38, 57, 57, 75, 75, 95 ] ], [ [ 0, 19, 20, 39, 40, 59, 60, 78, 79, 99 ], [ 0, 19, 19, 38, 38, 57, 57, 75, 75, 95 ] ], [ [ 0, 16, 17, 36, 37, 56, 57, 79, 80, 99 ], [ 0, 16, 16, 35, 35, 54, 54, 76, 76, 95 ] ], [ [ 0, 17, 18, 36, 37, 56, 57, 79, 80, 99 ], [ 0, 17, 17, 35, 35, 54, 54, 76, 76, 95 ] ], [ [ 0, 18, 19, 36, 37, 56, 57, 79, 80, 99 ], [ 0, 18, 18, 35, 35, 54, 54, 76, 76, 95 ] ], [ [ 0, 19, 20, 36, 37, 56, 57, 79, 80, 99 ], [ 0, 19, 19, 35, 35, 54, 54, 76, 76, 95 ] ], [ [ 0, 16, 17, 37, 38, 56, 57, 79, 80, 99 ], [ 0, 16, 16, 36, 36, 54, 54, 76, 76, 95 ] ], [ [ 0, 17, 18, 37, 38, 56, 57, 79, 80, 99 ], [ 0, 17, 17, 36, 36, 54, 54, 76, 76, 95 ] ], [ [ 0, 18, 19, 37, 38, 56, 57, 79, 80, 99 ], [ 0, 18, 18, 36, 36, 54, 54, 76, 76, 95 ] ], [ [ 0, 19, 20, 37, 38, 56, 57, 79, 80, 99 ], [ 0, 19, 19, 36, 36, 54, 54, 76, 76, 95 ] ], [ [ 0, 16, 17, 38, 39, 56, 57, 79, 80, 99 ], [ 0, 16, 16, 37, 37, 54, 54, 76, 76, 95 ] ], [ [ 0, 17, 18, 38, 39, 56, 57, 79, 80, 99 ], [ 0, 17, 17, 37, 37, 54, 54, 76, 76, 95 ] ], [ [ 0, 18, 19, 38, 39, 56, 57, 79, 80, 99 ], [ 0, 18, 18, 37, 37, 54, 54, 76, 76, 95 ] ], [ [ 0, 19, 20, 38, 39, 56, 57, 79, 80, 99 ], [ 0, 19, 19, 37, 37, 54, 54, 76, 76, 95 ] ], [ [ 0, 16, 17, 39, 40, 56, 57, 79, 80, 99 ], [ 0, 16, 16, 38, 38, 54, 54, 76, 76, 95 ] ], [ [ 0, 17, 18, 39, 40, 56, 57, 79, 80, 99 ], [ 0, 17, 17, 38, 38, 54, 54, 76, 76, 95 ] ], [ [ 0, 18, 19, 39, 40, 56, 57, 79, 80, 99 ], [ 0, 18, 18, 38, 38, 54, 54, 76, 76, 95 ] ], [ [ 0, 19, 20, 39, 40, 56, 57, 79, 80, 99 ], [ 0, 19, 19, 38, 38, 54, 54, 76, 76, 95 ] ], [ [ 0, 16, 17, 36, 37, 57, 58, 79, 80, 99 ], [ 0, 16, 16, 35, 35, 55, 55, 76, 76, 95 ] ], [ [ 0, 17, 18, 36, 37, 57, 58, 79, 80, 99 ], [ 0, 17, 17, 35, 35, 55, 55, 76, 76, 95 ] ], [ [ 0, 18, 19, 36, 37, 57, 58, 79, 80, 99 ], [ 0, 18, 18, 35, 35, 55, 55, 76, 76, 95 ] ], [ [ 0, 19, 20, 36, 37, 57, 58, 79, 80, 99 ], [ 0, 19, 19, 35, 35, 55, 55, 76, 76, 95 ] ], [ [ 0, 16, 17, 37, 38, 57, 58, 79, 80, 99 ], [ 0, 16, 16, 36, 36, 55, 55, 76, 76, 95 ] ], [ [ 0, 17, 18, 37, 38, 57, 58, 79, 80, 99 ], [ 0, 17, 17, 36, 36, 55, 55, 76, 76, 95 ] ], [ [ 0, 18, 19, 37, 38, 57, 58, 79, 80, 99 ], [ 0, 18, 18, 36, 36, 55, 55, 76, 76, 95 ] ], [ [ 0, 19, 20, 37, 38, 57, 58, 79, 80, 99 ], [ 0, 19, 19, 36, 36, 55, 55, 76, 76, 95 ] ], [ [ 0, 16, 17, 38, 39, 57, 58, 79, 80, 99 ], [ 0, 16, 16, 37, 37, 55, 55, 76, 76, 95 ] ], [ [ 0, 17, 18, 38, 39, 57, 58, 79, 80, 99 ], [ 0, 17, 17, 37, 37, 55, 55, 76, 76, 95 ] ], [ [ 0, 18, 19, 38, 39, 57, 58, 79, 80, 99 ], [ 0, 18, 18, 37, 37, 55, 55, 76, 76, 95 ] ], [ [ 0, 19, 20, 38, 39, 57, 58, 79, 80, 99 ], [ 0, 19, 19, 37, 37, 55, 55, 76, 76, 95 ] ], [ [ 0, 16, 17, 39, 40, 57, 58, 79, 80, 99 ], [ 0, 16, 16, 38, 38, 55, 55, 76, 76, 95 ] ], [ [ 0, 17, 18, 39, 40, 57, 58, 79, 80, 99 ], [ 0, 17, 17, 38, 38, 55, 55, 76, 76, 95 ] ], [ [ 0, 18, 19, 39, 40, 57, 58, 79, 80, 99 ], [ 0, 18, 18, 38, 38, 55, 55, 76, 76, 95 ] ], [ [ 0, 19, 20, 39, 40, 57, 58, 79, 80, 99 ], [ 0, 19, 19, 38, 38, 55, 55, 76, 76, 95 ] ], [ [ 0, 16, 17, 36, 37, 58, 59, 79, 80, 99 ], [ 0, 16, 16, 35, 35, 56, 56, 76, 76, 95 ] ], [ [ 0, 17, 18, 36, 37, 58, 59, 79, 80, 99 ], [ 0, 17, 17, 35, 35, 56, 56, 76, 76, 95 ] ], [ [ 0, 18, 19, 36, 37, 58, 59, 79, 80, 99 ], [ 0, 18, 18, 35, 35, 56, 56, 76, 76, 95 ] ], [ [ 0, 19, 20, 36, 37, 58, 59, 79, 80, 99 ], [ 0, 19, 19, 35, 35, 56, 56, 76, 76, 95 ] ], [ [ 0, 16, 17, 37, 38, 58, 59, 79, 80, 99 ], [ 0, 16, 16, 36, 36, 56, 56, 76, 76, 95 ] ], [ [ 0, 17, 18, 37, 38, 58, 59, 79, 80, 99 ], [ 0, 17, 17, 36, 36, 56, 56, 76, 76, 95 ] ], [ [ 0, 18, 19, 37, 38, 58, 59, 79, 80, 99 ], [ 0, 18, 18, 36, 36, 56, 56, 76, 76, 95 ] ], [ [ 0, 19, 20, 37, 38, 58, 59, 79, 80, 99 ], [ 0, 19, 19, 36, 36, 56, 56, 76, 76, 95 ] ], [ [ 0, 16, 17, 38, 39, 58, 59, 79, 80, 99 ], [ 0, 16, 16, 37, 37, 56, 56, 76, 76, 95 ] ], [ [ 0, 17, 18, 38, 39, 58, 59, 79, 80, 99 ], [ 0, 17, 17, 37, 37, 56, 56, 76, 76, 95 ] ], [ [ 0, 18, 19, 38, 39, 58, 59, 79, 80, 99 ], [ 0, 18, 18, 37, 37, 56, 56, 76, 76, 95 ] ], [ [ 0, 19, 20, 38, 39, 58, 59, 79, 80, 99 ], [ 0, 19, 19, 37, 37, 56, 56, 76, 76, 95 ] ], [ [ 0, 16, 17, 39, 40, 58, 59, 79, 80, 99 ], [ 0, 16, 16, 38, 38, 56, 56, 76, 76, 95 ] ], [ [ 0, 17, 18, 39, 40, 58, 59, 79, 80, 99 ], [ 0, 17, 17, 38, 38, 56, 56, 76, 76, 95 ] ], [ [ 0, 18, 19, 39, 40, 58, 59, 79, 80, 99 ], [ 0, 18, 18, 38, 38, 56, 56, 76, 76, 95 ] ], [ [ 0, 19, 20, 39, 40, 58, 59, 79, 80, 99 ], [ 0, 19, 19, 38, 38, 56, 56, 76, 76, 95 ] ], [ [ 0, 16, 17, 36, 37, 59, 60, 79, 80, 99 ], [ 0, 16, 16, 35, 35, 57, 57, 76, 76, 95 ] ], [ [ 0, 17, 18, 36, 37, 59, 60, 79, 80, 99 ], [ 0, 17, 17, 35, 35, 57, 57, 76, 76, 95 ] ], [ [ 0, 18, 19, 36, 37, 59, 60, 79, 80, 99 ], [ 0, 18, 18, 35, 35, 57, 57, 76, 76, 95 ] ], [ [ 0, 19, 20, 36, 37, 59, 60, 79, 80, 99 ], [ 0, 19, 19, 35, 35, 57, 57, 76, 76, 95 ] ], [ [ 0, 16, 17, 37, 38, 59, 60, 79, 80, 99 ], [ 0, 16, 16, 36, 36, 57, 57, 76, 76, 95 ] ], [ [ 0, 17, 18, 37, 38, 59, 60, 79, 80, 99 ], [ 0, 17, 17, 36, 36, 57, 57, 76, 76, 95 ] ], [ [ 0, 18, 19, 37, 38, 59, 60, 79, 80, 99 ], [ 0, 18, 18, 36, 36, 57, 57, 76, 76, 95 ] ], [ [ 0, 19, 20, 37, 38, 59, 60, 79, 80, 99 ], [ 0, 19, 19, 36, 36, 57, 57, 76, 76, 95 ] ], [ [ 0, 16, 17, 38, 39, 59, 60, 79, 80, 99 ], [ 0, 16, 16, 37, 37, 57, 57, 76, 76, 95 ] ], [ [ 0, 17, 18, 38, 39, 59, 60, 79, 80, 99 ], [ 0, 17, 17, 37, 37, 57, 57, 76, 76, 95 ] ], [ [ 0, 18, 19, 38, 39, 59, 60, 79, 80, 99 ], [ 0, 18, 18, 37, 37, 57, 57, 76, 76, 95 ] ], [ [ 0, 19, 20, 38, 39, 59, 60, 79, 80, 99 ], [ 0, 19, 19, 37, 37, 57, 57, 76, 76, 95 ] ], [ [ 0, 16, 17, 39, 40, 59, 60, 79, 80, 99 ], [ 0, 16, 16, 38, 38, 57, 57, 76, 76, 95 ] ], [ [ 0, 17, 18, 39, 40, 59, 60, 79, 80, 99 ], [ 0, 17, 17, 38, 38, 57, 57, 76, 76, 95 ] ], [ [ 0, 18, 19, 39, 40, 59, 60, 79, 80, 99 ], [ 0, 18, 18, 38, 38, 57, 57, 76, 76, 95 ] ], [ [ 0, 19, 20, 39, 40, 59, 60, 79, 80, 99 ], [ 0, 19, 19, 38, 38, 57, 57, 76, 76, 95 ] ] ], "tuples": [ [ 95, 0, 99, 0, 4, 4, 95, 99 ] ], "tupleFields": [ "identical", "ambiguousColumns", "columns", "mismatches", "gapColumns", "gapOpens", "readAligned", "referenceCovered" ], "variation": { "readAligned": { "shared": true, "min": 95, "max": 95 }, "referenceCovered": { "shared": true, "min": 99, "max": 99 }, "identity": { "shared": true, "min": { "numerator": 95, "denominator": 99 }, "max": { "numerator": 95, "denominator": 99 } }, "overhangStart": { "shared": true, "min": 0, "max": 0 }, "overhangEnd": { "shared": true, "min": 0, "max": 0 } }, "placements": [ { "refStart": 1, "refEnd": 99, "crossesOrigin": false, "wholeCircle": false, "readStart": 1, "readEnd": 95, "alignments": 256, "band": { "diagonalMin": 0, "diagonalMax": 4, "cellsNeeded": 692, "bandLimited": false } } ] }, "minus": { "score": 11, "count": 1, "overCap": false, "state": "aligned", "biopython": { "score": 11, "count": 3, "tailScore": 11, "tailCountSubtracted": 2, "certifiedText": { "extension": 98, "textLength": 298, "reruns": 0, "differencesUpTo": 92 } }, "uniquePairs": [ [ 44, 45 ], [ 45, 46 ], [ 46, 47 ], [ 47, 48 ], [ 48, 49 ], [ 49, 50 ], [ 50, 51 ], [ 51, 52 ], [ 52, 53 ], [ 53, 54 ], [ 54, 55 ], [ 55, 56 ], [ 56, 57 ] ], "uniquePlacement": true, "placementNotDetermined": false, "noCommonColumn": false, "hull": { "refStart": 44, "refEnd": 56, "crossesOrigin": false, "wholeCircle": false }, "selected": { "coordinates": [ [ 43, 56 ], [ 44, 57 ] ], "gappedReference": "CCTCCGCCGTAGG", "gappedRead": "CCTACGGCGGAGG", "columns": 13, "identical": 10, "mismatches": 3, "ambiguousColumns": 0, "gapColumns": 0, "gapOpens": 0, "identity": { "numerator": 10, "denominator": 13 }, "readAligned": { "bases": 13, "of": 98 }, "referenceCovered": { "bases": 13, "of": 103 }, "placement": { "refStart": 44, "refEnd": 56, "readStart": 45, "readEnd": 57, "crossesOrigin": false, "asSupplied": { "readStart": 42, "readEnd": 54 } }, "overhang": [], "differences": [ { "kind": "substitution", "ref": 47, "refBase": "C", "readBase": "A", "read": 48, "common": true, "asSupplied": { "read": 51, "readBase": "T" } }, { "kind": "substitution", "ref": 50, "refBase": "C", "readBase": "G", "read": 51, "common": true, "asSupplied": { "read": 48, "readBase": "C" } }, { "kind": "substitution", "ref": 53, "refBase": "T", "readBase": "G", "read": 54, "common": true, "asSupplied": { "read": 45, "readBase": "C" } } ] }, "band": { "diagonalMin": -1, "diagonalMax": -1, "cellsNeeded": 294, "unionBandLimited": false, "scope": "every optimal path", "gridCells": 29601, "searchedBanded": true, "sharedWords": 0, "sharedWordsOverCap": false, "seedGuarantee": { "differencesUpTo": 92, "guaranteed": false } }, "enumeration": "listed", "alignments": [ [ [ 43, 56 ], [ 44, 57 ] ] ], "tuples": [ [ 10, 0, 13, 3, 0, 0, 13, 13 ] ], "tupleFields": [ "identical", "ambiguousColumns", "columns", "mismatches", "gapColumns", "gapOpens", "readAligned", "referenceCovered" ], "variation": { "readAligned": { "shared": true, "min": 13, "max": 13 }, "referenceCovered": { "shared": true, "min": 13, "max": 13 }, "identity": { "shared": true, "min": { "numerator": 10, "denominator": 13 }, "max": { "numerator": 10, "denominator": 13 } }, "overhangStart": { "shared": true, "min": 0, "max": 0 }, "overhangEnd": { "shared": true, "min": 0, "max": 0 } }, "placements": [ { "refStart": 44, "refEnd": 56, "crossesOrigin": false, "wholeCircle": false, "readStart": 45, "readEnd": 57, "asSupplied": { "readStart": 42, "readEnd": 54 }, "alignments": 1, "band": { "diagonalMin": -1, "diagonalMax": -1, "cellsNeeded": 294, "bandLimited": false } } ] } } ] } }, { "id": "two-placements-origin", "note": "F3: a 20-base word present twice on a circle of 90, once split by the origin: two placements, one crossing the origin, and no wrap.", "input": { "reference": { "residues": "AATACCCGTGGTGGTACACCGCGGAGTACAACTGATCTTCGGAACTCGGTAATACCCGTGGTTGAAGGGACTCGAAGCAGGGAACTCGGT", "topology": "circular", "source": "literal, 90 bases" }, "read": { "residues": "GGAACTCGGTAATACCCGTG" }, "modes": [ "semiglobal-read", "local" ] }, "expected": { "results": [ { "mode": "semiglobal-read", "region": null, "strand": "+", "strandUndetermined": false, "plus": { "score": 40, "count": 2, "overCap": false, "state": "aligned", "biopython": { "score": 40, "count": 2, "tailScore": -3, "tailCountSubtracted": 0, "certifiedText": { "extension": 20, "textLength": 129, "reruns": 0, "differencesUpTo": 0 } }, "uniquePairs": [], "uniquePlacement": false, "placementNotDetermined": false, "noCommonColumn": false, "hull": { "refStart": 41, "refEnd": 10, "crossesOrigin": true, "wholeCircle": false }, "selected": { "coordinates": [ [ 0, 40, 60 ], [ 0, 0, 20 ] ], "gappedReference": "GGAACTCGGTAATACCCGTG", "gappedRead": "GGAACTCGGTAATACCCGTG", "columns": 20, "identical": 20, "mismatches": 0, "ambiguousColumns": 0, "gapColumns": 0, "gapOpens": 0, "identity": { "numerator": 20, "denominator": 20 }, "readAligned": { "bases": 20, "of": 20 }, "referenceCovered": { "bases": 20, "of": 90 }, "placement": { "refStart": 41, "refEnd": 60, "readStart": 1, "readEnd": 20, "crossesOrigin": false }, "overhang": [], "differences": [] }, "band": { "diagonalMin": 40, "diagonalMax": 80, "cellsNeeded": 903, "unionBandLimited": false, "scope": "every optimal path", "gridCells": 2730, "searchedBanded": false, "sharedWords": 18, "sharedWordsOverCap": false, "seedGuarantee": { "differencesUpTo": 0, "guaranteed": true } }, "enumeration": "listed", "alignments": [ [ [ 0, 40, 60 ], [ 0, 0, 20 ] ], [ [ 0, 80, 100 ], [ 0, 0, 20 ] ] ], "tuples": [ [ 20, 0, 20, 0, 0, 0, 20, 20 ] ], "tupleFields": [ "identical", "ambiguousColumns", "columns", "mismatches", "gapColumns", "gapOpens", "readAligned", "referenceCovered" ], "variation": { "readAligned": { "shared": true, "min": 20, "max": 20 }, "referenceCovered": { "shared": true, "min": 20, "max": 20 }, "identity": { "shared": true, "min": { "numerator": 1, "denominator": 1 }, "max": { "numerator": 1, "denominator": 1 } }, "overhangStart": { "shared": true, "min": 0, "max": 0 }, "overhangEnd": { "shared": true, "min": 0, "max": 0 } }, "placements": [ { "refStart": 41, "refEnd": 60, "crossesOrigin": false, "wholeCircle": false, "readStart": 1, "readEnd": 20, "alignments": 1, "band": { "diagonalMin": 40, "diagonalMax": 40, "cellsNeeded": 63, "bandLimited": false } }, { "refStart": 81, "refEnd": 10, "crossesOrigin": true, "wholeCircle": false, "readStart": 1, "readEnd": 20, "alignments": 1, "band": { "diagonalMin": 80, "diagonalMax": 80, "cellsNeeded": 63, "bandLimited": false } } ] }, "minus": { "score": 0, "count": 3, "overCap": false, "state": "aligned", "biopython": { "score": 0, "count": 3, "tailScore": -1, "tailCountSubtracted": 0, "certifiedText": { "extension": 20, "textLength": 129, "reruns": 0, "differencesUpTo": 20 } }, "uniquePairs": [ [ 20, 1 ], [ 21, 2 ], [ 22, 3 ], [ 23, 4 ], [ 24, 5 ], [ 26, 6 ], [ 27, 7 ], [ 28, 8 ], [ 29, 9 ], [ 30, 10 ], [ 31, 11 ], [ 32, 12 ], [ 33, 13 ], [ 34, 14 ], [ 35, 15 ] ], "uniquePlacement": true, "placementNotDetermined": false, "noCommonColumn": false, "hull": { "refStart": 20, "refEnd": 41, "crossesOrigin": false, "wholeCircle": false }, "selected": { "coordinates": [ [ 0, 19, 24, 25, 40 ], [ 0, 0, 5, 5, 20 ] ], "gappedReference": "CGCGGAGTACAACTGATCTTC", "gappedRead": "CACGG-GTATTACCGAGTTCC", "columns": 21, "identical": 13, "mismatches": 7, "ambiguousColumns": 0, "gapColumns": 1, "gapOpens": 1, "identity": { "numerator": 13, "denominator": 21 }, "readAligned": { "bases": 20, "of": 20 }, "referenceCovered": { "bases": 21, "of": 90 }, "placement": { "refStart": 20, "refEnd": 40, "readStart": 1, "readEnd": 20, "crossesOrigin": false, "asSupplied": { "readStart": 1, "readEnd": 20 } }, "overhang": [], "differences": [ { "kind": "substitution", "ref": 21, "refBase": "G", "readBase": "A", "read": 2, "common": true, "asSupplied": { "read": 19, "readBase": "T" } }, { "kind": "deletion", "refStart": 25, "refEnd": 25, "length": 1, "bases": "A", "readAfter": 5, "asSupplied": { "readBetween": [ 15, 16 ] }, "common": true }, { "kind": "substitution", "ref": 29, "refBase": "C", "readBase": "T", "read": 9, "common": true, "asSupplied": { "read": 12, "readBase": "A" } }, { "kind": "substitution", "ref": 30, "refBase": "A", "readBase": "T", "read": 10, "common": true, "asSupplied": { "read": 11, "readBase": "A" } }, { "kind": "substitution", "ref": 33, "refBase": "T", "readBase": "C", "read": 13, "common": true, "asSupplied": { "read": 8, "readBase": "G" } }, { "kind": "substitution", "ref": 36, "refBase": "T", "readBase": "G", "read": 16, "common": false, "notFixed": { "from": { "ref": 35, "read": 15, "readAsSupplied": 6 }, "to": null }, "asSupplied": { "read": 5, "readBase": "C" } }, { "kind": "substitution", "ref": 37, "refBase": "C", "readBase": "T", "read": 17, "common": false, "notFixed": { "from": { "ref": 35, "read": 15, "readAsSupplied": 6 }, "to": null }, "asSupplied": { "read": 4, "readBase": "A" } }, { "kind": "substitution", "ref": 39, "refBase": "T", "readBase": "C", "read": 19, "common": false, "notFixed": { "from": { "ref": 35, "read": 15, "readAsSupplied": 6 }, "to": null }, "asSupplied": { "read": 2, "readBase": "G" } } ] }, "band": { "diagonalMin": 19, "diagonalMax": 21, "cellsNeeded": 105, "unionBandLimited": false, "scope": "every optimal path", "gridCells": 2730, "searchedBanded": false, "sharedWords": 0, "sharedWordsOverCap": false, "seedGuarantee": { "differencesUpTo": 20, "guaranteed": false } }, "enumeration": "listed", "alignments": [ [ [ 0, 19, 24, 25, 40 ], [ 0, 0, 5, 5, 20 ] ], [ [ 0, 19, 24, 25, 35, 36, 41 ], [ 0, 0, 5, 5, 15, 15, 20 ] ], [ [ 0, 19, 24, 25, 36, 37, 41 ], [ 0, 0, 5, 5, 16, 16, 20 ] ] ], "tuples": [ [ 13, 0, 21, 7, 1, 1, 20, 21 ], [ 14, 0, 22, 6, 2, 2, 20, 22 ] ], "tupleFields": [ "identical", "ambiguousColumns", "columns", "mismatches", "gapColumns", "gapOpens", "readAligned", "referenceCovered" ], "variation": { "readAligned": { "shared": true, "min": 20, "max": 20 }, "referenceCovered": { "shared": false, "min": 21, "max": 22 }, "identity": { "shared": false, "min": { "numerator": 13, "denominator": 21 }, "max": { "numerator": 7, "denominator": 11 } }, "overhangStart": { "shared": true, "min": 0, "max": 0 }, "overhangEnd": { "shared": true, "min": 0, "max": 0 } }, "placements": [ { "refStart": 20, "refEnd": 41, "crossesOrigin": false, "wholeCircle": false, "readStart": 1, "readEnd": 20, "asSupplied": { "readStart": 1, "readEnd": 20 }, "alignments": 3, "band": { "diagonalMin": 19, "diagonalMax": 21, "cellsNeeded": 105, "bandLimited": false } } ] } }, { "mode": "local", "region": null, "strand": "+", "strandUndetermined": false, "plus": { "score": 40, "count": 2, "overCap": false, "state": "aligned", "biopython": { "score": 40, "count": 2, "tailScore": 20, "tailCountSubtracted": 0, "certifiedText": { "extension": 20, "textLength": 129, "reruns": 0, "differencesUpTo": 0 } }, "uniquePairs": [], "uniquePlacement": false, "placementNotDetermined": false, "noCommonColumn": false, "hull": { "refStart": 41, "refEnd": 10, "crossesOrigin": true, "wholeCircle": false }, "selected": { "coordinates": [ [ 40, 60 ], [ 0, 20 ] ], "gappedReference": "GGAACTCGGTAATACCCGTG", "gappedRead": "GGAACTCGGTAATACCCGTG", "columns": 20, "identical": 20, "mismatches": 0, "ambiguousColumns": 0, "gapColumns": 0, "gapOpens": 0, "identity": { "numerator": 20, "denominator": 20 }, "readAligned": { "bases": 20, "of": 20 }, "referenceCovered": { "bases": 20, "of": 90 }, "placement": { "refStart": 41, "refEnd": 60, "readStart": 1, "readEnd": 20, "crossesOrigin": false }, "overhang": [], "differences": [] }, "band": { "diagonalMin": 40, "diagonalMax": 80, "cellsNeeded": 903, "unionBandLimited": false, "scope": "every optimal path", "gridCells": 2730, "searchedBanded": false, "sharedWords": 18, "sharedWordsOverCap": false, "seedGuarantee": { "differencesUpTo": 0, "guaranteed": true } }, "enumeration": "listed", "alignments": [ [ [ 40, 60 ], [ 0, 20 ] ], [ [ 80, 100 ], [ 0, 20 ] ] ], "tuples": [ [ 20, 0, 20, 0, 0, 0, 20, 20 ] ], "tupleFields": [ "identical", "ambiguousColumns", "columns", "mismatches", "gapColumns", "gapOpens", "readAligned", "referenceCovered" ], "variation": { "readAligned": { "shared": true, "min": 20, "max": 20 }, "referenceCovered": { "shared": true, "min": 20, "max": 20 }, "identity": { "shared": true, "min": { "numerator": 1, "denominator": 1 }, "max": { "numerator": 1, "denominator": 1 } }, "overhangStart": { "shared": true, "min": 0, "max": 0 }, "overhangEnd": { "shared": true, "min": 0, "max": 0 } }, "placements": [ { "refStart": 41, "refEnd": 60, "crossesOrigin": false, "wholeCircle": false, "readStart": 1, "readEnd": 20, "alignments": 1, "band": { "diagonalMin": 40, "diagonalMax": 40, "cellsNeeded": 63, "bandLimited": false } }, { "refStart": 81, "refEnd": 10, "crossesOrigin": true, "wholeCircle": false, "readStart": 1, "readEnd": 20, "alignments": 1, "band": { "diagonalMin": 80, "diagonalMax": 80, "cellsNeeded": 63, "bandLimited": false } } ] }, "minus": { "score": 13, "count": 2, "overCap": false, "state": "aligned", "biopython": { "score": 13, "count": 2, "tailScore": 8, "tailCountSubtracted": 0, "certifiedText": { "extension": 20, "textLength": 129, "reruns": 0, "differencesUpTo": 13 } }, "uniquePairs": [], "uniquePlacement": false, "placementNotDetermined": false, "noCommonColumn": false, "hull": { "refStart": 48, "refEnd": 6, "crossesOrigin": true, "wholeCircle": false }, "selected": { "coordinates": [ [ 47, 56 ], [ 4, 13 ] ], "gappedReference": "GGTAATACC", "gappedRead": "GGTATTACC", "columns": 9, "identical": 8, "mismatches": 1, "ambiguousColumns": 0, "gapColumns": 0, "gapOpens": 0, "identity": { "numerator": 8, "denominator": 9 }, "readAligned": { "bases": 9, "of": 20 }, "referenceCovered": { "bases": 9, "of": 90 }, "placement": { "refStart": 48, "refEnd": 56, "readStart": 5, "readEnd": 13, "crossesOrigin": false, "asSupplied": { "readStart": 8, "readEnd": 16 } }, "overhang": [], "differences": [ { "kind": "substitution", "ref": 52, "refBase": "A", "readBase": "T", "read": 9, "common": false, "notFixed": { "from": null, "to": null }, "asSupplied": { "read": 12, "readBase": "A" } } ] }, "band": { "diagonalMin": 43, "diagonalMax": 83, "cellsNeeded": 903, "unionBandLimited": false, "scope": "every optimal path", "gridCells": 2730, "searchedBanded": false, "sharedWords": 0, "sharedWordsOverCap": false, "seedGuarantee": { "differencesUpTo": 13, "guaranteed": false } }, "enumeration": "listed", "alignments": [ [ [ 47, 56 ], [ 4, 13 ] ], [ [ 87, 96 ], [ 4, 13 ] ] ], "tuples": [ [ 8, 0, 9, 1, 0, 0, 9, 9 ] ], "tupleFields": [ "identical", "ambiguousColumns", "columns", "mismatches", "gapColumns", "gapOpens", "readAligned", "referenceCovered" ], "variation": { "readAligned": { "shared": true, "min": 9, "max": 9 }, "referenceCovered": { "shared": true, "min": 9, "max": 9 }, "identity": { "shared": true, "min": { "numerator": 8, "denominator": 9 }, "max": { "numerator": 8, "denominator": 9 } }, "overhangStart": { "shared": true, "min": 0, "max": 0 }, "overhangEnd": { "shared": true, "min": 0, "max": 0 } }, "placements": [ { "refStart": 48, "refEnd": 56, "crossesOrigin": false, "wholeCircle": false, "readStart": 5, "readEnd": 13, "asSupplied": { "readStart": 8, "readEnd": 16 }, "alignments": 1, "band": { "diagonalMin": 43, "diagonalMax": 43, "cellsNeeded": 63, "bandLimited": false } }, { "refStart": 88, "refEnd": 6, "crossesOrigin": true, "wholeCircle": false, "readStart": 5, "readEnd": 13, "asSupplied": { "readStart": 8, "readEnd": 16 }, "alignments": 1, "band": { "diagonalMin": 83, "diagonalMax": 83, "cellsNeeded": 63, "bandLimited": false } } ] } } ] } }, { "id": "strand-undetermined", "note": "The CSO's example: ACGA against ACGT scores 3 on both strands with each strand's placement unique and over the same bases (global and semiglobal-read): strand undetermined. Local scores 6 on both, over 1-3 and 2-4: ambiguous, not undetermined.", "input": { "reference": { "residues": "ACGT", "topology": "linear" }, "read": { "residues": "ACGA" }, "modes": [ "global", "semiglobal-read", "local" ] }, "expected": { "results": [ { "mode": "global", "region": null, "strand": "ambiguous", "strandUndetermined": true, "plus": { "score": 3, "count": 1, "overCap": false, "state": "aligned", "biopython": { "score": 3, "count": 1 }, "uniquePairs": [ [ 1, 1 ], [ 2, 2 ], [ 3, 3 ], [ 4, 4 ] ], "uniquePlacement": true, "placementNotDetermined": false, "noCommonColumn": false, "hull": { "refStart": 1, "refEnd": 4, "crossesOrigin": false, "wholeCircle": false }, "selected": { "coordinates": [ [ 0, 4 ], [ 0, 4 ] ], "gappedReference": "ACGT", "gappedRead": "ACGA", "columns": 4, "identical": 3, "mismatches": 1, "ambiguousColumns": 0, "gapColumns": 0, "gapOpens": 0, "identity": { "numerator": 3, "denominator": 4 }, "readAligned": { "bases": 4, "of": 4 }, "referenceCovered": { "bases": 4, "of": 4 }, "placement": { "refStart": 1, "refEnd": 4, "readStart": 1, "readEnd": 4, "crossesOrigin": false }, "overhang": [], "differences": [ { "kind": "substitution", "ref": 4, "refBase": "T", "readBase": "A", "read": 4, "common": true } ] }, "band": { "diagonalMin": 0, "diagonalMax": 0, "cellsNeeded": 13, "unionBandLimited": false, "scope": "every optimal path", "gridCells": 25, "searchedBanded": false, "sharedWords": 0, "sharedWordsOverCap": false, "seedGuarantee": { "differencesUpTo": 2, "guaranteed": false } }, "enumeration": "listed", "alignments": [ [ [ 0, 4 ], [ 0, 4 ] ] ], "tuples": [ [ 3, 0, 4, 1, 0, 0, 4, 4 ] ], "tupleFields": [ "identical", "ambiguousColumns", "columns", "mismatches", "gapColumns", "gapOpens", "readAligned", "referenceCovered" ], "variation": { "readAligned": { "shared": true, "min": 4, "max": 4 }, "referenceCovered": { "shared": true, "min": 4, "max": 4 }, "identity": { "shared": true, "min": { "numerator": 3, "denominator": 4 }, "max": { "numerator": 3, "denominator": 4 } }, "overhangStart": { "shared": true, "min": 0, "max": 0 }, "overhangEnd": { "shared": true, "min": 0, "max": 0 } }, "placements": [ { "refStart": 1, "refEnd": 4, "crossesOrigin": false, "wholeCircle": false, "readStart": 1, "readEnd": 4, "alignments": 1, "band": { "diagonalMin": 0, "diagonalMax": 0, "cellsNeeded": 13, "bandLimited": false } } ] }, "minus": { "score": 3, "count": 1, "overCap": false, "state": "aligned", "biopython": { "score": 3, "count": 1 }, "uniquePairs": [ [ 1, 1 ], [ 2, 2 ], [ 3, 3 ], [ 4, 4 ] ], "uniquePlacement": true, "placementNotDetermined": false, "noCommonColumn": false, "hull": { "refStart": 1, "refEnd": 4, "crossesOrigin": false, "wholeCircle": false }, "selected": { "coordinates": [ [ 0, 4 ], [ 0, 4 ] ], "gappedReference": "ACGT", "gappedRead": "TCGT", "columns": 4, "identical": 3, "mismatches": 1, "ambiguousColumns": 0, "gapColumns": 0, "gapOpens": 0, "identity": { "numerator": 3, "denominator": 4 }, "readAligned": { "bases": 4, "of": 4 }, "referenceCovered": { "bases": 4, "of": 4 }, "placement": { "refStart": 1, "refEnd": 4, "readStart": 1, "readEnd": 4, "crossesOrigin": false, "asSupplied": { "readStart": 1, "readEnd": 4 } }, "overhang": [], "differences": [ { "kind": "substitution", "ref": 1, "refBase": "A", "readBase": "T", "read": 1, "common": true, "asSupplied": { "read": 4, "readBase": "A" } } ] }, "band": { "diagonalMin": 0, "diagonalMax": 0, "cellsNeeded": 13, "unionBandLimited": false, "scope": "every optimal path", "gridCells": 25, "searchedBanded": false, "sharedWords": 0, "sharedWordsOverCap": false, "seedGuarantee": { "differencesUpTo": 2, "guaranteed": false } }, "enumeration": "listed", "alignments": [ [ [ 0, 4 ], [ 0, 4 ] ] ], "tuples": [ [ 3, 0, 4, 1, 0, 0, 4, 4 ] ], "tupleFields": [ "identical", "ambiguousColumns", "columns", "mismatches", "gapColumns", "gapOpens", "readAligned", "referenceCovered" ], "variation": { "readAligned": { "shared": true, "min": 4, "max": 4 }, "referenceCovered": { "shared": true, "min": 4, "max": 4 }, "identity": { "shared": true, "min": { "numerator": 3, "denominator": 4 }, "max": { "numerator": 3, "denominator": 4 } }, "overhangStart": { "shared": true, "min": 0, "max": 0 }, "overhangEnd": { "shared": true, "min": 0, "max": 0 } }, "placements": [ { "refStart": 1, "refEnd": 4, "crossesOrigin": false, "wholeCircle": false, "readStart": 1, "readEnd": 4, "asSupplied": { "readStart": 1, "readEnd": 4 }, "alignments": 1, "band": { "diagonalMin": 0, "diagonalMax": 0, "cellsNeeded": 13, "bandLimited": false } } ] } }, { "mode": "semiglobal-read", "region": null, "strand": "ambiguous", "strandUndetermined": true, "plus": { "score": 3, "count": 1, "overCap": false, "state": "aligned", "biopython": { "score": 3, "count": 1 }, "uniquePairs": [ [ 1, 1 ], [ 2, 2 ], [ 3, 3 ], [ 4, 4 ] ], "uniquePlacement": true, "placementNotDetermined": false, "noCommonColumn": false, "hull": { "refStart": 1, "refEnd": 4, "crossesOrigin": false, "wholeCircle": false }, "selected": { "coordinates": [ [ 0, 4 ], [ 0, 4 ] ], "gappedReference": "ACGT", "gappedRead": "ACGA", "columns": 4, "identical": 3, "mismatches": 1, "ambiguousColumns": 0, "gapColumns": 0, "gapOpens": 0, "identity": { "numerator": 3, "denominator": 4 }, "readAligned": { "bases": 4, "of": 4 }, "referenceCovered": { "bases": 4, "of": 4 }, "placement": { "refStart": 1, "refEnd": 4, "readStart": 1, "readEnd": 4, "crossesOrigin": false }, "overhang": [], "differences": [ { "kind": "substitution", "ref": 4, "refBase": "T", "readBase": "A", "read": 4, "common": true } ] }, "band": { "diagonalMin": 0, "diagonalMax": 0, "cellsNeeded": 13, "unionBandLimited": false, "scope": "every optimal path", "gridCells": 25, "searchedBanded": false, "sharedWords": 0, "sharedWordsOverCap": false, "seedGuarantee": { "differencesUpTo": 2, "guaranteed": false } }, "enumeration": "listed", "alignments": [ [ [ 0, 4 ], [ 0, 4 ] ] ], "tuples": [ [ 3, 0, 4, 1, 0, 0, 4, 4 ] ], "tupleFields": [ "identical", "ambiguousColumns", "columns", "mismatches", "gapColumns", "gapOpens", "readAligned", "referenceCovered" ], "variation": { "readAligned": { "shared": true, "min": 4, "max": 4 }, "referenceCovered": { "shared": true, "min": 4, "max": 4 }, "identity": { "shared": true, "min": { "numerator": 3, "denominator": 4 }, "max": { "numerator": 3, "denominator": 4 } }, "overhangStart": { "shared": true, "min": 0, "max": 0 }, "overhangEnd": { "shared": true, "min": 0, "max": 0 } }, "placements": [ { "refStart": 1, "refEnd": 4, "crossesOrigin": false, "wholeCircle": false, "readStart": 1, "readEnd": 4, "alignments": 1, "band": { "diagonalMin": 0, "diagonalMax": 0, "cellsNeeded": 13, "bandLimited": false } } ] }, "minus": { "score": 3, "count": 1, "overCap": false, "state": "aligned", "biopython": { "score": 3, "count": 1 }, "uniquePairs": [ [ 1, 1 ], [ 2, 2 ], [ 3, 3 ], [ 4, 4 ] ], "uniquePlacement": true, "placementNotDetermined": false, "noCommonColumn": false, "hull": { "refStart": 1, "refEnd": 4, "crossesOrigin": false, "wholeCircle": false }, "selected": { "coordinates": [ [ 0, 4 ], [ 0, 4 ] ], "gappedReference": "ACGT", "gappedRead": "TCGT", "columns": 4, "identical": 3, "mismatches": 1, "ambiguousColumns": 0, "gapColumns": 0, "gapOpens": 0, "identity": { "numerator": 3, "denominator": 4 }, "readAligned": { "bases": 4, "of": 4 }, "referenceCovered": { "bases": 4, "of": 4 }, "placement": { "refStart": 1, "refEnd": 4, "readStart": 1, "readEnd": 4, "crossesOrigin": false, "asSupplied": { "readStart": 1, "readEnd": 4 } }, "overhang": [], "differences": [ { "kind": "substitution", "ref": 1, "refBase": "A", "readBase": "T", "read": 1, "common": true, "asSupplied": { "read": 4, "readBase": "A" } } ] }, "band": { "diagonalMin": 0, "diagonalMax": 0, "cellsNeeded": 13, "unionBandLimited": false, "scope": "every optimal path", "gridCells": 25, "searchedBanded": false, "sharedWords": 0, "sharedWordsOverCap": false, "seedGuarantee": { "differencesUpTo": 2, "guaranteed": false } }, "enumeration": "listed", "alignments": [ [ [ 0, 4 ], [ 0, 4 ] ] ], "tuples": [ [ 3, 0, 4, 1, 0, 0, 4, 4 ] ], "tupleFields": [ "identical", "ambiguousColumns", "columns", "mismatches", "gapColumns", "gapOpens", "readAligned", "referenceCovered" ], "variation": { "readAligned": { "shared": true, "min": 4, "max": 4 }, "referenceCovered": { "shared": true, "min": 4, "max": 4 }, "identity": { "shared": true, "min": { "numerator": 3, "denominator": 4 }, "max": { "numerator": 3, "denominator": 4 } }, "overhangStart": { "shared": true, "min": 0, "max": 0 }, "overhangEnd": { "shared": true, "min": 0, "max": 0 } }, "placements": [ { "refStart": 1, "refEnd": 4, "crossesOrigin": false, "wholeCircle": false, "readStart": 1, "readEnd": 4, "asSupplied": { "readStart": 1, "readEnd": 4 }, "alignments": 1, "band": { "diagonalMin": 0, "diagonalMax": 0, "cellsNeeded": 13, "bandLimited": false } } ] } }, { "mode": "local", "region": null, "strand": "ambiguous", "strandUndetermined": false, "plus": { "score": 6, "count": 1, "overCap": false, "state": "aligned", "biopython": { "score": 6, "count": 1 }, "uniquePairs": [ [ 1, 1 ], [ 2, 2 ], [ 3, 3 ] ], "uniquePlacement": true, "placementNotDetermined": false, "noCommonColumn": false, "hull": { "refStart": 1, "refEnd": 3, "crossesOrigin": false, "wholeCircle": false }, "selected": { "coordinates": [ [ 0, 3 ], [ 0, 3 ] ], "gappedReference": "ACG", "gappedRead": "ACG", "columns": 3, "identical": 3, "mismatches": 0, "ambiguousColumns": 0, "gapColumns": 0, "gapOpens": 0, "identity": { "numerator": 3, "denominator": 3 }, "readAligned": { "bases": 3, "of": 4 }, "referenceCovered": { "bases": 3, "of": 4 }, "placement": { "refStart": 1, "refEnd": 3, "readStart": 1, "readEnd": 3, "crossesOrigin": false }, "overhang": [], "differences": [] }, "band": { "diagonalMin": 0, "diagonalMax": 0, "cellsNeeded": 13, "unionBandLimited": false, "scope": "every optimal path", "gridCells": 25, "searchedBanded": false, "sharedWords": 0, "sharedWordsOverCap": false, "seedGuarantee": { "differencesUpTo": 1, "guaranteed": false } }, "enumeration": "listed", "alignments": [ [ [ 0, 3 ], [ 0, 3 ] ] ], "tuples": [ [ 3, 0, 3, 0, 0, 0, 3, 3 ] ], "tupleFields": [ "identical", "ambiguousColumns", "columns", "mismatches", "gapColumns", "gapOpens", "readAligned", "referenceCovered" ], "variation": { "readAligned": { "shared": true, "min": 3, "max": 3 }, "referenceCovered": { "shared": true, "min": 3, "max": 3 }, "identity": { "shared": true, "min": { "numerator": 1, "denominator": 1 }, "max": { "numerator": 1, "denominator": 1 } }, "overhangStart": { "shared": true, "min": 0, "max": 0 }, "overhangEnd": { "shared": true, "min": 0, "max": 0 } }, "placements": [ { "refStart": 1, "refEnd": 3, "crossesOrigin": false, "wholeCircle": false, "readStart": 1, "readEnd": 3, "alignments": 1, "band": { "diagonalMin": 0, "diagonalMax": 0, "cellsNeeded": 13, "bandLimited": false } } ] }, "minus": { "score": 6, "count": 1, "overCap": false, "state": "aligned", "biopython": { "score": 6, "count": 1 }, "uniquePairs": [ [ 2, 2 ], [ 3, 3 ], [ 4, 4 ] ], "uniquePlacement": true, "placementNotDetermined": false, "noCommonColumn": false, "hull": { "refStart": 2, "refEnd": 4, "crossesOrigin": false, "wholeCircle": false }, "selected": { "coordinates": [ [ 1, 4 ], [ 1, 4 ] ], "gappedReference": "CGT", "gappedRead": "CGT", "columns": 3, "identical": 3, "mismatches": 0, "ambiguousColumns": 0, "gapColumns": 0, "gapOpens": 0, "identity": { "numerator": 3, "denominator": 3 }, "readAligned": { "bases": 3, "of": 4 }, "referenceCovered": { "bases": 3, "of": 4 }, "placement": { "refStart": 2, "refEnd": 4, "readStart": 2, "readEnd": 4, "crossesOrigin": false, "asSupplied": { "readStart": 1, "readEnd": 3 } }, "overhang": [], "differences": [] }, "band": { "diagonalMin": 0, "diagonalMax": 0, "cellsNeeded": 13, "unionBandLimited": false, "scope": "every optimal path", "gridCells": 25, "searchedBanded": false, "sharedWords": 0, "sharedWordsOverCap": false, "seedGuarantee": { "differencesUpTo": 1, "guaranteed": false } }, "enumeration": "listed", "alignments": [ [ [ 1, 4 ], [ 1, 4 ] ] ], "tuples": [ [ 3, 0, 3, 0, 0, 0, 3, 3 ] ], "tupleFields": [ "identical", "ambiguousColumns", "columns", "mismatches", "gapColumns", "gapOpens", "readAligned", "referenceCovered" ], "variation": { "readAligned": { "shared": true, "min": 3, "max": 3 }, "referenceCovered": { "shared": true, "min": 3, "max": 3 }, "identity": { "shared": true, "min": { "numerator": 1, "denominator": 1 }, "max": { "numerator": 1, "denominator": 1 } }, "overhangStart": { "shared": true, "min": 0, "max": 0 }, "overhangEnd": { "shared": true, "min": 0, "max": 0 } }, "placements": [ { "refStart": 2, "refEnd": 4, "crossesOrigin": false, "wholeCircle": false, "readStart": 2, "readEnd": 4, "asSupplied": { "readStart": 1, "readEnd": 3 }, "alignments": 1, "band": { "diagonalMin": 0, "diagonalMax": 0, "cellsNeeded": 13, "bandLimited": false } } ] } } ] } }, { "id": "region-linear", "note": "A chosen region (J01636.1 1-120, positions 1-40): the read runs five bases before the reference's own start and five past the region's edge, so one overhang is at the reference's end and the other at the region's edge; coverage is over the region's 40 bases, positions in the reference's numbering.", "input": { "reference": { "residues": "GACACCATCGAATGGCGCAAAACCTTTCGCGGTATGGCATGATAGCGCCCGGAAGAGAGTCAATTCAGGGTGGTGAATGTGAAACCAGTAACGTTATACGATGTCGCAGAGTATGCCGGT", "topology": "linear", "region": { "from": 1, "to": 40 }, "source": "J01636.1 1-120, region 1-40" }, "read": { "residues": "GTCAGGACACCATCGAATGGCGCAAAACCTTTCGCGGTATGGCATGATAG", "source": "GTCAG then J01636.1 1-45" }, "modes": [ "semiglobal-read", "local" ] }, "expected": { "results": [ { "mode": "semiglobal-read", "region": { "from": 1, "to": 40, "length": 40, "acrossOrigin": false }, "strand": "+", "strandUndetermined": false, "plus": { "score": 54, "count": 2, "overCap": false, "state": "aligned", "biopython": { "score": 54, "count": 2 }, "uniquePairs": [ [ 2, 7 ], [ 3, 8 ], [ 4, 9 ], [ 5, 10 ], [ 6, 11 ], [ 7, 12 ], [ 8, 13 ], [ 9, 14 ], [ 10, 15 ], [ 11, 16 ], [ 12, 17 ], [ 13, 18 ], [ 14, 19 ], [ 15, 20 ], [ 16, 21 ], [ 17, 22 ], [ 18, 23 ], [ 19, 24 ], [ 20, 25 ], [ 21, 26 ], [ 22, 27 ], [ 23, 28 ], [ 24, 29 ], [ 25, 30 ], [ 26, 31 ], [ 27, 32 ], [ 28, 33 ], [ 29, 34 ], [ 30, 35 ], [ 31, 36 ], [ 32, 37 ], [ 33, 38 ], [ 34, 39 ], [ 35, 40 ], [ 36, 41 ], [ 37, 42 ], [ 38, 43 ], [ 39, 44 ], [ 40, 45 ] ], "uniquePlacement": true, "placementNotDetermined": false, "noCommonColumn": false, "hull": { "refStart": 1, "refEnd": 40, "crossesOrigin": false, "wholeCircle": false }, "selected": { "coordinates": [ [ 0, 0, 40, 40 ], [ 0, 5, 45, 50 ] ], "gappedReference": "GACACCATCGAATGGCGCAAAACCTTTCGCGGTATGGCAT", "gappedRead": "GACACCATCGAATGGCGCAAAACCTTTCGCGGTATGGCAT", "columns": 40, "identical": 40, "mismatches": 0, "ambiguousColumns": 0, "gapColumns": 0, "gapOpens": 0, "identity": { "numerator": 40, "denominator": 40 }, "readAligned": { "bases": 40, "of": 50 }, "referenceCovered": { "bases": 40, "of": 40 }, "placement": { "refStart": 1, "refEnd": 40, "readStart": 6, "readEnd": 45, "crossesOrigin": false }, "overhang": [ { "side": "start", "at": "reference-end", "length": 5, "bases": "GTCAG", "readStart": 1, "readEnd": 5 }, { "side": "end", "at": "region-edge", "length": 5, "bases": "GATAG", "readStart": 46, "readEnd": 50 } ], "differences": [] }, "band": { "diagonalMin": -10, "diagonalMax": 0, "cellsNeeded": 531, "unionBandLimited": false, "scope": "every optimal path", "gridCells": 2091, "searchedBanded": false, "sharedWords": 29, "sharedWordsOverCap": false, "seedGuarantee": { "differencesUpTo": 23, "guaranteed": false } }, "enumeration": "listed", "alignments": [ [ [ 0, 0, 40, 40 ], [ 0, 5, 45, 50 ] ], [ [ 0, 1, 1, 40, 40 ], [ 0, 1, 6, 45, 50 ] ] ], "tuples": [ [ 40, 0, 40, 0, 0, 0, 40, 40 ], [ 40, 0, 45, 0, 5, 1, 45, 40 ] ], "tupleFields": [ "identical", "ambiguousColumns", "columns", "mismatches", "gapColumns", "gapOpens", "readAligned", "referenceCovered" ], "variation": { "readAligned": { "shared": false, "min": 40, "max": 45 }, "referenceCovered": { "shared": true, "min": 40, "max": 40 }, "identity": { "shared": false, "min": { "numerator": 8, "denominator": 9 }, "max": { "numerator": 1, "denominator": 1 } }, "overhangStart": { "shared": false, "min": 0, "max": 5 }, "overhangEnd": { "shared": true, "min": 5, "max": 5 } }, "placements": [ { "refStart": 1, "refEnd": 40, "crossesOrigin": false, "wholeCircle": false, "readStart": 1, "readEnd": 45, "alignments": 2, "band": { "diagonalMin": -10, "diagonalMax": 0, "cellsNeeded": 531, "bandLimited": false } } ] }, "minus": { "score": -23, "count": 29, "overCap": false, "state": "aligned", "biopython": { "score": -23, "count": 29 }, "uniquePairs": [ [ 3, 1 ], [ 4, 3 ], [ 5, 4 ], [ 6, 5 ], [ 7, 6 ], [ 8, 7 ], [ 9, 8 ], [ 10, 9 ], [ 11, 10 ], [ 12, 11 ], [ 13, 12 ], [ 14, 13 ], [ 15, 14 ], [ 16, 15 ], [ 17, 16 ], [ 18, 17 ], [ 19, 18 ], [ 20, 19 ], [ 21, 20 ], [ 22, 21 ] ], "uniquePlacement": true, "placementNotDetermined": false, "noCommonColumn": false, "hull": { "refStart": 3, "refEnd": 40, "crossesOrigin": false, "wholeCircle": false }, "selected": { "coordinates": [ [ 0, 2, 3, 3, 22, 22, 29, 29, 33, 33, 38, 40 ], [ 0, 0, 1, 2, 21, 30, 37, 38, 42, 45, 50, 50 ] ], "gappedReference": "C-ACCATCGAATGGCGCAAAA---------CCTTTCG-CGGT---ATGGC", "gappedRead": "CTATCATGCCATACCGCGAAAGGTTTTGCGCCATTCGATGGTGTCCTGAC", "columns": 50, "identical": 25, "mismatches": 11, "ambiguousColumns": 0, "gapColumns": 14, "gapOpens": 4, "identity": { "numerator": 25, "denominator": 50 }, "readAligned": { "bases": 50, "of": 50 }, "referenceCovered": { "bases": 36, "of": 40 }, "placement": { "refStart": 3, "refEnd": 38, "readStart": 1, "readEnd": 50, "crossesOrigin": false, "asSupplied": { "readStart": 1, "readEnd": 50 } }, "overhang": [], "differences": [ { "kind": "insertion", "refAfter": 3, "length": 1, "bases": "T", "readStart": 2, "readEnd": 2, "asSupplied": { "readStart": 49, "readEnd": 49, "bases": "A" }, "common": true }, { "kind": "substitution", "ref": 5, "refBase": "C", "readBase": "T", "read": 4, "common": true, "asSupplied": { "read": 47, "readBase": "A" } }, { "kind": "substitution", "ref": 9, "refBase": "C", "readBase": "G", "read": 8, "common": true, "asSupplied": { "read": 43, "readBase": "C" } }, { "kind": "substitution", "ref": 10, "refBase": "G", "readBase": "C", "read": 9, "common": true, "asSupplied": { "read": 42, "readBase": "G" } }, { "kind": "substitution", "ref": 11, "refBase": "A", "readBase": "C", "read": 10, "common": true, "asSupplied": { "read": 41, "readBase": "G" } }, { "kind": "substitution", "ref": 14, "refBase": "G", "readBase": "A", "read": 13, "common": true, "asSupplied": { "read": 38, "readBase": "T" } }, { "kind": "substitution", "ref": 15, "refBase": "G", "readBase": "C", "read": 14, "common": true, "asSupplied": { "read": 37, "readBase": "G" } }, { "kind": "substitution", "ref": 19, "refBase": "A", "readBase": "G", "read": 18, "common": true, "asSupplied": { "read": 33, "readBase": "C" } }, { "kind": "insertion", "refAfter": 22, "length": 9, "bases": "GGTTTTGCG", "readStart": 22, "readEnd": 30, "asSupplied": { "readStart": 21, "readEnd": 29, "bases": "CGCAAAACC" }, "common": false, "notFixed": { "from": { "ref": 22, "read": 21, "readAsSupplied": 30 }, "to": null } }, { "kind": "substitution", "ref": 25, "refBase": "T", "readBase": "A", "read": 33, "common": false, "notFixed": { "from": { "ref": 22, "read": 21, "readAsSupplied": 30 }, "to": null }, "asSupplied": { "read": 18, "readBase": "T" } }, { "kind": "insertion", "refAfter": 29, "length": 1, "bases": "A", "readStart": 38, "readEnd": 38, "asSupplied": { "readStart": 13, "readEnd": 13, "bases": "T" }, "common": false, "notFixed": { "from": { "ref": 22, "read": 21, "readAsSupplied": 30 }, "to": null } }, { "kind": "substitution", "ref": 30, "refBase": "C", "readBase": "T", "read": 39, "common": false, "notFixed": { "from": { "ref": 22, "read": 21, "readAsSupplied": 30 }, "to": null }, "asSupplied": { "read": 12, "readBase": "A" } }, { "kind": "insertion", "refAfter": 33, "length": 3, "bases": "GTC", "readStart": 43, "readEnd": 45, "asSupplied": { "readStart": 6, "readEnd": 8, "bases": "GAC" }, "common": false, "notFixed": { "from": { "ref": 22, "read": 21, "readAsSupplied": 30 }, "to": null } }, { "kind": "substitution", "ref": 34, "refBase": "A", "readBase": "C", "read": 46, "common": false, "notFixed": { "from": { "ref": 22, "read": 21, "readAsSupplied": 30 }, "to": null }, "asSupplied": { "read": 5, "readBase": "G" } }, { "kind": "substitution", "ref": 37, "refBase": "G", "readBase": "A", "read": 49, "common": false, "notFixed": { "from": { "ref": 22, "read": 21, "readAsSupplied": 30 }, "to": null }, "asSupplied": { "read": 2, "readBase": "T" } } ] }, "band": { "diagonalMin": -12, "diagonalMax": 2, "cellsNeeded": 685, "unionBandLimited": false, "scope": "every optimal path", "gridCells": 2091, "searchedBanded": false, "sharedWords": 0, "sharedWordsOverCap": false, "seedGuarantee": { "differencesUpTo": 61, "guaranteed": false } }, "enumeration": "listed", "alignments": [ [ [ 0, 2, 3, 3, 22, 22, 29, 29, 33, 33, 38, 40 ], [ 0, 0, 1, 2, 21, 30, 37, 38, 42, 45, 50, 50 ] ], [ [ 0, 2, 3, 3, 27, 27, 30, 30, 33, 33, 38, 40 ], [ 0, 0, 1, 2, 26, 28, 31, 39, 42, 45, 50, 50 ] ], [ [ 0, 2, 3, 3, 22, 22, 30, 30, 33, 33, 38, 40 ], [ 0, 0, 1, 2, 21, 30, 38, 39, 42, 45, 50, 50 ] ], [ [ 0, 2, 3, 3, 22, 22, 29, 29, 34, 34, 38, 40 ], [ 0, 0, 1, 2, 21, 30, 37, 38, 43, 46, 50, 50 ] ], [ [ 0, 2, 3, 3, 27, 27, 30, 30, 34, 34, 38, 40 ], [ 0, 0, 1, 2, 26, 28, 31, 39, 43, 46, 50, 50 ] ], [ [ 0, 2, 3, 3, 22, 22, 30, 30, 34, 34, 38, 40 ], [ 0, 0, 1, 2, 21, 30, 38, 39, 43, 46, 50, 50 ] ], [ [ 0, 2, 3, 3, 22, 22, 29, 29, 35, 35, 38, 40 ], [ 0, 0, 1, 2, 21, 30, 37, 38, 44, 47, 50, 50 ] ], [ [ 0, 2, 3, 3, 27, 27, 30, 30, 35, 35, 38, 40 ], [ 0, 0, 1, 2, 26, 28, 31, 39, 44, 47, 50, 50 ] ], [ [ 0, 2, 3, 3, 22, 22, 30, 30, 35, 35, 38, 40 ], [ 0, 0, 1, 2, 21, 30, 38, 39, 44, 47, 50, 50 ] ], [ [ 0, 2, 3, 3, 27, 27, 33, 33, 37, 37, 38, 40 ], [ 0, 0, 1, 2, 26, 28, 34, 37, 41, 49, 50, 50 ] ], [ [ 0, 2, 3, 3, 31, 31, 33, 33, 37, 37, 38, 40 ], [ 0, 0, 1, 2, 30, 32, 34, 37, 41, 49, 50, 50 ] ], [ [ 0, 2, 3, 3, 32, 32, 33, 33, 37, 37, 38, 40 ], [ 0, 0, 1, 2, 31, 33, 34, 37, 41, 49, 50, 50 ] ], [ [ 0, 2, 3, 3, 31, 31, 33, 33, 37, 37, 38, 40 ], [ 0, 0, 1, 2, 30, 33, 35, 37, 41, 49, 50, 50 ] ], [ [ 0, 2, 3, 3, 32, 32, 33, 33, 37, 37, 38, 40 ], [ 0, 0, 1, 2, 31, 34, 35, 37, 41, 49, 50, 50 ] ], [ [ 0, 2, 3, 3, 27, 27, 33, 33, 37, 37, 38, 38, 40 ], [ 0, 0, 1, 2, 26, 28, 34, 37, 41, 44, 45, 48, 50 ] ], [ [ 0, 2, 3, 3, 31, 31, 33, 33, 37, 37, 38, 38, 40 ], [ 0, 0, 1, 2, 30, 32, 34, 37, 41, 44, 45, 48, 50 ] ], [ [ 0, 2, 3, 3, 32, 32, 33, 33, 37, 37, 38, 38, 40 ], [ 0, 0, 1, 2, 31, 33, 34, 37, 41, 44, 45, 48, 50 ] ], [ [ 0, 2, 3, 3, 31, 31, 33, 33, 37, 37, 38, 38, 40 ], [ 0, 0, 1, 2, 30, 33, 35, 37, 41, 44, 45, 48, 50 ] ], [ [ 0, 2, 3, 3, 32, 32, 33, 33, 37, 37, 38, 38, 40 ], [ 0, 0, 1, 2, 31, 34, 35, 37, 41, 44, 45, 48, 50 ] ], [ [ 0, 2, 3, 3, 27, 27, 33, 33, 37, 37, 38, 38, 40 ], [ 0, 0, 1, 2, 26, 28, 34, 37, 41, 45, 46, 48, 50 ] ], [ [ 0, 2, 3, 3, 31, 31, 33, 33, 37, 37, 38, 38, 40 ], [ 0, 0, 1, 2, 30, 32, 34, 37, 41, 45, 46, 48, 50 ] ], [ [ 0, 2, 3, 3, 32, 32, 33, 33, 37, 37, 38, 38, 40 ], [ 0, 0, 1, 2, 31, 33, 34, 37, 41, 45, 46, 48, 50 ] ], [ [ 0, 2, 3, 3, 31, 31, 33, 33, 37, 37, 38, 38, 40 ], [ 0, 0, 1, 2, 30, 33, 35, 37, 41, 45, 46, 48, 50 ] ], [ [ 0, 2, 3, 3, 32, 32, 33, 33, 37, 37, 38, 38, 40 ], [ 0, 0, 1, 2, 31, 34, 35, 37, 41, 45, 46, 48, 50 ] ], [ [ 0, 2, 3, 3, 27, 27, 33, 33, 37, 37, 40, 40 ], [ 0, 0, 1, 2, 26, 28, 34, 37, 41, 44, 47, 50 ] ], [ [ 0, 2, 3, 3, 31, 31, 33, 33, 37, 37, 40, 40 ], [ 0, 0, 1, 2, 30, 32, 34, 37, 41, 44, 47, 50 ] ], [ [ 0, 2, 3, 3, 32, 32, 33, 33, 37, 37, 40, 40 ], [ 0, 0, 1, 2, 31, 33, 34, 37, 41, 44, 47, 50 ] ], [ [ 0, 2, 3, 3, 31, 31, 33, 33, 37, 37, 40, 40 ], [ 0, 0, 1, 2, 30, 33, 35, 37, 41, 44, 47, 50 ] ], [ [ 0, 2, 3, 3, 32, 32, 33, 33, 37, 37, 40, 40 ], [ 0, 0, 1, 2, 31, 34, 35, 37, 41, 44, 47, 50 ] ] ], "tuples": [ [ 25, 0, 50, 11, 14, 4, 50, 36 ], [ 26, 0, 47, 12, 9, 4, 47, 38 ], [ 26, 0, 50, 12, 12, 5, 50, 38 ] ], "tupleFields": [ "identical", "ambiguousColumns", "columns", "mismatches", "gapColumns", "gapOpens", "readAligned", "referenceCovered" ], "variation": { "readAligned": { "shared": false, "min": 47, "max": 50 }, "referenceCovered": { "shared": false, "min": 36, "max": 38 }, "identity": { "shared": false, "min": { "numerator": 1, "denominator": 2 }, "max": { "numerator": 26, "denominator": 47 } }, "overhangStart": { "shared": true, "min": 0, "max": 0 }, "overhangEnd": { "shared": false, "min": 0, "max": 3 } }, "placements": [ { "refStart": 3, "refEnd": 40, "crossesOrigin": false, "wholeCircle": false, "readStart": 1, "readEnd": 50, "asSupplied": { "readStart": 1, "readEnd": 50 }, "alignments": 29, "band": { "diagonalMin": -12, "diagonalMax": 2, "cellsNeeded": 685, "bandLimited": false } } ] } }, { "mode": "local", "region": { "from": 1, "to": 40, "length": 40, "acrossOrigin": false }, "strand": "+", "strandUndetermined": false, "plus": { "score": 80, "count": 1, "overCap": false, "state": "aligned", "biopython": { "score": 80, "count": 1 }, "uniquePairs": [ [ 1, 6 ], [ 2, 7 ], [ 3, 8 ], [ 4, 9 ], [ 5, 10 ], [ 6, 11 ], [ 7, 12 ], [ 8, 13 ], [ 9, 14 ], [ 10, 15 ], [ 11, 16 ], [ 12, 17 ], [ 13, 18 ], [ 14, 19 ], [ 15, 20 ], [ 16, 21 ], [ 17, 22 ], [ 18, 23 ], [ 19, 24 ], [ 20, 25 ], [ 21, 26 ], [ 22, 27 ], [ 23, 28 ], [ 24, 29 ], [ 25, 30 ], [ 26, 31 ], [ 27, 32 ], [ 28, 33 ], [ 29, 34 ], [ 30, 35 ], [ 31, 36 ], [ 32, 37 ], [ 33, 38 ], [ 34, 39 ], [ 35, 40 ], [ 36, 41 ], [ 37, 42 ], [ 38, 43 ], [ 39, 44 ], [ 40, 45 ] ], "uniquePlacement": true, "placementNotDetermined": false, "noCommonColumn": false, "hull": { "refStart": 1, "refEnd": 40, "crossesOrigin": false, "wholeCircle": false }, "selected": { "coordinates": [ [ 0, 40 ], [ 5, 45 ] ], "gappedReference": "GACACCATCGAATGGCGCAAAACCTTTCGCGGTATGGCAT", "gappedRead": "GACACCATCGAATGGCGCAAAACCTTTCGCGGTATGGCAT", "columns": 40, "identical": 40, "mismatches": 0, "ambiguousColumns": 0, "gapColumns": 0, "gapOpens": 0, "identity": { "numerator": 40, "denominator": 40 }, "readAligned": { "bases": 40, "of": 50 }, "referenceCovered": { "bases": 40, "of": 40 }, "placement": { "refStart": 1, "refEnd": 40, "readStart": 6, "readEnd": 45, "crossesOrigin": false }, "overhang": [], "differences": [] }, "band": { "diagonalMin": -5, "diagonalMax": -5, "cellsNeeded": 123, "unionBandLimited": false, "scope": "every optimal path", "gridCells": 2091, "searchedBanded": false, "sharedWords": 29, "sharedWordsOverCap": false, "seedGuarantee": { "differencesUpTo": 10, "guaranteed": false } }, "enumeration": "listed", "alignments": [ [ [ 0, 40 ], [ 5, 45 ] ] ], "tuples": [ [ 40, 0, 40, 0, 0, 0, 40, 40 ] ], "tupleFields": [ "identical", "ambiguousColumns", "columns", "mismatches", "gapColumns", "gapOpens", "readAligned", "referenceCovered" ], "variation": { "readAligned": { "shared": true, "min": 40, "max": 40 }, "referenceCovered": { "shared": true, "min": 40, "max": 40 }, "identity": { "shared": true, "min": { "numerator": 1, "denominator": 1 }, "max": { "numerator": 1, "denominator": 1 } }, "overhangStart": { "shared": true, "min": 0, "max": 0 }, "overhangEnd": { "shared": true, "min": 0, "max": 0 } }, "placements": [ { "refStart": 1, "refEnd": 40, "crossesOrigin": false, "wholeCircle": false, "readStart": 6, "readEnd": 45, "alignments": 1, "band": { "diagonalMin": -5, "diagonalMax": -5, "cellsNeeded": 123, "bandLimited": false } } ] }, "minus": { "score": 12, "count": 1, "overCap": false, "state": "aligned", "biopython": { "score": 12, "count": 1 }, "uniquePairs": [ [ 16, 15 ], [ 17, 16 ], [ 18, 17 ], [ 19, 18 ], [ 20, 19 ], [ 21, 20 ], [ 22, 21 ], [ 23, 22 ], [ 24, 23 ], [ 25, 24 ], [ 26, 25 ], [ 27, 26 ], [ 28, 27 ], [ 29, 28 ], [ 30, 29 ], [ 31, 30 ] ], "uniquePlacement": true, "placementNotDetermined": false, "noCommonColumn": false, "hull": { "refStart": 16, "refEnd": 31, "crossesOrigin": false, "wholeCircle": false }, "selected": { "coordinates": [ [ 15, 31 ], [ 14, 30 ] ], "gappedReference": "CGCAAAACCTTTCGCG", "gappedRead": "CGCGAAAGGTTTTGCG", "columns": 16, "identical": 12, "mismatches": 4, "ambiguousColumns": 0, "gapColumns": 0, "gapOpens": 0, "identity": { "numerator": 12, "denominator": 16 }, "readAligned": { "bases": 16, "of": 50 }, "referenceCovered": { "bases": 16, "of": 40 }, "placement": { "refStart": 16, "refEnd": 31, "readStart": 15, "readEnd": 30, "crossesOrigin": false, "asSupplied": { "readStart": 21, "readEnd": 36 } }, "overhang": [], "differences": [ { "kind": "substitution", "ref": 19, "refBase": "A", "readBase": "G", "read": 18, "common": true, "asSupplied": { "read": 33, "readBase": "C" } }, { "kind": "substitution", "ref": 23, "refBase": "C", "readBase": "G", "read": 22, "common": true, "asSupplied": { "read": 29, "readBase": "C" } }, { "kind": "substitution", "ref": 24, "refBase": "C", "readBase": "G", "read": 23, "common": true, "asSupplied": { "read": 28, "readBase": "C" } }, { "kind": "substitution", "ref": 28, "refBase": "C", "readBase": "T", "read": 27, "common": true, "asSupplied": { "read": 24, "readBase": "A" } } ] }, "band": { "diagonalMin": 1, "diagonalMax": 1, "cellsNeeded": 120, "unionBandLimited": false, "scope": "every optimal path", "gridCells": 2091, "searchedBanded": false, "sharedWords": 0, "sharedWordsOverCap": false, "seedGuarantee": { "differencesUpTo": 44, "guaranteed": false } }, "enumeration": "listed", "alignments": [ [ [ 15, 31 ], [ 14, 30 ] ] ], "tuples": [ [ 12, 0, 16, 4, 0, 0, 16, 16 ] ], "tupleFields": [ "identical", "ambiguousColumns", "columns", "mismatches", "gapColumns", "gapOpens", "readAligned", "referenceCovered" ], "variation": { "readAligned": { "shared": true, "min": 16, "max": 16 }, "referenceCovered": { "shared": true, "min": 16, "max": 16 }, "identity": { "shared": true, "min": { "numerator": 3, "denominator": 4 }, "max": { "numerator": 3, "denominator": 4 } }, "overhangStart": { "shared": true, "min": 0, "max": 0 }, "overhangEnd": { "shared": true, "min": 0, "max": 0 } }, "placements": [ { "refStart": 16, "refEnd": 31, "crossesOrigin": false, "wholeCircle": false, "readStart": 15, "readEnd": 30, "asSupplied": { "readStart": 21, "readEnd": 36 }, "alignments": 1, "band": { "diagonalMin": 1, "diagonalMax": 1, "cellsNeeded": 120, "bandLimited": false } } ] } } ] } }, { "id": "region-inner", "note": "A chosen region (positions 31-90 of J01636.1 1-120) and a read of 21-50: ten bases run past the region's start, overhang at the region's edge, never at the reference's end.", "input": { "reference": { "residues": "GACACCATCGAATGGCGCAAAACCTTTCGCGGTATGGCATGATAGCGCCCGGAAGAGAGTCAATTCAGGGTGGTGAATGTGAAACCAGTAACGTTATACGATGTCGCAGAGTATGCCGGT", "topology": "linear", "region": { "from": 31, "to": 90 }, "source": "J01636.1 1-120, region 31-90" }, "read": { "residues": "AACCTTTCGCGGTATGGCATGATAGCGCCC", "source": "J01636.1 21-50" }, "modes": [ "global", "semiglobal-read", "local" ] }, "expected": { "results": [ { "mode": "global", "region": { "from": 31, "to": 90, "length": 60, "acrossOrigin": false }, "strand": "-", "strandUndetermined": false, "plus": { "score": -66, "count": 1, "overCap": false, "state": "aligned", "biopython": { "score": -66, "count": 1 }, "uniquePairs": [ [ 31, 11 ], [ 32, 12 ], [ 33, 13 ], [ 34, 14 ], [ 35, 15 ], [ 36, 16 ], [ 37, 17 ], [ 38, 18 ], [ 39, 19 ], [ 40, 20 ], [ 41, 21 ], [ 42, 22 ], [ 43, 23 ], [ 44, 24 ], [ 45, 25 ], [ 46, 26 ], [ 47, 27 ], [ 48, 28 ], [ 49, 29 ], [ 50, 30 ] ], "uniquePlacement": true, "placementNotDetermined": false, "noCommonColumn": false, "hull": { "refStart": 31, "refEnd": 50, "crossesOrigin": false, "wholeCircle": false }, "selected": { "coordinates": [ [ 0, 0, 20, 60 ], [ 0, 10, 30, 30 ] ], "gappedReference": "----------GGTATGGCATGATAGCGCCCGGAAGAGAGTCAATTCAGGGTGGTGAATGTGAAACCAGTA", "gappedRead": "AACCTTTCGCGGTATGGCATGATAGCGCCC----------------------------------------", "columns": 70, "identical": 20, "mismatches": 0, "ambiguousColumns": 0, "gapColumns": 50, "gapOpens": 2, "identity": { "numerator": 20, "denominator": 70 }, "readAligned": { "bases": 20, "of": 30 }, "referenceCovered": { "bases": 20, "of": 60 }, "placement": { "refStart": 31, "refEnd": 50, "readStart": 11, "readEnd": 30, "crossesOrigin": false }, "overhang": [], "differences": [ { "kind": "insertion", "refAfter": 30, "length": 10, "bases": "AACCTTTCGC", "readStart": 1, "readEnd": 10, "common": true }, { "kind": "deletion", "refStart": 51, "refEnd": 90, "length": 40, "bases": "GGAAGAGAGTCAATTCAGGGTGGTGAATGTGAAACCAGTA", "readAfter": 30, "common": true } ] }, "band": { "diagonalMin": -10, "diagonalMax": 30, "cellsNeeded": 1266, "unionBandLimited": false, "scope": "every optimal path", "gridCells": 1891, "searchedBanded": false, "sharedWords": 9, "sharedWordsOverCap": false, "seedGuarantee": { "differencesUpTo": 63, "guaranteed": false } }, "enumeration": "listed", "alignments": [ [ [ 0, 0, 20, 60 ], [ 0, 10, 30, 30 ] ] ], "tuples": [ [ 20, 0, 70, 0, 50, 2, 20, 20 ] ], "tupleFields": [ "identical", "ambiguousColumns", "columns", "mismatches", "gapColumns", "gapOpens", "readAligned", "referenceCovered" ], "variation": { "readAligned": { "shared": true, "min": 20, "max": 20 }, "referenceCovered": { "shared": true, "min": 20, "max": 20 }, "identity": { "shared": true, "min": { "numerator": 2, "denominator": 7 }, "max": { "numerator": 2, "denominator": 7 } }, "overhangStart": { "shared": true, "min": 0, "max": 0 }, "overhangEnd": { "shared": true, "min": 0, "max": 0 } }, "placements": [ { "refStart": 31, "refEnd": 50, "crossesOrigin": false, "wholeCircle": false, "readStart": 11, "readEnd": 30, "alignments": 1, "band": { "diagonalMin": -10, "diagonalMax": 30, "cellsNeeded": 1266, "bandLimited": false } } ] }, "minus": { "score": -63, "count": 91, "overCap": false, "state": "aligned", "biopython": { "score": -63, "count": 91 }, "uniquePairs": [ [ 31, 1 ], [ 88, 28 ], [ 89, 29 ], [ 90, 30 ] ], "uniquePlacement": true, "placementNotDetermined": false, "noCommonColumn": false, "hull": { "refStart": 31, "refEnd": 90, "crossesOrigin": false, "wholeCircle": false }, "selected": { "coordinates": [ [ 0, 1, 5, 8, 10, 16, 22, 25, 30, 34, 45, 54, 56, 60 ], [ 0, 1, 1, 4, 4, 10, 10, 13, 13, 17, 17, 26, 26, 30 ] ], "gappedReference": "GGTATGGCATGATAGCGCCCGGAAGAGAGTCAATTCAGGGTGGTGAATGTGAAACCAGTA", "gappedRead": "G----GGC--GCTATC------ATG-----CCAT-----------ACCGCGAAA--GGTT", "columns": 60, "identical": 21, "mismatches": 9, "ambiguousColumns": 0, "gapColumns": 30, "gapOpens": 6, "identity": { "numerator": 21, "denominator": 60 }, "readAligned": { "bases": 30, "of": 30 }, "referenceCovered": { "bases": 60, "of": 60 }, "placement": { "refStart": 31, "refEnd": 90, "readStart": 1, "readEnd": 30, "crossesOrigin": false, "asSupplied": { "readStart": 1, "readEnd": 30 } }, "overhang": [], "differences": [ { "kind": "deletion", "refStart": 32, "refEnd": 35, "length": 4, "bases": "GTAT", "readAfter": 1, "asSupplied": { "readBetween": [ 29, 30 ] }, "common": false, "notFixed": { "from": { "ref": 31, "read": 1, "readAsSupplied": 30 }, "to": { "ref": 88, "read": 28, "readAsSupplied": 3 } } }, { "kind": "deletion", "refStart": 39, "refEnd": 40, "length": 2, "bases": "AT", "readAfter": 4, "asSupplied": { "readBetween": [ 26, 27 ] }, "common": false, "notFixed": { "from": { "ref": 31, "read": 1, "readAsSupplied": 30 }, "to": { "ref": 88, "read": 28, "readAsSupplied": 3 } } }, { "kind": "substitution", "ref": 42, "refBase": "A", "readBase": "C", "read": 6, "common": false, "notFixed": { "from": { "ref": 31, "read": 1, "readAsSupplied": 30 }, "to": { "ref": 88, "read": 28, "readAsSupplied": 3 } }, "asSupplied": { "read": 25, "readBase": "G" } }, { "kind": "substitution", "ref": 45, "refBase": "G", "readBase": "T", "read": 9, "common": false, "notFixed": { "from": { "ref": 31, "read": 1, "readAsSupplied": 30 }, "to": { "ref": 88, "read": 28, "readAsSupplied": 3 } }, "asSupplied": { "read": 22, "readBase": "A" } }, { "kind": "deletion", "refStart": 47, "refEnd": 52, "length": 6, "bases": "GCCCGG", "readAfter": 10, "asSupplied": { "readBetween": [ 20, 21 ] }, "common": false, "notFixed": { "from": { "ref": 31, "read": 1, "readAsSupplied": 30 }, "to": { "ref": 88, "read": 28, "readAsSupplied": 3 } } }, { "kind": "substitution", "ref": 54, "refBase": "A", "readBase": "T", "read": 12, "common": false, "notFixed": { "from": { "ref": 31, "read": 1, "readAsSupplied": 30 }, "to": { "ref": 88, "read": 28, "readAsSupplied": 3 } }, "asSupplied": { "read": 19, "readBase": "A" } }, { "kind": "deletion", "refStart": 56, "refEnd": 60, "length": 5, "bases": "AGAGT", "readAfter": 13, "asSupplied": { "readBetween": [ 17, 18 ] }, "common": false, "notFixed": { "from": { "ref": 31, "read": 1, "readAsSupplied": 30 }, "to": { "ref": 88, "read": 28, "readAsSupplied": 3 } } }, { "kind": "substitution", "ref": 62, "refBase": "A", "readBase": "C", "read": 15, "common": false, "notFixed": { "from": { "ref": 31, "read": 1, "readAsSupplied": 30 }, "to": { "ref": 88, "read": 28, "readAsSupplied": 3 } }, "asSupplied": { "read": 16, "readBase": "G" } }, { "kind": "deletion", "refStart": 65, "refEnd": 75, "length": 11, "bases": "TCAGGGTGGTG", "readAfter": 17, "asSupplied": { "readBetween": [ 13, 14 ] }, "common": false, "notFixed": { "from": { "ref": 31, "read": 1, "readAsSupplied": 30 }, "to": { "ref": 88, "read": 28, "readAsSupplied": 3 } } }, { "kind": "substitution", "ref": 77, "refBase": "A", "readBase": "C", "read": 19, "common": false, "notFixed": { "from": { "ref": 31, "read": 1, "readAsSupplied": 30 }, "to": { "ref": 88, "read": 28, "readAsSupplied": 3 } }, "asSupplied": { "read": 12, "readBase": "G" } }, { "kind": "substitution", "ref": 78, "refBase": "T", "readBase": "C", "read": 20, "common": false, "notFixed": { "from": { "ref": 31, "read": 1, "readAsSupplied": 30 }, "to": { "ref": 88, "read": 28, "readAsSupplied": 3 } }, "asSupplied": { "read": 11, "readBase": "G" } }, { "kind": "substitution", "ref": 80, "refBase": "T", "readBase": "C", "read": 22, "common": false, "notFixed": { "from": { "ref": 31, "read": 1, "readAsSupplied": 30 }, "to": { "ref": 88, "read": 28, "readAsSupplied": 3 } }, "asSupplied": { "read": 9, "readBase": "G" } }, { "kind": "deletion", "refStart": 85, "refEnd": 86, "length": 2, "bases": "CC", "readAfter": 26, "asSupplied": { "readBetween": [ 4, 5 ] }, "common": false, "notFixed": { "from": { "ref": 31, "read": 1, "readAsSupplied": 30 }, "to": { "ref": 88, "read": 28, "readAsSupplied": 3 } } }, { "kind": "substitution", "ref": 87, "refBase": "A", "readBase": "G", "read": 27, "common": false, "notFixed": { "from": { "ref": 31, "read": 1, "readAsSupplied": 30 }, "to": { "ref": 88, "read": 28, "readAsSupplied": 3 } }, "asSupplied": { "read": 4, "readBase": "C" } }, { "kind": "substitution", "ref": 90, "refBase": "A", "readBase": "T", "read": 30, "common": true, "asSupplied": { "read": 1, "readBase": "A" } } ] }, "band": { "diagonalMin": 0, "diagonalMax": 30, "cellsNeeded": 1021, "unionBandLimited": false, "scope": "every optimal path", "gridCells": 1891, "searchedBanded": false, "sharedWords": 0, "sharedWordsOverCap": false, "seedGuarantee": { "differencesUpTo": 61, "guaranteed": false } }, "enumeration": "listed", "alignments": [ [ [ 0, 1, 5, 8, 10, 16, 22, 25, 30, 34, 45, 54, 56, 60 ], [ 0, 1, 1, 4, 4, 10, 10, 13, 13, 17, 17, 26, 26, 30 ] ], [ [ 0, 2, 6, 8, 10, 16, 22, 25, 30, 34, 45, 54, 56, 60 ], [ 0, 2, 2, 4, 4, 10, 10, 13, 13, 17, 17, 26, 26, 30 ] ], [ [ 0, 2, 5, 6, 6, 8, 8, 13, 16, 19, 32, 34, 45, 54, 56, 60 ], [ 0, 2, 2, 3, 4, 6, 7, 12, 12, 15, 15, 17, 17, 26, 26, 30 ] ], [ [ 0, 1, 5, 8, 10, 14, 29, 37, 40, 41, 45, 54, 56, 60 ], [ 0, 1, 1, 4, 4, 8, 8, 16, 16, 17, 17, 26, 26, 30 ] ], [ [ 0, 2, 6, 8, 10, 14, 29, 37, 40, 41, 45, 54, 56, 60 ], [ 0, 2, 2, 4, 4, 8, 8, 16, 16, 17, 17, 26, 26, 30 ] ], [ [ 0, 2, 14, 18, 21, 23, 29, 37, 40, 41, 45, 54, 56, 60 ], [ 0, 2, 2, 6, 6, 8, 8, 16, 16, 17, 17, 26, 26, 30 ] ], [ [ 0, 2, 14, 19, 22, 23, 29, 37, 40, 41, 45, 54, 56, 60 ], [ 0, 2, 2, 7, 7, 8, 8, 16, 16, 17, 17, 26, 26, 30 ] ], [ [ 0, 2, 14, 18, 22, 24, 29, 37, 40, 41, 45, 54, 56, 60 ], [ 0, 2, 2, 6, 6, 8, 8, 16, 16, 17, 17, 26, 26, 30 ] ], [ [ 0, 2, 14, 19, 23, 24, 29, 37, 40, 41, 45, 54, 56, 60 ], [ 0, 2, 2, 7, 7, 8, 8, 16, 16, 17, 17, 26, 26, 30 ] ], [ [ 0, 2, 14, 18, 24, 26, 29, 37, 40, 41, 45, 54, 56, 60 ], [ 0, 2, 2, 6, 6, 8, 8, 16, 16, 17, 17, 26, 26, 30 ] ], [ [ 0, 2, 14, 19, 25, 26, 29, 37, 40, 41, 45, 54, 56, 60 ], [ 0, 2, 2, 7, 7, 8, 8, 16, 16, 17, 17, 26, 26, 30 ] ], [ [ 0, 2, 14, 18, 26, 28, 29, 37, 40, 41, 45, 54, 56, 60 ], [ 0, 2, 2, 6, 6, 8, 8, 16, 16, 17, 17, 26, 26, 30 ] ], [ [ 0, 2, 14, 19, 27, 28, 29, 37, 40, 41, 45, 54, 56, 60 ], [ 0, 2, 2, 7, 7, 8, 8, 16, 16, 17, 17, 26, 26, 30 ] ], [ [ 0, 1, 5, 8, 10, 14, 29, 37, 43, 44, 45, 54, 56, 60 ], [ 0, 1, 1, 4, 4, 8, 8, 16, 16, 17, 17, 26, 26, 30 ] ], [ [ 0, 2, 6, 8, 10, 14, 29, 37, 43, 44, 45, 54, 56, 60 ], [ 0, 2, 2, 4, 4, 8, 8, 16, 16, 17, 17, 26, 26, 30 ] ], [ [ 0, 2, 14, 18, 21, 23, 29, 37, 43, 44, 45, 54, 56, 60 ], [ 0, 2, 2, 6, 6, 8, 8, 16, 16, 17, 17, 26, 26, 30 ] ], [ [ 0, 2, 14, 19, 22, 23, 29, 37, 43, 44, 45, 54, 56, 60 ], [ 0, 2, 2, 7, 7, 8, 8, 16, 16, 17, 17, 26, 26, 30 ] ], [ [ 0, 2, 14, 18, 22, 24, 29, 37, 43, 44, 45, 54, 56, 60 ], [ 0, 2, 2, 6, 6, 8, 8, 16, 16, 17, 17, 26, 26, 30 ] ], [ [ 0, 2, 14, 19, 23, 24, 29, 37, 43, 44, 45, 54, 56, 60 ], [ 0, 2, 2, 7, 7, 8, 8, 16, 16, 17, 17, 26, 26, 30 ] ], [ [ 0, 2, 14, 18, 24, 26, 29, 37, 43, 44, 45, 54, 56, 60 ], [ 0, 2, 2, 6, 6, 8, 8, 16, 16, 17, 17, 26, 26, 30 ] ], [ [ 0, 2, 14, 19, 25, 26, 29, 37, 43, 44, 45, 54, 56, 60 ], [ 0, 2, 2, 7, 7, 8, 8, 16, 16, 17, 17, 26, 26, 30 ] ], [ [ 0, 2, 14, 18, 26, 28, 29, 37, 43, 44, 45, 54, 56, 60 ], [ 0, 2, 2, 6, 6, 8, 8, 16, 16, 17, 17, 26, 26, 30 ] ], [ [ 0, 2, 14, 19, 27, 28, 29, 37, 43, 44, 45, 54, 56, 60 ], [ 0, 2, 2, 7, 7, 8, 8, 16, 16, 17, 17, 26, 26, 30 ] ], [ [ 0, 1, 5, 8, 10, 16, 22, 25, 30, 36, 47, 54, 56, 60 ], [ 0, 1, 1, 4, 4, 10, 10, 13, 13, 19, 19, 26, 26, 30 ] ], [ [ 0, 2, 6, 8, 10, 16, 22, 25, 30, 36, 47, 54, 56, 60 ], [ 0, 2, 2, 4, 4, 10, 10, 13, 13, 19, 19, 26, 26, 30 ] ], [ [ 0, 2, 5, 6, 6, 8, 8, 13, 16, 19, 32, 36, 47, 54, 56, 60 ], [ 0, 2, 2, 3, 4, 6, 7, 12, 12, 15, 15, 19, 19, 26, 26, 30 ] ], [ [ 0, 1, 5, 8, 10, 16, 22, 25, 30, 37, 48, 54, 56, 60 ], [ 0, 1, 1, 4, 4, 10, 10, 13, 13, 20, 20, 26, 26, 30 ] ], [ [ 0, 2, 6, 8, 10, 16, 22, 25, 30, 37, 48, 54, 56, 60 ], [ 0, 2, 2, 4, 4, 10, 10, 13, 13, 20, 20, 26, 26, 30 ] ], [ [ 0, 2, 5, 6, 6, 8, 8, 13, 16, 19, 32, 37, 48, 54, 56, 60 ], [ 0, 2, 2, 3, 4, 6, 7, 12, 12, 15, 15, 20, 20, 26, 26, 30 ] ], [ [ 0, 1, 5, 8, 10, 16, 22, 25, 30, 38, 49, 54, 56, 60 ], [ 0, 1, 1, 4, 4, 10, 10, 13, 13, 21, 21, 26, 26, 30 ] ], [ [ 0, 2, 6, 8, 10, 16, 22, 25, 30, 38, 49, 54, 56, 60 ], [ 0, 2, 2, 4, 4, 10, 10, 13, 13, 21, 21, 26, 26, 30 ] ], [ [ 0, 2, 5, 6, 6, 8, 8, 13, 16, 19, 32, 38, 49, 54, 56, 60 ], [ 0, 2, 2, 3, 4, 6, 7, 12, 12, 15, 15, 21, 21, 26, 26, 30 ] ], [ [ 0, 1, 5, 8, 10, 16, 22, 25, 30, 39, 50, 54, 56, 60 ], [ 0, 1, 1, 4, 4, 10, 10, 13, 13, 22, 22, 26, 26, 30 ] ], [ [ 0, 2, 6, 8, 10, 16, 22, 25, 30, 39, 50, 54, 56, 60 ], [ 0, 2, 2, 4, 4, 10, 10, 13, 13, 22, 22, 26, 26, 30 ] ], [ [ 0, 2, 5, 6, 6, 8, 8, 13, 16, 19, 32, 39, 50, 54, 56, 60 ], [ 0, 2, 2, 3, 4, 6, 7, 12, 12, 15, 15, 22, 22, 26, 26, 30 ] ], [ [ 0, 1, 5, 8, 10, 16, 22, 25, 30, 40, 51, 54, 56, 60 ], [ 0, 1, 1, 4, 4, 10, 10, 13, 13, 23, 23, 26, 26, 30 ] ], [ [ 0, 2, 6, 8, 10, 16, 22, 25, 30, 40, 51, 54, 56, 60 ], [ 0, 2, 2, 4, 4, 10, 10, 13, 13, 23, 23, 26, 26, 30 ] ], [ [ 0, 2, 5, 6, 6, 8, 8, 13, 16, 19, 32, 40, 51, 54, 56, 60 ], [ 0, 2, 2, 3, 4, 6, 7, 12, 12, 15, 15, 23, 23, 26, 26, 30 ] ], [ [ 0, 1, 5, 8, 10, 16, 22, 25, 30, 36, 41, 49, 57, 60 ], [ 0, 1, 1, 4, 4, 10, 10, 13, 13, 19, 19, 27, 27, 30 ] ], [ [ 0, 2, 6, 8, 10, 16, 22, 25, 30, 36, 41, 49, 57, 60 ], [ 0, 2, 2, 4, 4, 10, 10, 13, 13, 19, 19, 27, 27, 30 ] ], [ [ 0, 2, 5, 6, 6, 8, 8, 13, 16, 19, 32, 36, 41, 49, 57, 60 ], [ 0, 2, 2, 3, 4, 6, 7, 12, 12, 15, 15, 19, 19, 27, 27, 30 ] ], [ [ 0, 1, 5, 8, 10, 16, 22, 25, 30, 37, 42, 49, 57, 60 ], [ 0, 1, 1, 4, 4, 10, 10, 13, 13, 20, 20, 27, 27, 30 ] ], [ [ 0, 2, 6, 8, 10, 16, 22, 25, 30, 37, 42, 49, 57, 60 ], [ 0, 2, 2, 4, 4, 10, 10, 13, 13, 20, 20, 27, 27, 30 ] ], [ [ 0, 2, 5, 6, 6, 8, 8, 13, 16, 19, 32, 37, 42, 49, 57, 60 ], [ 0, 2, 2, 3, 4, 6, 7, 12, 12, 15, 15, 20, 20, 27, 27, 30 ] ], [ [ 0, 1, 5, 8, 10, 16, 22, 25, 30, 38, 43, 49, 57, 60 ], [ 0, 1, 1, 4, 4, 10, 10, 13, 13, 21, 21, 27, 27, 30 ] ], [ [ 0, 2, 6, 8, 10, 16, 22, 25, 30, 38, 43, 49, 57, 60 ], [ 0, 2, 2, 4, 4, 10, 10, 13, 13, 21, 21, 27, 27, 30 ] ], [ [ 0, 2, 5, 6, 6, 8, 8, 13, 16, 19, 32, 38, 43, 49, 57, 60 ], [ 0, 2, 2, 3, 4, 6, 7, 12, 12, 15, 15, 21, 21, 27, 27, 30 ] ], [ [ 0, 1, 5, 8, 10, 16, 22, 25, 30, 39, 44, 49, 57, 60 ], [ 0, 1, 1, 4, 4, 10, 10, 13, 13, 22, 22, 27, 27, 30 ] ], [ [ 0, 2, 6, 8, 10, 16, 22, 25, 30, 39, 44, 49, 57, 60 ], [ 0, 2, 2, 4, 4, 10, 10, 13, 13, 22, 22, 27, 27, 30 ] ], [ [ 0, 2, 5, 6, 6, 8, 8, 13, 16, 19, 32, 39, 44, 49, 57, 60 ], [ 0, 2, 2, 3, 4, 6, 7, 12, 12, 15, 15, 22, 22, 27, 27, 30 ] ], [ [ 0, 1, 5, 8, 10, 16, 22, 25, 30, 40, 45, 49, 57, 60 ], [ 0, 1, 1, 4, 4, 10, 10, 13, 13, 23, 23, 27, 27, 30 ] ], [ [ 0, 2, 6, 8, 10, 16, 22, 25, 30, 40, 45, 49, 57, 60 ], [ 0, 2, 2, 4, 4, 10, 10, 13, 13, 23, 23, 27, 27, 30 ] ], [ [ 0, 2, 5, 6, 6, 8, 8, 13, 16, 19, 32, 40, 45, 49, 57, 60 ], [ 0, 2, 2, 3, 4, 6, 7, 12, 12, 15, 15, 23, 23, 27, 27, 30 ] ], [ [ 0, 1, 5, 8, 10, 16, 22, 25, 30, 34, 45, 55, 57, 60 ], [ 0, 1, 1, 4, 4, 10, 10, 13, 13, 17, 17, 27, 27, 30 ] ], [ [ 0, 2, 6, 8, 10, 16, 22, 25, 30, 34, 45, 55, 57, 60 ], [ 0, 2, 2, 4, 4, 10, 10, 13, 13, 17, 17, 27, 27, 30 ] ], [ [ 0, 2, 5, 6, 6, 8, 8, 13, 16, 19, 32, 34, 45, 55, 57, 60 ], [ 0, 2, 2, 3, 4, 6, 7, 12, 12, 15, 15, 17, 17, 27, 27, 30 ] ], [ [ 0, 1, 5, 8, 10, 14, 29, 37, 40, 41, 45, 55, 57, 60 ], [ 0, 1, 1, 4, 4, 8, 8, 16, 16, 17, 17, 27, 27, 30 ] ], [ [ 0, 2, 6, 8, 10, 14, 29, 37, 40, 41, 45, 55, 57, 60 ], [ 0, 2, 2, 4, 4, 8, 8, 16, 16, 17, 17, 27, 27, 30 ] ], [ [ 0, 2, 14, 18, 21, 23, 29, 37, 40, 41, 45, 55, 57, 60 ], [ 0, 2, 2, 6, 6, 8, 8, 16, 16, 17, 17, 27, 27, 30 ] ], [ [ 0, 2, 14, 19, 22, 23, 29, 37, 40, 41, 45, 55, 57, 60 ], [ 0, 2, 2, 7, 7, 8, 8, 16, 16, 17, 17, 27, 27, 30 ] ], [ [ 0, 2, 14, 18, 22, 24, 29, 37, 40, 41, 45, 55, 57, 60 ], [ 0, 2, 2, 6, 6, 8, 8, 16, 16, 17, 17, 27, 27, 30 ] ], [ [ 0, 2, 14, 19, 23, 24, 29, 37, 40, 41, 45, 55, 57, 60 ], [ 0, 2, 2, 7, 7, 8, 8, 16, 16, 17, 17, 27, 27, 30 ] ], [ [ 0, 2, 14, 18, 24, 26, 29, 37, 40, 41, 45, 55, 57, 60 ], [ 0, 2, 2, 6, 6, 8, 8, 16, 16, 17, 17, 27, 27, 30 ] ], [ [ 0, 2, 14, 19, 25, 26, 29, 37, 40, 41, 45, 55, 57, 60 ], [ 0, 2, 2, 7, 7, 8, 8, 16, 16, 17, 17, 27, 27, 30 ] ], [ [ 0, 2, 14, 18, 26, 28, 29, 37, 40, 41, 45, 55, 57, 60 ], [ 0, 2, 2, 6, 6, 8, 8, 16, 16, 17, 17, 27, 27, 30 ] ], [ [ 0, 2, 14, 19, 27, 28, 29, 37, 40, 41, 45, 55, 57, 60 ], [ 0, 2, 2, 7, 7, 8, 8, 16, 16, 17, 17, 27, 27, 30 ] ], [ [ 0, 1, 5, 8, 10, 14, 29, 37, 43, 44, 45, 55, 57, 60 ], [ 0, 1, 1, 4, 4, 8, 8, 16, 16, 17, 17, 27, 27, 30 ] ], [ [ 0, 2, 6, 8, 10, 14, 29, 37, 43, 44, 45, 55, 57, 60 ], [ 0, 2, 2, 4, 4, 8, 8, 16, 16, 17, 17, 27, 27, 30 ] ], [ [ 0, 2, 14, 18, 21, 23, 29, 37, 43, 44, 45, 55, 57, 60 ], [ 0, 2, 2, 6, 6, 8, 8, 16, 16, 17, 17, 27, 27, 30 ] ], [ [ 0, 2, 14, 19, 22, 23, 29, 37, 43, 44, 45, 55, 57, 60 ], [ 0, 2, 2, 7, 7, 8, 8, 16, 16, 17, 17, 27, 27, 30 ] ], [ [ 0, 2, 14, 18, 22, 24, 29, 37, 43, 44, 45, 55, 57, 60 ], [ 0, 2, 2, 6, 6, 8, 8, 16, 16, 17, 17, 27, 27, 30 ] ], [ [ 0, 2, 14, 19, 23, 24, 29, 37, 43, 44, 45, 55, 57, 60 ], [ 0, 2, 2, 7, 7, 8, 8, 16, 16, 17, 17, 27, 27, 30 ] ], [ [ 0, 2, 14, 18, 24, 26, 29, 37, 43, 44, 45, 55, 57, 60 ], [ 0, 2, 2, 6, 6, 8, 8, 16, 16, 17, 17, 27, 27, 30 ] ], [ [ 0, 2, 14, 19, 25, 26, 29, 37, 43, 44, 45, 55, 57, 60 ], [ 0, 2, 2, 7, 7, 8, 8, 16, 16, 17, 17, 27, 27, 30 ] ], [ [ 0, 2, 14, 18, 26, 28, 29, 37, 43, 44, 45, 55, 57, 60 ], [ 0, 2, 2, 6, 6, 8, 8, 16, 16, 17, 17, 27, 27, 30 ] ], [ [ 0, 2, 14, 19, 27, 28, 29, 37, 43, 44, 45, 55, 57, 60 ], [ 0, 2, 2, 7, 7, 8, 8, 16, 16, 17, 17, 27, 27, 30 ] ], [ [ 0, 1, 5, 8, 10, 16, 22, 25, 30, 36, 47, 55, 57, 60 ], [ 0, 1, 1, 4, 4, 10, 10, 13, 13, 19, 19, 27, 27, 30 ] ], [ [ 0, 2, 6, 8, 10, 16, 22, 25, 30, 36, 47, 55, 57, 60 ], [ 0, 2, 2, 4, 4, 10, 10, 13, 13, 19, 19, 27, 27, 30 ] ], [ [ 0, 2, 5, 6, 6, 8, 8, 13, 16, 19, 32, 36, 47, 55, 57, 60 ], [ 0, 2, 2, 3, 4, 6, 7, 12, 12, 15, 15, 19, 19, 27, 27, 30 ] ], [ [ 0, 1, 5, 8, 10, 16, 22, 25, 30, 37, 48, 55, 57, 60 ], [ 0, 1, 1, 4, 4, 10, 10, 13, 13, 20, 20, 27, 27, 30 ] ], [ [ 0, 2, 6, 8, 10, 16, 22, 25, 30, 37, 48, 55, 57, 60 ], [ 0, 2, 2, 4, 4, 10, 10, 13, 13, 20, 20, 27, 27, 30 ] ], [ [ 0, 2, 5, 6, 6, 8, 8, 13, 16, 19, 32, 37, 48, 55, 57, 60 ], [ 0, 2, 2, 3, 4, 6, 7, 12, 12, 15, 15, 20, 20, 27, 27, 30 ] ], [ [ 0, 1, 5, 8, 10, 16, 22, 25, 30, 38, 49, 55, 57, 60 ], [ 0, 1, 1, 4, 4, 10, 10, 13, 13, 21, 21, 27, 27, 30 ] ], [ [ 0, 2, 6, 8, 10, 16, 22, 25, 30, 38, 49, 55, 57, 60 ], [ 0, 2, 2, 4, 4, 10, 10, 13, 13, 21, 21, 27, 27, 30 ] ], [ [ 0, 2, 5, 6, 6, 8, 8, 13, 16, 19, 32, 38, 49, 55, 57, 60 ], [ 0, 2, 2, 3, 4, 6, 7, 12, 12, 15, 15, 21, 21, 27, 27, 30 ] ], [ [ 0, 1, 5, 8, 10, 16, 22, 25, 30, 39, 50, 55, 57, 60 ], [ 0, 1, 1, 4, 4, 10, 10, 13, 13, 22, 22, 27, 27, 30 ] ], [ [ 0, 2, 6, 8, 10, 16, 22, 25, 30, 39, 50, 55, 57, 60 ], [ 0, 2, 2, 4, 4, 10, 10, 13, 13, 22, 22, 27, 27, 30 ] ], [ [ 0, 2, 5, 6, 6, 8, 8, 13, 16, 19, 32, 39, 50, 55, 57, 60 ], [ 0, 2, 2, 3, 4, 6, 7, 12, 12, 15, 15, 22, 22, 27, 27, 30 ] ], [ [ 0, 1, 5, 8, 10, 16, 22, 25, 30, 40, 51, 55, 57, 60 ], [ 0, 1, 1, 4, 4, 10, 10, 13, 13, 23, 23, 27, 27, 30 ] ], [ [ 0, 2, 6, 8, 10, 16, 22, 25, 30, 40, 51, 55, 57, 60 ], [ 0, 2, 2, 4, 4, 10, 10, 13, 13, 23, 23, 27, 27, 30 ] ], [ [ 0, 2, 5, 6, 6, 8, 8, 13, 16, 19, 32, 40, 51, 55, 57, 60 ], [ 0, 2, 2, 3, 4, 6, 7, 12, 12, 15, 15, 23, 23, 27, 27, 30 ] ] ], "tuples": [ [ 21, 0, 60, 9, 30, 6, 30, 60 ], [ 22, 0, 62, 6, 34, 7, 30, 60 ] ], "tupleFields": [ "identical", "ambiguousColumns", "columns", "mismatches", "gapColumns", "gapOpens", "readAligned", "referenceCovered" ], "variation": { "readAligned": { "shared": true, "min": 30, "max": 30 }, "referenceCovered": { "shared": true, "min": 60, "max": 60 }, "identity": { "shared": false, "min": { "numerator": 7, "denominator": 20 }, "max": { "numerator": 11, "denominator": 31 } }, "overhangStart": { "shared": true, "min": 0, "max": 0 }, "overhangEnd": { "shared": true, "min": 0, "max": 0 } }, "placements": [ { "refStart": 31, "refEnd": 90, "crossesOrigin": false, "wholeCircle": false, "readStart": 1, "readEnd": 30, "asSupplied": { "readStart": 1, "readEnd": 30 }, "alignments": 91, "band": { "diagonalMin": 0, "diagonalMax": 30, "cellsNeeded": 1021, "bandLimited": false } } ] } }, { "mode": "semiglobal-read", "region": { "from": 31, "to": 90, "length": 60, "acrossOrigin": false }, "strand": "+", "strandUndetermined": false, "plus": { "score": 17, "count": 1, "overCap": false, "state": "aligned", "biopython": { "score": 17, "count": 1 }, "uniquePairs": [ [ 31, 11 ], [ 32, 12 ], [ 33, 13 ], [ 34, 14 ], [ 35, 15 ], [ 36, 16 ], [ 37, 17 ], [ 38, 18 ], [ 39, 19 ], [ 40, 20 ], [ 41, 21 ], [ 42, 22 ], [ 43, 23 ], [ 44, 24 ], [ 45, 25 ], [ 46, 26 ], [ 47, 27 ], [ 48, 28 ], [ 49, 29 ], [ 50, 30 ] ], "uniquePlacement": true, "placementNotDetermined": false, "noCommonColumn": false, "hull": { "refStart": 31, "refEnd": 50, "crossesOrigin": false, "wholeCircle": false }, "selected": { "coordinates": [ [ 0, 0, 20, 60 ], [ 0, 10, 30, 30 ] ], "gappedReference": "GGTATGGCATGATAGCGCCC", "gappedRead": "GGTATGGCATGATAGCGCCC", "columns": 20, "identical": 20, "mismatches": 0, "ambiguousColumns": 0, "gapColumns": 0, "gapOpens": 0, "identity": { "numerator": 20, "denominator": 20 }, "readAligned": { "bases": 20, "of": 30 }, "referenceCovered": { "bases": 20, "of": 60 }, "placement": { "refStart": 31, "refEnd": 50, "readStart": 11, "readEnd": 30, "crossesOrigin": false }, "overhang": [ { "side": "start", "at": "region-edge", "length": 10, "bases": "AACCTTTCGC", "readStart": 1, "readEnd": 10 } ], "differences": [] }, "band": { "diagonalMin": -10, "diagonalMax": -1, "cellsNeeded": 306, "unionBandLimited": false, "scope": "every optimal path", "gridCells": 1891, "searchedBanded": false, "sharedWords": 9, "sharedWordsOverCap": false, "seedGuarantee": { "differencesUpTo": 21, "guaranteed": false } }, "enumeration": "listed", "alignments": [ [ [ 0, 0, 20, 60 ], [ 0, 10, 30, 30 ] ] ], "tuples": [ [ 20, 0, 20, 0, 0, 0, 20, 20 ] ], "tupleFields": [ "identical", "ambiguousColumns", "columns", "mismatches", "gapColumns", "gapOpens", "readAligned", "referenceCovered" ], "variation": { "readAligned": { "shared": true, "min": 20, "max": 20 }, "referenceCovered": { "shared": true, "min": 20, "max": 20 }, "identity": { "shared": true, "min": { "numerator": 1, "denominator": 1 }, "max": { "numerator": 1, "denominator": 1 } }, "overhangStart": { "shared": true, "min": 10, "max": 10 }, "overhangEnd": { "shared": true, "min": 0, "max": 0 } }, "placements": [ { "refStart": 31, "refEnd": 50, "crossesOrigin": false, "wholeCircle": false, "readStart": 11, "readEnd": 30, "alignments": 1, "band": { "diagonalMin": -10, "diagonalMax": -1, "cellsNeeded": 306, "bandLimited": false } } ] }, "minus": { "score": -6, "count": 2, "overCap": false, "state": "aligned", "biopython": { "score": -6, "count": 2 }, "uniquePairs": [ [ 31, 1 ], [ 32, 2 ], [ 33, 7 ], [ 34, 8 ], [ 35, 9 ], [ 38, 10 ], [ 39, 11 ], [ 40, 12 ], [ 41, 13 ], [ 42, 16 ], [ 43, 17 ], [ 44, 18 ], [ 45, 19 ], [ 46, 20 ], [ 47, 21 ], [ 48, 22 ], [ 52, 23 ], [ 53, 24 ], [ 54, 25 ], [ 56, 26 ], [ 57, 27 ] ], "uniquePlacement": true, "placementNotDetermined": false, "noCommonColumn": false, "hull": { "refStart": 31, "refEnd": 61, "crossesOrigin": false, "wholeCircle": false }, "selected": { "coordinates": [ [ 0, 2, 2, 5, 7, 11, 11, 18, 21, 24, 25, 30, 60 ], [ 0, 2, 6, 9, 9, 13, 15, 22, 22, 25, 25, 30, 30 ] ], "gappedReference": "GG----TATGGCATG--ATAGCGCCCGGAAGAGAGT", "gappedRead": "GGGCGCTAT--CATGCCATACCGC---GAA-AGGTT", "columns": 36, "identical": 21, "mismatches": 3, "ambiguousColumns": 0, "gapColumns": 12, "gapOpens": 5, "identity": { "numerator": 21, "denominator": 36 }, "readAligned": { "bases": 30, "of": 30 }, "referenceCovered": { "bases": 30, "of": 60 }, "placement": { "refStart": 31, "refEnd": 60, "readStart": 1, "readEnd": 30, "crossesOrigin": false, "asSupplied": { "readStart": 1, "readEnd": 30 } }, "overhang": [], "differences": [ { "kind": "insertion", "refAfter": 32, "length": 4, "bases": "GCGC", "readStart": 3, "readEnd": 6, "asSupplied": { "readStart": 25, "readEnd": 28, "bases": "GCGC" }, "common": true }, { "kind": "deletion", "refStart": 36, "refEnd": 37, "length": 2, "bases": "GG", "readAfter": 9, "asSupplied": { "readBetween": [ 21, 22 ] }, "common": true }, { "kind": "insertion", "refAfter": 41, "length": 2, "bases": "CC", "readStart": 14, "readEnd": 15, "asSupplied": { "readStart": 16, "readEnd": 17, "bases": "GG" }, "common": true }, { "kind": "substitution", "ref": 45, "refBase": "G", "readBase": "C", "read": 19, "common": true, "asSupplied": { "read": 12, "readBase": "G" } }, { "kind": "deletion", "refStart": 49, "refEnd": 51, "length": 3, "bases": "CCG", "readAfter": 22, "asSupplied": { "readBetween": [ 8, 9 ] }, "common": true }, { "kind": "deletion", "refStart": 55, "refEnd": 55, "length": 1, "bases": "G", "readAfter": 25, "asSupplied": { "readBetween": [ 5, 6 ] }, "common": true }, { "kind": "substitution", "ref": 58, "refBase": "A", "readBase": "G", "read": 28, "common": false, "notFixed": { "from": { "ref": 57, "read": 27, "readAsSupplied": 4 }, "to": null }, "asSupplied": { "read": 3, "readBase": "C" } }, { "kind": "substitution", "ref": 59, "refBase": "G", "readBase": "T", "read": 29, "common": false, "notFixed": { "from": { "ref": 57, "read": 27, "readAsSupplied": 4 }, "to": null }, "asSupplied": { "read": 2, "readBase": "A" } } ] }, "band": { "diagonalMin": -4, "diagonalMax": 1, "cellsNeeded": 233, "unionBandLimited": false, "scope": "every optimal path", "gridCells": 1891, "searchedBanded": false, "sharedWords": 0, "sharedWordsOverCap": false, "seedGuarantee": { "differencesUpTo": 33, "guaranteed": false } }, "enumeration": "listed", "alignments": [ [ [ 0, 2, 2, 5, 7, 11, 11, 18, 21, 24, 25, 30, 60 ], [ 0, 2, 6, 9, 9, 13, 15, 22, 22, 25, 25, 30, 30 ] ], [ [ 0, 2, 2, 5, 7, 11, 11, 18, 21, 24, 25, 27, 28, 31, 60 ], [ 0, 2, 6, 9, 9, 13, 15, 22, 22, 25, 25, 27, 27, 30, 30 ] ] ], "tuples": [ [ 21, 0, 36, 3, 12, 5, 30, 30 ], [ 22, 0, 37, 2, 13, 6, 30, 31 ] ], "tupleFields": [ "identical", "ambiguousColumns", "columns", "mismatches", "gapColumns", "gapOpens", "readAligned", "referenceCovered" ], "variation": { "readAligned": { "shared": true, "min": 30, "max": 30 }, "referenceCovered": { "shared": false, "min": 30, "max": 31 }, "identity": { "shared": false, "min": { "numerator": 7, "denominator": 12 }, "max": { "numerator": 22, "denominator": 37 } }, "overhangStart": { "shared": true, "min": 0, "max": 0 }, "overhangEnd": { "shared": true, "min": 0, "max": 0 } }, "placements": [ { "refStart": 31, "refEnd": 61, "crossesOrigin": false, "wholeCircle": false, "readStart": 1, "readEnd": 30, "asSupplied": { "readStart": 1, "readEnd": 30 }, "alignments": 2, "band": { "diagonalMin": -4, "diagonalMax": 1, "cellsNeeded": 233, "bandLimited": false } } ] } }, { "mode": "local", "region": { "from": 31, "to": 90, "length": 60, "acrossOrigin": false }, "strand": "+", "strandUndetermined": false, "plus": { "score": 40, "count": 1, "overCap": false, "state": "aligned", "biopython": { "score": 40, "count": 1 }, "uniquePairs": [ [ 31, 11 ], [ 32, 12 ], [ 33, 13 ], [ 34, 14 ], [ 35, 15 ], [ 36, 16 ], [ 37, 17 ], [ 38, 18 ], [ 39, 19 ], [ 40, 20 ], [ 41, 21 ], [ 42, 22 ], [ 43, 23 ], [ 44, 24 ], [ 45, 25 ], [ 46, 26 ], [ 47, 27 ], [ 48, 28 ], [ 49, 29 ], [ 50, 30 ] ], "uniquePlacement": true, "placementNotDetermined": false, "noCommonColumn": false, "hull": { "refStart": 31, "refEnd": 50, "crossesOrigin": false, "wholeCircle": false }, "selected": { "coordinates": [ [ 0, 20 ], [ 10, 30 ] ], "gappedReference": "GGTATGGCATGATAGCGCCC", "gappedRead": "GGTATGGCATGATAGCGCCC", "columns": 20, "identical": 20, "mismatches": 0, "ambiguousColumns": 0, "gapColumns": 0, "gapOpens": 0, "identity": { "numerator": 20, "denominator": 20 }, "readAligned": { "bases": 20, "of": 30 }, "referenceCovered": { "bases": 20, "of": 60 }, "placement": { "refStart": 31, "refEnd": 50, "readStart": 11, "readEnd": 30, "crossesOrigin": false }, "overhang": [], "differences": [] }, "band": { "diagonalMin": -10, "diagonalMax": -10, "cellsNeeded": 63, "unionBandLimited": false, "scope": "every optimal path", "gridCells": 1891, "searchedBanded": false, "sharedWords": 9, "sharedWordsOverCap": false, "seedGuarantee": { "differencesUpTo": 10, "guaranteed": false } }, "enumeration": "listed", "alignments": [ [ [ 0, 20 ], [ 10, 30 ] ] ], "tuples": [ [ 20, 0, 20, 0, 0, 0, 20, 20 ] ], "tupleFields": [ "identical", "ambiguousColumns", "columns", "mismatches", "gapColumns", "gapOpens", "readAligned", "referenceCovered" ], "variation": { "readAligned": { "shared": true, "min": 20, "max": 20 }, "referenceCovered": { "shared": true, "min": 20, "max": 20 }, "identity": { "shared": true, "min": { "numerator": 1, "denominator": 1 }, "max": { "numerator": 1, "denominator": 1 } }, "overhangStart": { "shared": true, "min": 0, "max": 0 }, "overhangEnd": { "shared": true, "min": 0, "max": 0 } }, "placements": [ { "refStart": 31, "refEnd": 50, "crossesOrigin": false, "wholeCircle": false, "readStart": 11, "readEnd": 30, "alignments": 1, "band": { "diagonalMin": -10, "diagonalMax": -10, "cellsNeeded": 63, "bandLimited": false } } ] }, "minus": { "score": 10, "count": 1, "overCap": false, "state": "aligned", "biopython": { "score": 10, "count": 1 }, "uniquePairs": [ [ 38, 10 ], [ 39, 11 ], [ 40, 12 ], [ 41, 13 ], [ 42, 16 ], [ 43, 17 ], [ 44, 18 ], [ 45, 19 ], [ 46, 20 ], [ 47, 21 ], [ 48, 22 ] ], "uniquePlacement": true, "placementNotDetermined": false, "noCommonColumn": false, "hull": { "refStart": 38, "refEnd": 48, "crossesOrigin": false, "wholeCircle": false }, "selected": { "coordinates": [ [ 7, 11, 11, 18 ], [ 9, 13, 15, 22 ] ], "gappedReference": "CATG--ATAGCGC", "gappedRead": "CATGCCATACCGC", "columns": 13, "identical": 10, "mismatches": 1, "ambiguousColumns": 0, "gapColumns": 2, "gapOpens": 1, "identity": { "numerator": 10, "denominator": 13 }, "readAligned": { "bases": 13, "of": 30 }, "referenceCovered": { "bases": 11, "of": 60 }, "placement": { "refStart": 38, "refEnd": 48, "readStart": 10, "readEnd": 22, "crossesOrigin": false, "asSupplied": { "readStart": 9, "readEnd": 21 } }, "overhang": [], "differences": [ { "kind": "insertion", "refAfter": 41, "length": 2, "bases": "CC", "readStart": 14, "readEnd": 15, "asSupplied": { "readStart": 16, "readEnd": 17, "bases": "GG" }, "common": true }, { "kind": "substitution", "ref": 45, "refBase": "G", "readBase": "C", "read": 19, "common": true, "asSupplied": { "read": 12, "readBase": "G" } } ] }, "band": { "diagonalMin": -4, "diagonalMax": -2, "cellsNeeded": 140, "unionBandLimited": false, "scope": "every optimal path", "gridCells": 1891, "searchedBanded": false, "sharedWords": 0, "sharedWordsOverCap": false, "seedGuarantee": { "differencesUpTo": 25, "guaranteed": false } }, "enumeration": "listed", "alignments": [ [ [ 7, 11, 11, 18 ], [ 9, 13, 15, 22 ] ] ], "tuples": [ [ 10, 0, 13, 1, 2, 1, 13, 11 ] ], "tupleFields": [ "identical", "ambiguousColumns", "columns", "mismatches", "gapColumns", "gapOpens", "readAligned", "referenceCovered" ], "variation": { "readAligned": { "shared": true, "min": 13, "max": 13 }, "referenceCovered": { "shared": true, "min": 11, "max": 11 }, "identity": { "shared": true, "min": { "numerator": 10, "denominator": 13 }, "max": { "numerator": 10, "denominator": 13 } }, "overhangStart": { "shared": true, "min": 0, "max": 0 }, "overhangEnd": { "shared": true, "min": 0, "max": 0 } }, "placements": [ { "refStart": 38, "refEnd": 48, "crossesOrigin": false, "wholeCircle": false, "readStart": 10, "readEnd": 22, "asSupplied": { "readStart": 9, "readEnd": 21 }, "alignments": 1, "band": { "diagonalMin": -4, "diagonalMax": -2, "cellsNeeded": 140, "bandLimited": false } } ] } } ] } }, { "id": "region-across-origin", "note": "A chosen region across a circle's origin (J01636.1 801-880 as a circle, positions 61 to 20, 40 bases), searched as a linear stretch: global is allowed on it, positions are in the circle's numbering, a placement over position 80 then 1 crosses the origin.", "input": { "reference": { "residues": "GATGCTGGTTGCCAACGATCAGATGGCGCTGGGCGCAATGCGCGCCATTACCGAGTCCGGGCTGCGCGTTGGTGCGGATA", "topology": "circular", "region": { "from": 61, "to": 20 }, "source": "J01636.1 801-880, circular, region 61-20" }, "read": { "residues": "GGTGCGGATAGCTGCTGGTTGCCA", "source": "reference bases 71-80 and 1-14, read base 12 changed" }, "modes": [ "global", "semiglobal-read", "local" ] }, "expected": { "results": [ { "mode": "global", "region": { "from": 61, "to": 20, "length": 40, "acrossOrigin": true }, "strand": "+", "strandUndetermined": false, "plus": { "score": 5, "count": 2, "overCap": false, "state": "aligned", "biopython": { "score": 5, "count": 2 }, "uniquePairs": [ [ 72, 2 ], [ 73, 3 ], [ 74, 4 ], [ 75, 5 ], [ 76, 6 ], [ 77, 7 ], [ 78, 8 ], [ 79, 9 ], [ 80, 10 ], [ 1, 11 ], [ 2, 12 ], [ 3, 13 ], [ 4, 14 ], [ 5, 15 ], [ 6, 16 ], [ 7, 17 ], [ 8, 18 ], [ 9, 19 ], [ 10, 20 ], [ 11, 21 ], [ 12, 22 ], [ 13, 23 ], [ 14, 24 ] ], "uniquePlacement": true, "placementNotDetermined": false, "noCommonColumn": false, "hull": { "refStart": 61, "refEnd": 14, "crossesOrigin": true, "wholeCircle": false }, "selected": { "coordinates": [ [ 0, 10, 34, 40 ], [ 0, 0, 24, 24 ] ], "gappedReference": "GCTGCGCGTTGGTGCGGATAGATGCTGGTTGCCAACGATC", "gappedRead": "----------GGTGCGGATAGCTGCTGGTTGCCA------", "columns": 40, "identical": 23, "mismatches": 1, "ambiguousColumns": 0, "gapColumns": 16, "gapOpens": 2, "identity": { "numerator": 23, "denominator": 40 }, "readAligned": { "bases": 24, "of": 24 }, "referenceCovered": { "bases": 24, "of": 40 }, "placement": { "refStart": 71, "refEnd": 14, "readStart": 1, "readEnd": 24, "crossesOrigin": true }, "overhang": [], "differences": [ { "kind": "deletion", "refStart": 61, "refEnd": 70, "length": 10, "bases": "GCTGCGCGTT", "readAfter": 0, "common": false, "notFixed": { "from": null, "to": { "ref": 72, "read": 2 } } }, { "kind": "substitution", "ref": 2, "refBase": "A", "readBase": "C", "read": 12, "common": true }, { "kind": "deletion", "refStart": 15, "refEnd": 20, "length": 6, "bases": "ACGATC", "readAfter": 24, "common": true } ] }, "band": { "diagonalMin": 0, "diagonalMax": 16, "cellsNeeded": 473, "unionBandLimited": false, "scope": "every optimal path", "gridCells": 1025, "searchedBanded": false, "sharedWords": 1, "sharedWordsOverCap": false, "seedGuarantee": { "differencesUpTo": 21, "guaranteed": false } }, "enumeration": "listed", "alignments": [ [ [ 0, 10, 34, 40 ], [ 0, 0, 24, 24 ] ], [ [ 0, 1, 11, 34, 40 ], [ 0, 1, 1, 24, 24 ] ] ], "tuples": [ [ 23, 0, 40, 1, 16, 2, 24, 24 ], [ 23, 0, 40, 1, 16, 2, 24, 34 ] ], "tupleFields": [ "identical", "ambiguousColumns", "columns", "mismatches", "gapColumns", "gapOpens", "readAligned", "referenceCovered" ], "variation": { "readAligned": { "shared": true, "min": 24, "max": 24 }, "referenceCovered": { "shared": false, "min": 24, "max": 34 }, "identity": { "shared": true, "min": { "numerator": 23, "denominator": 40 }, "max": { "numerator": 23, "denominator": 40 } }, "overhangStart": { "shared": true, "min": 0, "max": 0 }, "overhangEnd": { "shared": true, "min": 0, "max": 0 } }, "placements": [ { "refStart": 61, "refEnd": 14, "crossesOrigin": true, "wholeCircle": false, "readStart": 1, "readEnd": 24, "alignments": 2, "band": { "diagonalMin": 0, "diagonalMax": 16, "cellsNeeded": 473, "bandLimited": false } } ] }, "minus": { "score": -45, "count": 12, "overCap": false, "state": "aligned", "biopython": { "score": -45, "count": 12 }, "uniquePairs": [ [ 63, 1 ], [ 64, 2 ], [ 66, 3 ], [ 67, 4 ], [ 74, 10 ], [ 75, 11 ], [ 76, 12 ], [ 77, 13 ], [ 78, 14 ], [ 79, 15 ], [ 3, 17 ], [ 4, 18 ], [ 5, 19 ], [ 11, 20 ], [ 12, 21 ], [ 15, 22 ], [ 16, 23 ], [ 20, 24 ] ], "uniquePlacement": true, "placementNotDetermined": false, "noCommonColumn": false, "hull": { "refStart": 63, "refEnd": 20, "crossesOrigin": true, "wholeCircle": false }, "selected": { "coordinates": [ [ 0, 2, 4, 5, 7, 8, 19, 21, 25, 30, 32, 34, 36, 39, 40 ], [ 0, 0, 2, 2, 4, 4, 15, 15, 19, 19, 21, 21, 23, 23, 24 ] ], "gappedReference": "GCTGCGCGTTGGTGCGGATAGATGCTGGTTGCCAACGATC", "gappedRead": "--TG-GC-AACCAGCAGCT--ATCC-----GC--AC---C", "columns": 40, "identical": 16, "mismatches": 8, "ambiguousColumns": 0, "gapColumns": 16, "gapOpens": 7, "identity": { "numerator": 16, "denominator": 40 }, "readAligned": { "bases": 24, "of": 24 }, "referenceCovered": { "bases": 38, "of": 40 }, "placement": { "refStart": 63, "refEnd": 20, "readStart": 1, "readEnd": 24, "crossesOrigin": true, "asSupplied": { "readStart": 1, "readEnd": 24 } }, "overhang": [], "differences": [ { "kind": "deletion", "refStart": 61, "refEnd": 62, "length": 2, "bases": "GC", "readAfter": 0, "asSupplied": { "readBetween": [ 24, 25 ] }, "common": true }, { "kind": "deletion", "refStart": 65, "refEnd": 65, "length": 1, "bases": "C", "readAfter": 2, "asSupplied": { "readBetween": [ 22, 23 ] }, "common": true }, { "kind": "deletion", "refStart": 68, "refEnd": 68, "length": 1, "bases": "G", "readAfter": 4, "asSupplied": { "readBetween": [ 20, 21 ] }, "common": false, "notFixed": { "from": { "ref": 67, "read": 4, "readAsSupplied": 21 }, "to": { "ref": 74, "read": 10, "readAsSupplied": 15 } } }, { "kind": "substitution", "ref": 69, "refBase": "T", "readBase": "A", "read": 5, "common": false, "notFixed": { "from": { "ref": 67, "read": 4, "readAsSupplied": 21 }, "to": { "ref": 74, "read": 10, "readAsSupplied": 15 } }, "asSupplied": { "read": 20, "readBase": "T" } }, { "kind": "substitution", "ref": 70, "refBase": "T", "readBase": "A", "read": 6, "common": false, "notFixed": { "from": { "ref": 67, "read": 4, "readAsSupplied": 21 }, "to": { "ref": 74, "read": 10, "readAsSupplied": 15 } }, "asSupplied": { "read": 19, "readBase": "T" } }, { "kind": "substitution", "ref": 71, "refBase": "G", "readBase": "C", "read": 7, "common": false, "notFixed": { "from": { "ref": 67, "read": 4, "readAsSupplied": 21 }, "to": { "ref": 74, "read": 10, "readAsSupplied": 15 } }, "asSupplied": { "read": 18, "readBase": "G" } }, { "kind": "substitution", "ref": 72, "refBase": "G", "readBase": "C", "read": 8, "common": false, "notFixed": { "from": { "ref": 67, "read": 4, "readAsSupplied": 21 }, "to": { "ref": 74, "read": 10, "readAsSupplied": 15 } }, "asSupplied": { "read": 17, "readBase": "G" } }, { "kind": "substitution", "ref": 73, "refBase": "T", "readBase": "A", "read": 9, "common": false, "notFixed": { "from": { "ref": 67, "read": 4, "readAsSupplied": 21 }, "to": { "ref": 74, "read": 10, "readAsSupplied": 15 } }, "asSupplied": { "read": 16, "readBase": "T" } }, { "kind": "substitution", "ref": 76, "refBase": "G", "readBase": "A", "read": 12, "common": true, "asSupplied": { "read": 13, "readBase": "T" } }, { "kind": "substitution", "ref": 78, "refBase": "A", "readBase": "C", "read": 14, "common": true, "asSupplied": { "read": 11, "readBase": "G" } }, { "kind": "deletion", "refStart": 80, "refEnd": 1, "length": 2, "bases": "AG", "readAfter": 15, "crossesOrigin": true, "asSupplied": { "readBetween": [ 9, 10 ] }, "common": false, "notFixed": { "from": { "ref": 79, "read": 15, "readAsSupplied": 10 }, "to": { "ref": 3, "read": 17, "readAsSupplied": 8 } } }, { "kind": "substitution", "ref": 4, "refBase": "G", "readBase": "C", "read": 18, "common": true, "asSupplied": { "read": 7, "readBase": "G" } }, { "kind": "deletion", "refStart": 6, "refEnd": 10, "length": 5, "bases": "TGGTT", "readAfter": 19, "asSupplied": { "readBetween": [ 5, 6 ] }, "common": true }, { "kind": "deletion", "refStart": 13, "refEnd": 14, "length": 2, "bases": "CA", "readAfter": 21, "asSupplied": { "readBetween": [ 3, 4 ] }, "common": true }, { "kind": "deletion", "refStart": 17, "refEnd": 19, "length": 3, "bases": "GAT", "readAfter": 23, "asSupplied": { "readBetween": [ 1, 2 ] }, "common": true } ] }, "band": { "diagonalMin": 0, "diagonalMax": 16, "cellsNeeded": 473, "unionBandLimited": false, "scope": "every optimal path", "gridCells": 1025, "searchedBanded": false, "sharedWords": 0, "sharedWordsOverCap": false, "seedGuarantee": { "differencesUpTo": 46, "guaranteed": false } }, "enumeration": "listed", "alignments": [ [ [ 0, 2, 4, 5, 7, 8, 19, 21, 25, 30, 32, 34, 36, 39, 40 ], [ 0, 0, 2, 2, 4, 4, 15, 15, 19, 19, 21, 21, 23, 23, 24 ] ], [ [ 0, 2, 4, 5, 8, 9, 19, 21, 25, 30, 32, 34, 36, 39, 40 ], [ 0, 0, 2, 2, 5, 5, 15, 15, 19, 19, 21, 21, 23, 23, 24 ] ], [ [ 0, 2, 4, 5, 9, 10, 19, 21, 25, 30, 32, 34, 36, 39, 40 ], [ 0, 0, 2, 2, 6, 6, 15, 15, 19, 19, 21, 21, 23, 23, 24 ] ], [ [ 0, 2, 4, 5, 10, 11, 19, 21, 25, 30, 32, 34, 36, 39, 40 ], [ 0, 0, 2, 2, 7, 7, 15, 15, 19, 19, 21, 21, 23, 23, 24 ] ], [ [ 0, 2, 4, 5, 11, 12, 19, 21, 25, 30, 32, 34, 36, 39, 40 ], [ 0, 0, 2, 2, 8, 8, 15, 15, 19, 19, 21, 21, 23, 23, 24 ] ], [ [ 0, 2, 4, 5, 12, 13, 19, 21, 25, 30, 32, 34, 36, 39, 40 ], [ 0, 0, 2, 2, 9, 9, 15, 15, 19, 19, 21, 21, 23, 23, 24 ] ], [ [ 0, 2, 4, 5, 7, 8, 20, 22, 25, 30, 32, 34, 36, 39, 40 ], [ 0, 0, 2, 2, 4, 4, 16, 16, 19, 19, 21, 21, 23, 23, 24 ] ], [ [ 0, 2, 4, 5, 8, 9, 20, 22, 25, 30, 32, 34, 36, 39, 40 ], [ 0, 0, 2, 2, 5, 5, 16, 16, 19, 19, 21, 21, 23, 23, 24 ] ], [ [ 0, 2, 4, 5, 9, 10, 20, 22, 25, 30, 32, 34, 36, 39, 40 ], [ 0, 0, 2, 2, 6, 6, 16, 16, 19, 19, 21, 21, 23, 23, 24 ] ], [ [ 0, 2, 4, 5, 10, 11, 20, 22, 25, 30, 32, 34, 36, 39, 40 ], [ 0, 0, 2, 2, 7, 7, 16, 16, 19, 19, 21, 21, 23, 23, 24 ] ], [ [ 0, 2, 4, 5, 11, 12, 20, 22, 25, 30, 32, 34, 36, 39, 40 ], [ 0, 0, 2, 2, 8, 8, 16, 16, 19, 19, 21, 21, 23, 23, 24 ] ], [ [ 0, 2, 4, 5, 12, 13, 20, 22, 25, 30, 32, 34, 36, 39, 40 ], [ 0, 0, 2, 2, 9, 9, 16, 16, 19, 19, 21, 21, 23, 23, 24 ] ] ], "tuples": [ [ 16, 0, 40, 8, 16, 7, 24, 38 ] ], "tupleFields": [ "identical", "ambiguousColumns", "columns", "mismatches", "gapColumns", "gapOpens", "readAligned", "referenceCovered" ], "variation": { "readAligned": { "shared": true, "min": 24, "max": 24 }, "referenceCovered": { "shared": true, "min": 38, "max": 38 }, "identity": { "shared": true, "min": { "numerator": 2, "denominator": 5 }, "max": { "numerator": 2, "denominator": 5 } }, "overhangStart": { "shared": true, "min": 0, "max": 0 }, "overhangEnd": { "shared": true, "min": 0, "max": 0 } }, "placements": [ { "refStart": 63, "refEnd": 20, "crossesOrigin": true, "wholeCircle": false, "readStart": 1, "readEnd": 24, "asSupplied": { "readStart": 1, "readEnd": 24 }, "alignments": 12, "band": { "diagonalMin": 0, "diagonalMax": 16, "cellsNeeded": 473, "bandLimited": false } } ] } }, { "mode": "semiglobal-read", "region": { "from": 61, "to": 20, "length": 40, "acrossOrigin": true }, "strand": "+", "strandUndetermined": false, "plus": { "score": 43, "count": 1, "overCap": false, "state": "aligned", "biopython": { "score": 43, "count": 1 }, "uniquePairs": [ [ 71, 1 ], [ 72, 2 ], [ 73, 3 ], [ 74, 4 ], [ 75, 5 ], [ 76, 6 ], [ 77, 7 ], [ 78, 8 ], [ 79, 9 ], [ 80, 10 ], [ 1, 11 ], [ 2, 12 ], [ 3, 13 ], [ 4, 14 ], [ 5, 15 ], [ 6, 16 ], [ 7, 17 ], [ 8, 18 ], [ 9, 19 ], [ 10, 20 ], [ 11, 21 ], [ 12, 22 ], [ 13, 23 ], [ 14, 24 ] ], "uniquePlacement": true, "placementNotDetermined": false, "noCommonColumn": false, "hull": { "refStart": 71, "refEnd": 14, "crossesOrigin": true, "wholeCircle": false }, "selected": { "coordinates": [ [ 0, 10, 34, 40 ], [ 0, 0, 24, 24 ] ], "gappedReference": "GGTGCGGATAGATGCTGGTTGCCA", "gappedRead": "GGTGCGGATAGCTGCTGGTTGCCA", "columns": 24, "identical": 23, "mismatches": 1, "ambiguousColumns": 0, "gapColumns": 0, "gapOpens": 0, "identity": { "numerator": 23, "denominator": 24 }, "readAligned": { "bases": 24, "of": 24 }, "referenceCovered": { "bases": 24, "of": 40 }, "placement": { "refStart": 71, "refEnd": 14, "readStart": 1, "readEnd": 24, "crossesOrigin": true }, "overhang": [], "differences": [ { "kind": "substitution", "ref": 2, "refBase": "A", "readBase": "C", "read": 12, "common": true } ] }, "band": { "diagonalMin": 10, "diagonalMax": 10, "cellsNeeded": 75, "unionBandLimited": false, "scope": "every optimal path", "gridCells": 1025, "searchedBanded": false, "sharedWords": 1, "sharedWordsOverCap": false, "seedGuarantee": { "differencesUpTo": 2, "guaranteed": false } }, "enumeration": "listed", "alignments": [ [ [ 0, 10, 34, 40 ], [ 0, 0, 24, 24 ] ] ], "tuples": [ [ 23, 0, 24, 1, 0, 0, 24, 24 ] ], "tupleFields": [ "identical", "ambiguousColumns", "columns", "mismatches", "gapColumns", "gapOpens", "readAligned", "referenceCovered" ], "variation": { "readAligned": { "shared": true, "min": 24, "max": 24 }, "referenceCovered": { "shared": true, "min": 24, "max": 24 }, "identity": { "shared": true, "min": { "numerator": 23, "denominator": 24 }, "max": { "numerator": 23, "denominator": 24 } }, "overhangStart": { "shared": true, "min": 0, "max": 0 }, "overhangEnd": { "shared": true, "min": 0, "max": 0 } }, "placements": [ { "refStart": 71, "refEnd": 14, "crossesOrigin": true, "wholeCircle": false, "readStart": 1, "readEnd": 24, "alignments": 1, "band": { "diagonalMin": 10, "diagonalMax": 10, "cellsNeeded": 75, "bandLimited": false } } ] }, "minus": { "score": -16, "count": 3, "overCap": false, "state": "aligned", "biopython": { "score": -16, "count": 3 }, "uniquePairs": [ [ 4, 10 ], [ 5, 11 ], [ 6, 12 ], [ 7, 13 ], [ 8, 14 ], [ 9, 15 ], [ 10, 17 ], [ 11, 18 ], [ 12, 19 ], [ 13, 21 ], [ 14, 22 ], [ 15, 23 ], [ 16, 24 ] ], "uniquePlacement": true, "placementNotDetermined": false, "noCommonColumn": false, "hull": { "refStart": 73, "refEnd": 16, "crossesOrigin": true, "wholeCircle": false }, "selected": { "coordinates": [ [ 0, 14, 29, 29, 32, 32, 36, 40 ], [ 0, 0, 15, 16, 19, 20, 24, 24 ] ], "gappedReference": "CGGATAGATGCTGGT-TGC-CAAC", "gappedRead": "TGGCAACCAGCAGCTATCCGCACC", "columns": 24, "identical": 12, "mismatches": 10, "ambiguousColumns": 0, "gapColumns": 2, "gapOpens": 2, "identity": { "numerator": 12, "denominator": 24 }, "readAligned": { "bases": 24, "of": 24 }, "referenceCovered": { "bases": 22, "of": 40 }, "placement": { "refStart": 75, "refEnd": 16, "readStart": 1, "readEnd": 24, "crossesOrigin": true, "asSupplied": { "readStart": 1, "readEnd": 24 } }, "overhang": [], "differences": [ { "kind": "substitution", "ref": 75, "refBase": "C", "readBase": "T", "read": 1, "common": false, "notFixed": { "from": null, "to": { "ref": 4, "read": 10, "readAsSupplied": 15 } }, "asSupplied": { "read": 24, "readBase": "A" } }, { "kind": "substitution", "ref": 78, "refBase": "A", "readBase": "C", "read": 4, "common": false, "notFixed": { "from": null, "to": { "ref": 4, "read": 10, "readAsSupplied": 15 } }, "asSupplied": { "read": 21, "readBase": "G" } }, { "kind": "substitution", "ref": 79, "refBase": "T", "readBase": "A", "read": 5, "common": false, "notFixed": { "from": null, "to": { "ref": 4, "read": 10, "readAsSupplied": 15 } }, "asSupplied": { "read": 20, "readBase": "T" } }, { "kind": "substitution", "ref": 1, "refBase": "G", "readBase": "C", "read": 7, "common": false, "notFixed": { "from": null, "to": { "ref": 4, "read": 10, "readAsSupplied": 15 } }, "asSupplied": { "read": 18, "readBase": "G" } }, { "kind": "substitution", "ref": 2, "refBase": "A", "readBase": "C", "read": 8, "common": false, "notFixed": { "from": null, "to": { "ref": 4, "read": 10, "readAsSupplied": 15 } }, "asSupplied": { "read": 17, "readBase": "G" } }, { "kind": "substitution", "ref": 3, "refBase": "T", "readBase": "A", "read": 9, "common": false, "notFixed": { "from": null, "to": { "ref": 4, "read": 10, "readAsSupplied": 15 } }, "asSupplied": { "read": 16, "readBase": "T" } }, { "kind": "substitution", "ref": 6, "refBase": "T", "readBase": "A", "read": 12, "common": true, "asSupplied": { "read": 13, "readBase": "T" } }, { "kind": "substitution", "ref": 8, "refBase": "G", "readBase": "C", "read": 14, "common": true, "asSupplied": { "read": 11, "readBase": "G" } }, { "kind": "insertion", "refAfter": 9, "length": 1, "bases": "A", "readStart": 16, "readEnd": 16, "asSupplied": { "readStart": 9, "readEnd": 9, "bases": "T" }, "common": true }, { "kind": "substitution", "ref": 11, "refBase": "G", "readBase": "C", "read": 18, "common": true, "asSupplied": { "read": 7, "readBase": "G" } }, { "kind": "insertion", "refAfter": 12, "length": 1, "bases": "G", "readStart": 20, "readEnd": 20, "asSupplied": { "readStart": 5, "readEnd": 5, "bases": "C" }, "common": true }, { "kind": "substitution", "ref": 15, "refBase": "A", "readBase": "C", "read": 23, "common": true, "asSupplied": { "read": 2, "readBase": "G" } } ] }, "band": { "diagonalMin": 12, "diagonalMax": 14, "cellsNeeded": 125, "unionBandLimited": false, "scope": "every optimal path", "gridCells": 1025, "searchedBanded": false, "sharedWords": 0, "sharedWordsOverCap": false, "seedGuarantee": { "differencesUpTo": 32, "guaranteed": false } }, "enumeration": "listed", "alignments": [ [ [ 0, 14, 29, 29, 32, 32, 36, 40 ], [ 0, 0, 15, 16, 19, 20, 24, 24 ] ], [ [ 0, 12, 14, 15, 18, 19, 29, 29, 32, 32, 36, 40 ], [ 0, 0, 2, 2, 5, 5, 15, 16, 19, 20, 24, 24 ] ], [ [ 0, 12, 14, 15, 22, 23, 29, 29, 32, 32, 36, 40 ], [ 0, 0, 2, 2, 9, 9, 15, 16, 19, 20, 24, 24 ] ] ], "tuples": [ [ 12, 0, 24, 10, 2, 2, 24, 22 ], [ 14, 0, 26, 8, 4, 4, 24, 24 ] ], "tupleFields": [ "identical", "ambiguousColumns", "columns", "mismatches", "gapColumns", "gapOpens", "readAligned", "referenceCovered" ], "variation": { "readAligned": { "shared": true, "min": 24, "max": 24 }, "referenceCovered": { "shared": false, "min": 22, "max": 24 }, "identity": { "shared": false, "min": { "numerator": 1, "denominator": 2 }, "max": { "numerator": 7, "denominator": 13 } }, "overhangStart": { "shared": true, "min": 0, "max": 0 }, "overhangEnd": { "shared": true, "min": 0, "max": 0 } }, "placements": [ { "refStart": 73, "refEnd": 16, "crossesOrigin": true, "wholeCircle": false, "readStart": 1, "readEnd": 24, "asSupplied": { "readStart": 1, "readEnd": 24 }, "alignments": 3, "band": { "diagonalMin": 12, "diagonalMax": 14, "cellsNeeded": 125, "bandLimited": false } } ] } }, { "mode": "local", "region": { "from": 61, "to": 20, "length": 40, "acrossOrigin": true }, "strand": "+", "strandUndetermined": false, "plus": { "score": 43, "count": 1, "overCap": false, "state": "aligned", "biopython": { "score": 43, "count": 1 }, "uniquePairs": [ [ 71, 1 ], [ 72, 2 ], [ 73, 3 ], [ 74, 4 ], [ 75, 5 ], [ 76, 6 ], [ 77, 7 ], [ 78, 8 ], [ 79, 9 ], [ 80, 10 ], [ 1, 11 ], [ 2, 12 ], [ 3, 13 ], [ 4, 14 ], [ 5, 15 ], [ 6, 16 ], [ 7, 17 ], [ 8, 18 ], [ 9, 19 ], [ 10, 20 ], [ 11, 21 ], [ 12, 22 ], [ 13, 23 ], [ 14, 24 ] ], "uniquePlacement": true, "placementNotDetermined": false, "noCommonColumn": false, "hull": { "refStart": 71, "refEnd": 14, "crossesOrigin": true, "wholeCircle": false }, "selected": { "coordinates": [ [ 10, 34 ], [ 0, 24 ] ], "gappedReference": "GGTGCGGATAGATGCTGGTTGCCA", "gappedRead": "GGTGCGGATAGCTGCTGGTTGCCA", "columns": 24, "identical": 23, "mismatches": 1, "ambiguousColumns": 0, "gapColumns": 0, "gapOpens": 0, "identity": { "numerator": 23, "denominator": 24 }, "readAligned": { "bases": 24, "of": 24 }, "referenceCovered": { "bases": 24, "of": 40 }, "placement": { "refStart": 71, "refEnd": 14, "readStart": 1, "readEnd": 24, "crossesOrigin": true }, "overhang": [], "differences": [ { "kind": "substitution", "ref": 2, "refBase": "A", "readBase": "C", "read": 12, "common": true } ] }, "band": { "diagonalMin": 10, "diagonalMax": 10, "cellsNeeded": 75, "unionBandLimited": false, "scope": "every optimal path", "gridCells": 1025, "searchedBanded": false, "sharedWords": 1, "sharedWordsOverCap": false, "seedGuarantee": { "differencesUpTo": 2, "guaranteed": false } }, "enumeration": "listed", "alignments": [ [ [ 10, 34 ], [ 0, 24 ] ] ], "tuples": [ [ 23, 0, 24, 1, 0, 0, 24, 24 ] ], "tupleFields": [ "identical", "ambiguousColumns", "columns", "mismatches", "gapColumns", "gapOpens", "readAligned", "referenceCovered" ], "variation": { "readAligned": { "shared": true, "min": 24, "max": 24 }, "referenceCovered": { "shared": true, "min": 24, "max": 24 }, "identity": { "shared": true, "min": { "numerator": 23, "denominator": 24 }, "max": { "numerator": 23, "denominator": 24 } }, "overhangStart": { "shared": true, "min": 0, "max": 0 }, "overhangEnd": { "shared": true, "min": 0, "max": 0 } }, "placements": [ { "refStart": 71, "refEnd": 14, "crossesOrigin": true, "wholeCircle": false, "readStart": 1, "readEnd": 24, "alignments": 1, "band": { "diagonalMin": 10, "diagonalMax": 10, "cellsNeeded": 75, "bandLimited": false } } ] }, "minus": { "score": 9, "count": 1, "overCap": false, "state": "aligned", "biopython": { "score": 9, "count": 1 }, "uniquePairs": [ [ 10, 1 ], [ 11, 2 ], [ 12, 3 ], [ 13, 4 ], [ 14, 5 ], [ 15, 6 ], [ 16, 7 ] ], "uniquePlacement": true, "placementNotDetermined": false, "noCommonColumn": false, "hull": { "refStart": 10, "refEnd": 16, "crossesOrigin": false, "wholeCircle": false }, "selected": { "coordinates": [ [ 29, 36 ], [ 0, 7 ] ], "gappedReference": "TGCCAAC", "gappedRead": "TGGCAAC", "columns": 7, "identical": 6, "mismatches": 1, "ambiguousColumns": 0, "gapColumns": 0, "gapOpens": 0, "identity": { "numerator": 6, "denominator": 7 }, "readAligned": { "bases": 7, "of": 24 }, "referenceCovered": { "bases": 7, "of": 40 }, "placement": { "refStart": 10, "refEnd": 16, "readStart": 1, "readEnd": 7, "crossesOrigin": false, "asSupplied": { "readStart": 18, "readEnd": 24 } }, "overhang": [], "differences": [ { "kind": "substitution", "ref": 12, "refBase": "C", "readBase": "G", "read": 3, "common": true, "asSupplied": { "read": 22, "readBase": "C" } } ] }, "band": { "diagonalMin": 29, "diagonalMax": 29, "cellsNeeded": 36, "unionBandLimited": false, "scope": "every optimal path", "gridCells": 1025, "searchedBanded": false, "sharedWords": 0, "sharedWordsOverCap": false, "seedGuarantee": { "differencesUpTo": 19, "guaranteed": false } }, "enumeration": "listed", "alignments": [ [ [ 29, 36 ], [ 0, 7 ] ] ], "tuples": [ [ 6, 0, 7, 1, 0, 0, 7, 7 ] ], "tupleFields": [ "identical", "ambiguousColumns", "columns", "mismatches", "gapColumns", "gapOpens", "readAligned", "referenceCovered" ], "variation": { "readAligned": { "shared": true, "min": 7, "max": 7 }, "referenceCovered": { "shared": true, "min": 7, "max": 7 }, "identity": { "shared": true, "min": { "numerator": 6, "denominator": 7 }, "max": { "numerator": 6, "denominator": 7 } }, "overhangStart": { "shared": true, "min": 0, "max": 0 }, "overhangEnd": { "shared": true, "min": 0, "max": 0 } }, "placements": [ { "refStart": 10, "refEnd": 16, "crossesOrigin": false, "wholeCircle": false, "readStart": 1, "readEnd": 7, "asSupplied": { "readStart": 18, "readEnd": 24 }, "alignments": 1, "band": { "diagonalMin": 29, "diagonalMax": 29, "cellsNeeded": 36, "bandLimited": false } } ] } } ] } }, { "id": "circle-pairs-folded", "note": "The CSO's separating case (final reading, ruling 4 item 2): a circle of four (GTAC) and the read TAG. On the minus strand the read's pairs fall in either copy of the certified text; they are the same pairs of the reference, so the positions, the shared pairs, the groups and the hull are taken modulo n.", "input": { "reference": { "residues": "GTAC", "topology": "circular" }, "read": { "residues": "TAG" }, "modes": [ "semiglobal-read", "local" ] }, "expected": { "results": [ { "mode": "semiglobal-read", "region": null, "strand": "ambiguous", "strandUndetermined": true, "plus": { "score": 1, "count": 2, "overCap": false, "state": "aligned", "biopython": { "score": 1, "count": 4, "tailScore": 1, "tailCountSubtracted": 2, "certifiedText": { "extension": 3, "textLength": 9, "reruns": 0, "differencesUpTo": 2 } }, "uniquePairs": [ [ 2, 1 ], [ 3, 2 ] ], "uniquePlacement": true, "placementNotDetermined": false, "noCommonColumn": false, "hull": { "refStart": 1, "refEnd": 4, "crossesOrigin": false, "wholeCircle": true }, "selected": { "coordinates": [ [ 0, 1, 4 ], [ 0, 0, 3 ] ], "gappedReference": "TAC", "gappedRead": "TAG", "columns": 3, "identical": 2, "mismatches": 1, "ambiguousColumns": 0, "gapColumns": 0, "gapOpens": 0, "identity": { "numerator": 2, "denominator": 3 }, "readAligned": { "bases": 3, "of": 3 }, "referenceCovered": { "bases": 3, "of": 4 }, "placement": { "refStart": 2, "refEnd": 4, "readStart": 1, "readEnd": 3, "crossesOrigin": false }, "overhang": [], "differences": [ { "kind": "substitution", "ref": 4, "refBase": "C", "readBase": "G", "read": 3, "common": false, "notFixed": { "from": { "ref": 3, "read": 2 }, "to": null } } ] }, "band": { "diagonalMin": 1, "diagonalMax": 2, "cellsNeeded": 16, "unionBandLimited": false, "scope": "every optimal path", "gridCells": 40, "searchedBanded": false, "sharedWords": 0, "sharedWordsOverCap": false, "seedGuarantee": { "differencesUpTo": 2, "guaranteed": false } }, "enumeration": "listed", "alignments": [ [ [ 0, 1, 4 ], [ 0, 0, 3 ] ], [ [ 0, 1, 3, 4, 5 ], [ 0, 0, 2, 2, 3 ] ] ], "tuples": [ [ 2, 0, 3, 1, 0, 0, 3, 3 ], [ 3, 0, 4, 0, 1, 1, 3, 4 ] ], "tupleFields": [ "identical", "ambiguousColumns", "columns", "mismatches", "gapColumns", "gapOpens", "readAligned", "referenceCovered" ], "variation": { "readAligned": { "shared": true, "min": 3, "max": 3 }, "referenceCovered": { "shared": false, "min": 3, "max": 4 }, "identity": { "shared": false, "min": { "numerator": 2, "denominator": 3 }, "max": { "numerator": 3, "denominator": 4 } }, "overhangStart": { "shared": true, "min": 0, "max": 0 }, "overhangEnd": { "shared": true, "min": 0, "max": 0 } }, "placements": [ { "refStart": 1, "refEnd": 4, "crossesOrigin": false, "wholeCircle": true, "readStart": 1, "readEnd": 3, "alignments": 2, "band": { "diagonalMin": 1, "diagonalMax": 2, "cellsNeeded": 16, "bandLimited": false } } ] }, "minus": { "score": 1, "count": 2, "overCap": false, "state": "aligned", "biopython": { "score": 1, "count": 3, "tailScore": 1, "tailCountSubtracted": 1, "certifiedText": { "extension": 3, "textLength": 9, "reruns": 0, "differencesUpTo": 2 } }, "uniquePairs": [ [ 2, 2 ], [ 3, 3 ] ], "uniquePlacement": true, "placementNotDetermined": false, "noCommonColumn": false, "hull": { "refStart": 1, "refEnd": 4, "crossesOrigin": false, "wholeCircle": true }, "selected": { "coordinates": [ [ 0, 3 ], [ 0, 3 ] ], "gappedReference": "GTA", "gappedRead": "CTA", "columns": 3, "identical": 2, "mismatches": 1, "ambiguousColumns": 0, "gapColumns": 0, "gapOpens": 0, "identity": { "numerator": 2, "denominator": 3 }, "readAligned": { "bases": 3, "of": 3 }, "referenceCovered": { "bases": 3, "of": 4 }, "placement": { "refStart": 1, "refEnd": 3, "readStart": 1, "readEnd": 3, "crossesOrigin": false, "asSupplied": { "readStart": 1, "readEnd": 3 } }, "overhang": [], "differences": [ { "kind": "substitution", "ref": 1, "refBase": "G", "readBase": "C", "read": 1, "common": false, "notFixed": { "from": null, "to": { "ref": 2, "read": 2, "readAsSupplied": 2 } }, "asSupplied": { "read": 3, "readBase": "G" } } ] }, "band": { "diagonalMin": 0, "diagonalMax": 4, "cellsNeeded": 27, "unionBandLimited": false, "scope": "every optimal path", "gridCells": 40, "searchedBanded": false, "sharedWords": 0, "sharedWordsOverCap": false, "seedGuarantee": { "differencesUpTo": 2, "guaranteed": false } }, "enumeration": "listed", "alignments": [ [ [ 0, 3 ], [ 0, 3 ] ], [ [ 0, 3, 4, 5, 7 ], [ 0, 0, 1, 1, 3 ] ] ], "tuples": [ [ 2, 0, 3, 1, 0, 0, 3, 3 ], [ 3, 0, 4, 0, 1, 1, 3, 4 ] ], "tupleFields": [ "identical", "ambiguousColumns", "columns", "mismatches", "gapColumns", "gapOpens", "readAligned", "referenceCovered" ], "variation": { "readAligned": { "shared": true, "min": 3, "max": 3 }, "referenceCovered": { "shared": false, "min": 3, "max": 4 }, "identity": { "shared": false, "min": { "numerator": 2, "denominator": 3 }, "max": { "numerator": 3, "denominator": 4 } }, "overhangStart": { "shared": true, "min": 0, "max": 0 }, "overhangEnd": { "shared": true, "min": 0, "max": 0 } }, "placements": [ { "refStart": 1, "refEnd": 4, "crossesOrigin": false, "wholeCircle": true, "readStart": 1, "readEnd": 3, "asSupplied": { "readStart": 1, "readEnd": 3 }, "alignments": 2, "band": { "diagonalMin": 0, "diagonalMax": 4, "cellsNeeded": 27, "bandLimited": false } } ] } }, { "mode": "local", "region": null, "strand": "ambiguous", "strandUndetermined": true, "plus": { "score": 4, "count": 1, "overCap": false, "state": "aligned", "biopython": { "score": 4, "count": 2, "tailScore": 4, "tailCountSubtracted": 1, "certifiedText": { "extension": 3, "textLength": 9, "reruns": 0, "differencesUpTo": 1 } }, "uniquePairs": [ [ 2, 1 ], [ 3, 2 ] ], "uniquePlacement": true, "placementNotDetermined": false, "noCommonColumn": false, "hull": { "refStart": 2, "refEnd": 3, "crossesOrigin": false, "wholeCircle": false }, "selected": { "coordinates": [ [ 1, 3 ], [ 0, 2 ] ], "gappedReference": "TA", "gappedRead": "TA", "columns": 2, "identical": 2, "mismatches": 0, "ambiguousColumns": 0, "gapColumns": 0, "gapOpens": 0, "identity": { "numerator": 2, "denominator": 2 }, "readAligned": { "bases": 2, "of": 3 }, "referenceCovered": { "bases": 2, "of": 4 }, "placement": { "refStart": 2, "refEnd": 3, "readStart": 1, "readEnd": 2, "crossesOrigin": false }, "overhang": [], "differences": [] }, "band": { "diagonalMin": 1, "diagonalMax": 1, "cellsNeeded": 12, "unionBandLimited": false, "scope": "every optimal path", "gridCells": 40, "searchedBanded": false, "sharedWords": 0, "sharedWordsOverCap": false, "seedGuarantee": { "differencesUpTo": 1, "guaranteed": false } }, "enumeration": "listed", "alignments": [ [ [ 1, 3 ], [ 0, 2 ] ] ], "tuples": [ [ 2, 0, 2, 0, 0, 0, 2, 2 ] ], "tupleFields": [ "identical", "ambiguousColumns", "columns", "mismatches", "gapColumns", "gapOpens", "readAligned", "referenceCovered" ], "variation": { "readAligned": { "shared": true, "min": 2, "max": 2 }, "referenceCovered": { "shared": true, "min": 2, "max": 2 }, "identity": { "shared": true, "min": { "numerator": 1, "denominator": 1 }, "max": { "numerator": 1, "denominator": 1 } }, "overhangStart": { "shared": true, "min": 0, "max": 0 }, "overhangEnd": { "shared": true, "min": 0, "max": 0 } }, "placements": [ { "refStart": 2, "refEnd": 3, "crossesOrigin": false, "wholeCircle": false, "readStart": 1, "readEnd": 2, "alignments": 1, "band": { "diagonalMin": 1, "diagonalMax": 1, "cellsNeeded": 12, "bandLimited": false } } ] }, "minus": { "score": 4, "count": 1, "overCap": false, "state": "aligned", "biopython": { "score": 4, "count": 2, "tailScore": 4, "tailCountSubtracted": 1, "certifiedText": { "extension": 3, "textLength": 9, "reruns": 0, "differencesUpTo": 1 } }, "uniquePairs": [ [ 2, 2 ], [ 3, 3 ] ], "uniquePlacement": true, "placementNotDetermined": false, "noCommonColumn": false, "hull": { "refStart": 2, "refEnd": 3, "crossesOrigin": false, "wholeCircle": false }, "selected": { "coordinates": [ [ 1, 3 ], [ 1, 3 ] ], "gappedReference": "TA", "gappedRead": "TA", "columns": 2, "identical": 2, "mismatches": 0, "ambiguousColumns": 0, "gapColumns": 0, "gapOpens": 0, "identity": { "numerator": 2, "denominator": 2 }, "readAligned": { "bases": 2, "of": 3 }, "referenceCovered": { "bases": 2, "of": 4 }, "placement": { "refStart": 2, "refEnd": 3, "readStart": 2, "readEnd": 3, "crossesOrigin": false, "asSupplied": { "readStart": 1, "readEnd": 2 } }, "overhang": [], "differences": [] }, "band": { "diagonalMin": 0, "diagonalMax": 0, "cellsNeeded": 11, "unionBandLimited": false, "scope": "every optimal path", "gridCells": 40, "searchedBanded": false, "sharedWords": 0, "sharedWordsOverCap": false, "seedGuarantee": { "differencesUpTo": 1, "guaranteed": false } }, "enumeration": "listed", "alignments": [ [ [ 1, 3 ], [ 1, 3 ] ] ], "tuples": [ [ 2, 0, 2, 0, 0, 0, 2, 2 ] ], "tupleFields": [ "identical", "ambiguousColumns", "columns", "mismatches", "gapColumns", "gapOpens", "readAligned", "referenceCovered" ], "variation": { "readAligned": { "shared": true, "min": 2, "max": 2 }, "referenceCovered": { "shared": true, "min": 2, "max": 2 }, "identity": { "shared": true, "min": { "numerator": 1, "denominator": 1 }, "max": { "numerator": 1, "denominator": 1 } }, "overhangStart": { "shared": true, "min": 0, "max": 0 }, "overhangEnd": { "shared": true, "min": 0, "max": 0 } }, "placements": [ { "refStart": 2, "refEnd": 3, "crossesOrigin": false, "wholeCircle": false, "readStart": 2, "readEnd": 3, "asSupplied": { "readStart": 1, "readEnd": 2 }, "alignments": 1, "band": { "diagonalMin": 0, "diagonalMax": 0, "cellsNeeded": 11, "bandLimited": false } } ] } } ] } }, { "id": "no-paired-letter", "note": "semiglobal-read where no co-optimal alignment pairs a letter: six A against ten C cost less as one gap (−15) than as six mismatches (−18), and the gap may sit before, inside or after the reference, eleven ways. The score and the count, nothing placed (ruling 4 item 4).", "input": { "reference": { "residues": "CCCCCCCCCC", "topology": "linear" }, "read": { "residues": "AAAAAA" }, "modes": [ "semiglobal-read" ] }, "expected": { "results": [ { "mode": "semiglobal-read", "region": null, "strand": "none", "strandUndetermined": false, "plus": { "score": -15, "count": 11, "overCap": false, "state": "no-paired-letter", "biopython": { "score": -15, "count": 11 } }, "minus": { "score": -15, "count": 11, "overCap": false, "state": "no-paired-letter", "biopython": { "score": -15, "count": 11 } } } ] } }, { "id": "insertion-after-free-gap", "note": "An insertion after a free leading gap: GGGGG then J01636.1 1221-1240 on 1201-1260; the five G cost less inserted than mismatched, after reference position 20, not 0 (ruling 4 item 3).", "input": { "reference": { "residues": "ACCCCAGGCTTTACACTTTATGCTTCCGGCTCGTATGTTGTGTGGAATTGTGAGCGGATA", "topology": "linear", "source": "J01636.1 1201-1260" }, "read": { "residues": "GGGGGTGCTTCCGGCTCGTATGTTG", "source": "GGGGG then J01636.1 1221-1240" }, "modes": [ "semiglobal-read" ] }, "expected": { "results": [ { "mode": "semiglobal-read", "region": null, "strand": "+", "strandUndetermined": false, "plus": { "score": 27, "count": 1, "overCap": false, "state": "aligned", "biopython": { "score": 27, "count": 1 }, "uniquePairs": [ [ 21, 6 ], [ 22, 7 ], [ 23, 8 ], [ 24, 9 ], [ 25, 10 ], [ 26, 11 ], [ 27, 12 ], [ 28, 13 ], [ 29, 14 ], [ 30, 15 ], [ 31, 16 ], [ 32, 17 ], [ 33, 18 ], [ 34, 19 ], [ 35, 20 ], [ 36, 21 ], [ 37, 22 ], [ 38, 23 ], [ 39, 24 ], [ 40, 25 ] ], "uniquePlacement": true, "placementNotDetermined": false, "noCommonColumn": false, "hull": { "refStart": 21, "refEnd": 40, "crossesOrigin": false, "wholeCircle": false }, "selected": { "coordinates": [ [ 0, 20, 20, 40, 60 ], [ 0, 0, 5, 25, 25 ] ], "gappedReference": "-----TGCTTCCGGCTCGTATGTTG", "gappedRead": "GGGGGTGCTTCCGGCTCGTATGTTG", "columns": 25, "identical": 20, "mismatches": 0, "ambiguousColumns": 0, "gapColumns": 5, "gapOpens": 1, "identity": { "numerator": 20, "denominator": 25 }, "readAligned": { "bases": 20, "of": 25 }, "referenceCovered": { "bases": 20, "of": 60 }, "placement": { "refStart": 21, "refEnd": 40, "readStart": 6, "readEnd": 25, "crossesOrigin": false }, "overhang": [], "differences": [ { "kind": "insertion", "refAfter": 20, "length": 5, "bases": "GGGGG", "readStart": 1, "readEnd": 5, "common": true } ] }, "band": { "diagonalMin": 15, "diagonalMax": 19, "cellsNeeded": 182, "unionBandLimited": false, "scope": "every optimal path", "gridCells": 1586, "searchedBanded": false, "sharedWords": 9, "sharedWordsOverCap": false, "seedGuarantee": { "differencesUpTo": 11, "guaranteed": false } }, "enumeration": "listed", "alignments": [ [ [ 0, 20, 20, 40, 60 ], [ 0, 0, 5, 25, 25 ] ] ], "tuples": [ [ 20, 0, 25, 0, 5, 1, 20, 20 ] ], "tupleFields": [ "identical", "ambiguousColumns", "columns", "mismatches", "gapColumns", "gapOpens", "readAligned", "referenceCovered" ], "variation": { "readAligned": { "shared": true, "min": 20, "max": 20 }, "referenceCovered": { "shared": true, "min": 20, "max": 20 }, "identity": { "shared": true, "min": { "numerator": 4, "denominator": 5 }, "max": { "numerator": 4, "denominator": 5 } }, "overhangStart": { "shared": true, "min": 0, "max": 0 }, "overhangEnd": { "shared": true, "min": 0, "max": 0 } }, "placements": [ { "refStart": 21, "refEnd": 40, "crossesOrigin": false, "wholeCircle": false, "readStart": 6, "readEnd": 25, "alignments": 1, "band": { "diagonalMin": 15, "diagonalMax": 19, "cellsNeeded": 182, "bandLimited": false } } ] }, "minus": { "score": -21, "count": 3, "overCap": false, "state": "aligned", "biopython": { "score": -21, "count": 3 }, "uniquePairs": [ [ 14, 1 ], [ 15, 2 ], [ 16, 3 ], [ 17, 4 ], [ 18, 5 ], [ 19, 6 ], [ 20, 7 ], [ 21, 8 ], [ 22, 9 ], [ 26, 12 ], [ 27, 13 ], [ 28, 14 ], [ 29, 15 ], [ 30, 23 ], [ 31, 24 ], [ 32, 25 ] ], "uniquePlacement": true, "placementNotDetermined": false, "noCommonColumn": false, "hull": { "refStart": 14, "refEnd": 32, "crossesOrigin": false, "wholeCircle": false }, "selected": { "coordinates": [ [ 0, 13, 22, 23, 29, 29, 32, 60 ], [ 0, 0, 9, 9, 15, 22, 25, 25 ] ], "gappedReference": "CACTTTATGCTTCCGG-------CTC", "gappedRead": "CAACATACG-AGCCGGAAGCACCCCC", "columns": 26, "identical": 11, "mismatches": 7, "ambiguousColumns": 0, "gapColumns": 8, "gapOpens": 2, "identity": { "numerator": 11, "denominator": 26 }, "readAligned": { "bases": 25, "of": 25 }, "referenceCovered": { "bases": 19, "of": 60 }, "placement": { "refStart": 14, "refEnd": 32, "readStart": 1, "readEnd": 25, "crossesOrigin": false, "asSupplied": { "readStart": 1, "readEnd": 25 } }, "overhang": [], "differences": [ { "kind": "substitution", "ref": 16, "refBase": "C", "readBase": "A", "read": 3, "common": true, "asSupplied": { "read": 23, "readBase": "T" } }, { "kind": "substitution", "ref": 17, "refBase": "T", "readBase": "C", "read": 4, "common": true, "asSupplied": { "read": 22, "readBase": "G" } }, { "kind": "substitution", "ref": 18, "refBase": "T", "readBase": "A", "read": 5, "common": true, "asSupplied": { "read": 21, "readBase": "T" } }, { "kind": "substitution", "ref": 21, "refBase": "T", "readBase": "C", "read": 8, "common": true, "asSupplied": { "read": 18, "readBase": "G" } }, { "kind": "deletion", "refStart": 23, "refEnd": 23, "length": 1, "bases": "C", "readAfter": 9, "asSupplied": { "readBetween": [ 16, 17 ] }, "common": false, "notFixed": { "from": { "ref": 22, "read": 9, "readAsSupplied": 17 }, "to": { "ref": 26, "read": 12, "readAsSupplied": 14 } } }, { "kind": "substitution", "ref": 24, "refBase": "T", "readBase": "A", "read": 10, "common": false, "notFixed": { "from": { "ref": 22, "read": 9, "readAsSupplied": 17 }, "to": { "ref": 26, "read": 12, "readAsSupplied": 14 } }, "asSupplied": { "read": 16, "readBase": "T" } }, { "kind": "substitution", "ref": 25, "refBase": "T", "readBase": "G", "read": 11, "common": false, "notFixed": { "from": { "ref": 22, "read": 9, "readAsSupplied": 17 }, "to": { "ref": 26, "read": 12, "readAsSupplied": 14 } }, "asSupplied": { "read": 15, "readBase": "C" } }, { "kind": "insertion", "refAfter": 29, "length": 7, "bases": "AAGCACC", "readStart": 16, "readEnd": 22, "asSupplied": { "readStart": 4, "readEnd": 10, "bases": "GGTGCTT" }, "common": true }, { "kind": "substitution", "ref": 31, "refBase": "T", "readBase": "C", "read": 24, "common": true, "asSupplied": { "read": 2, "readBase": "G" } } ] }, "band": { "diagonalMin": 7, "diagonalMax": 14, "cellsNeeded": 260, "unionBandLimited": false, "scope": "every optimal path", "gridCells": 1586, "searchedBanded": false, "sharedWords": 0, "sharedWordsOverCap": false, "seedGuarantee": { "differencesUpTo": 35, "guaranteed": false } }, "enumeration": "listed", "alignments": [ [ [ 0, 13, 22, 23, 29, 29, 32, 60 ], [ 0, 0, 9, 9, 15, 22, 25, 25 ] ], [ [ 0, 13, 23, 24, 29, 29, 32, 60 ], [ 0, 0, 10, 10, 15, 22, 25, 25 ] ], [ [ 0, 13, 24, 25, 29, 29, 32, 60 ], [ 0, 0, 11, 11, 15, 22, 25, 25 ] ] ], "tuples": [ [ 11, 0, 26, 7, 8, 2, 25, 19 ] ], "tupleFields": [ "identical", "ambiguousColumns", "columns", "mismatches", "gapColumns", "gapOpens", "readAligned", "referenceCovered" ], "variation": { "readAligned": { "shared": true, "min": 25, "max": 25 }, "referenceCovered": { "shared": true, "min": 19, "max": 19 }, "identity": { "shared": true, "min": { "numerator": 11, "denominator": 26 }, "max": { "numerator": 11, "denominator": 26 } }, "overhangStart": { "shared": true, "min": 0, "max": 0 }, "overhangEnd": { "shared": true, "min": 0, "max": 0 } }, "placements": [ { "refStart": 14, "refEnd": 32, "crossesOrigin": false, "wholeCircle": false, "readStart": 1, "readEnd": 25, "asSupplied": { "readStart": 1, "readEnd": 25 }, "alignments": 3, "band": { "diagonalMin": 7, "diagonalMax": 14, "cellsNeeded": 260, "bandLimited": false } } ] } } ] } }, { "id": "insertion-at-origin", "note": "An insertion before a circle's first letter: CCCCC then the first 20 bases of J01636.1 801-880 as a circle; it follows position 80 and crosses the origin (ruling 4 item 3).", "input": { "reference": { "residues": "GATGCTGGTTGCCAACGATCAGATGGCGCTGGGCGCAATGCGCGCCATTACCGAGTCCGGGCTGCGCGTTGGTGCGGATA", "topology": "circular", "source": "J01636.1 801-880, circular" }, "read": { "residues": "CCCCCGATGCTGGTTGCCAACGATC", "source": "CCCCC then reference bases 1-20" }, "modes": [ "semiglobal-read" ] }, "expected": { "results": [ { "mode": "semiglobal-read", "region": null, "strand": "+", "strandUndetermined": false, "plus": { "score": 27, "count": 1, "overCap": false, "state": "aligned", "biopython": { "score": 27, "count": 2, "tailScore": 27, "tailCountSubtracted": 1, "certifiedText": { "extension": 25, "textLength": 129, "reruns": 0, "differencesUpTo": 11 } }, "uniquePairs": [ [ 1, 6 ], [ 2, 7 ], [ 3, 8 ], [ 4, 9 ], [ 5, 10 ], [ 6, 11 ], [ 7, 12 ], [ 8, 13 ], [ 9, 14 ], [ 10, 15 ], [ 11, 16 ], [ 12, 17 ], [ 13, 18 ], [ 14, 19 ], [ 15, 20 ], [ 16, 21 ], [ 17, 22 ], [ 18, 23 ], [ 19, 24 ], [ 20, 25 ] ], "uniquePlacement": true, "placementNotDetermined": false, "noCommonColumn": false, "hull": { "refStart": 1, "refEnd": 20, "crossesOrigin": false, "wholeCircle": false }, "selected": { "coordinates": [ [ 0, 0, 20 ], [ 0, 5, 25 ] ], "gappedReference": "-----GATGCTGGTTGCCAACGATC", "gappedRead": "CCCCCGATGCTGGTTGCCAACGATC", "columns": 25, "identical": 20, "mismatches": 0, "ambiguousColumns": 0, "gapColumns": 5, "gapOpens": 1, "identity": { "numerator": 20, "denominator": 25 }, "readAligned": { "bases": 20, "of": 25 }, "referenceCovered": { "bases": 20, "of": 80 }, "placement": { "refStart": 1, "refEnd": 20, "readStart": 6, "readEnd": 25, "crossesOrigin": false }, "overhang": [], "differences": [ { "kind": "insertion", "refAfter": 80, "length": 5, "bases": "CCCCC", "readStart": 1, "readEnd": 5, "crossesOrigin": true, "common": true } ] }, "band": { "diagonalMin": -5, "diagonalMax": -1, "cellsNeeded": 161, "unionBandLimited": false, "scope": "every optimal path", "gridCells": 3380, "searchedBanded": false, "sharedWords": 9, "sharedWordsOverCap": false, "seedGuarantee": { "differencesUpTo": 11, "guaranteed": false } }, "enumeration": "listed", "alignments": [ [ [ 0, 0, 20 ], [ 0, 5, 25 ] ] ], "tuples": [ [ 20, 0, 25, 0, 5, 1, 20, 20 ] ], "tupleFields": [ "identical", "ambiguousColumns", "columns", "mismatches", "gapColumns", "gapOpens", "readAligned", "referenceCovered" ], "variation": { "readAligned": { "shared": true, "min": 20, "max": 20 }, "referenceCovered": { "shared": true, "min": 20, "max": 20 }, "identity": { "shared": true, "min": { "numerator": 4, "denominator": 5 }, "max": { "numerator": 4, "denominator": 5 } }, "overhangStart": { "shared": true, "min": 0, "max": 0 }, "overhangEnd": { "shared": true, "min": 0, "max": 0 } }, "placements": [ { "refStart": 1, "refEnd": 20, "crossesOrigin": false, "wholeCircle": false, "readStart": 6, "readEnd": 25, "alignments": 1, "band": { "diagonalMin": -5, "diagonalMax": -1, "cellsNeeded": 161, "bandLimited": false } } ] }, "minus": { "score": 5, "count": 1, "overCap": false, "state": "aligned", "biopython": { "score": 5, "count": 2, "tailScore": 5, "tailCountSubtracted": 1, "certifiedText": { "extension": 25, "textLength": 129, "reruns": 0, "differencesUpTo": 22 } }, "uniquePairs": [ [ 4, 1 ], [ 5, 2 ], [ 6, 3 ], [ 7, 4 ], [ 8, 5 ], [ 9, 6 ], [ 10, 7 ], [ 11, 8 ], [ 12, 9 ], [ 13, 10 ], [ 14, 11 ], [ 15, 12 ], [ 16, 13 ], [ 17, 14 ], [ 18, 15 ], [ 19, 16 ], [ 20, 17 ], [ 21, 18 ], [ 22, 19 ], [ 23, 20 ], [ 24, 21 ], [ 25, 22 ], [ 26, 23 ], [ 27, 24 ], [ 28, 25 ] ], "uniquePlacement": true, "placementNotDetermined": false, "noCommonColumn": false, "hull": { "refStart": 4, "refEnd": 28, "crossesOrigin": false, "wholeCircle": false }, "selected": { "coordinates": [ [ 0, 3, 28 ], [ 0, 0, 25 ] ], "gappedReference": "GCTGGTTGCCAACGATCAGATGGCG", "gappedRead": "GATCGTTGGCAACCAGCATCGGGGG", "columns": 25, "identical": 16, "mismatches": 9, "ambiguousColumns": 0, "gapColumns": 0, "gapOpens": 0, "identity": { "numerator": 16, "denominator": 25 }, "readAligned": { "bases": 25, "of": 25 }, "referenceCovered": { "bases": 25, "of": 80 }, "placement": { "refStart": 4, "refEnd": 28, "readStart": 1, "readEnd": 25, "crossesOrigin": false, "asSupplied": { "readStart": 1, "readEnd": 25 } }, "overhang": [], "differences": [ { "kind": "substitution", "ref": 5, "refBase": "C", "readBase": "A", "read": 2, "common": true, "asSupplied": { "read": 24, "readBase": "T" } }, { "kind": "substitution", "ref": 7, "refBase": "G", "readBase": "C", "read": 4, "common": true, "asSupplied": { "read": 22, "readBase": "G" } }, { "kind": "substitution", "ref": 12, "refBase": "C", "readBase": "G", "read": 9, "common": true, "asSupplied": { "read": 17, "readBase": "C" } }, { "kind": "substitution", "ref": 17, "refBase": "G", "readBase": "C", "read": 14, "common": true, "asSupplied": { "read": 12, "readBase": "G" } }, { "kind": "substitution", "ref": 19, "refBase": "T", "readBase": "G", "read": 16, "common": true, "asSupplied": { "read": 10, "readBase": "C" } }, { "kind": "substitution", "ref": 22, "refBase": "G", "readBase": "T", "read": 19, "common": true, "asSupplied": { "read": 7, "readBase": "A" } }, { "kind": "substitution", "ref": 23, "refBase": "A", "readBase": "C", "read": 20, "common": true, "asSupplied": { "read": 6, "readBase": "G" } }, { "kind": "substitution", "ref": 24, "refBase": "T", "readBase": "G", "read": 21, "common": true, "asSupplied": { "read": 5, "readBase": "C" } }, { "kind": "substitution", "ref": 27, "refBase": "C", "readBase": "G", "read": 24, "common": true, "asSupplied": { "read": 2, "readBase": "C" } } ] }, "band": { "diagonalMin": 3, "diagonalMax": 3, "cellsNeeded": 78, "unionBandLimited": false, "scope": "every optimal path", "gridCells": 3380, "searchedBanded": false, "sharedWords": 0, "sharedWordsOverCap": false, "seedGuarantee": { "differencesUpTo": 22, "guaranteed": false } }, "enumeration": "listed", "alignments": [ [ [ 0, 3, 28 ], [ 0, 0, 25 ] ] ], "tuples": [ [ 16, 0, 25, 9, 0, 0, 25, 25 ] ], "tupleFields": [ "identical", "ambiguousColumns", "columns", "mismatches", "gapColumns", "gapOpens", "readAligned", "referenceCovered" ], "variation": { "readAligned": { "shared": true, "min": 25, "max": 25 }, "referenceCovered": { "shared": true, "min": 25, "max": 25 }, "identity": { "shared": true, "min": { "numerator": 16, "denominator": 25 }, "max": { "numerator": 16, "denominator": 25 } }, "overhangStart": { "shared": true, "min": 0, "max": 0 }, "overhangEnd": { "shared": true, "min": 0, "max": 0 } }, "placements": [ { "refStart": 4, "refEnd": 28, "crossesOrigin": false, "wholeCircle": false, "readStart": 1, "readEnd": 25, "asSupplied": { "readStart": 1, "readEnd": 25 }, "alignments": 1, "band": { "diagonalMin": 3, "diagonalMax": 3, "cellsNeeded": 78, "bandLimited": false } } ] } } ] } }, { "id": "periodic-circle", "note": "F3: ACGTACGT on a circle of three ACGT units: three placements, one across the origin, together spanning more than one turn of the text while no single alignment does; not a wrap.", "input": { "reference": { "residues": "ACGTACGTACGT", "topology": "circular" }, "read": { "residues": "ACGTACGT" }, "modes": [ "semiglobal-read", "local" ] }, "expected": { "results": [ { "mode": "semiglobal-read", "region": null, "strand": "ambiguous", "strandUndetermined": false, "plus": { "score": 16, "count": 3, "overCap": false, "state": "aligned", "biopython": { "score": 16, "count": 5, "tailScore": 16, "tailCountSubtracted": 2, "certifiedText": { "extension": 8, "textLength": 27, "reruns": 0, "differencesUpTo": 0 } }, "uniquePairs": [], "uniquePlacement": false, "placementNotDetermined": false, "noCommonColumn": false, "hull": { "refStart": 1, "refEnd": 12, "crossesOrigin": false, "wholeCircle": true }, "selected": { "coordinates": [ [ 0, 8 ], [ 0, 8 ] ], "gappedReference": "ACGTACGT", "gappedRead": "ACGTACGT", "columns": 8, "identical": 8, "mismatches": 0, "ambiguousColumns": 0, "gapColumns": 0, "gapOpens": 0, "identity": { "numerator": 8, "denominator": 8 }, "readAligned": { "bases": 8, "of": 8 }, "referenceCovered": { "bases": 8, "of": 12 }, "placement": { "refStart": 1, "refEnd": 8, "readStart": 1, "readEnd": 8, "crossesOrigin": false }, "overhang": [], "differences": [] }, "band": { "diagonalMin": 0, "diagonalMax": 8, "cellsNeeded": 98, "unionBandLimited": false, "scope": "every optimal path", "gridCells": 252, "searchedBanded": false, "sharedWords": 0, "sharedWordsOverCap": false, "seedGuarantee": { "differencesUpTo": 0, "guaranteed": false } }, "enumeration": "listed", "alignments": [ [ [ 0, 8 ], [ 0, 8 ] ], [ [ 0, 4, 12 ], [ 0, 0, 8 ] ], [ [ 0, 8, 16 ], [ 0, 0, 8 ] ] ], "tuples": [ [ 8, 0, 8, 0, 0, 0, 8, 8 ] ], "tupleFields": [ "identical", "ambiguousColumns", "columns", "mismatches", "gapColumns", "gapOpens", "readAligned", "referenceCovered" ], "variation": { "readAligned": { "shared": true, "min": 8, "max": 8 }, "referenceCovered": { "shared": true, "min": 8, "max": 8 }, "identity": { "shared": true, "min": { "numerator": 1, "denominator": 1 }, "max": { "numerator": 1, "denominator": 1 } }, "overhangStart": { "shared": true, "min": 0, "max": 0 }, "overhangEnd": { "shared": true, "min": 0, "max": 0 } }, "placements": [ { "refStart": 1, "refEnd": 8, "crossesOrigin": false, "wholeCircle": false, "readStart": 1, "readEnd": 8, "alignments": 1, "band": { "diagonalMin": 0, "diagonalMax": 0, "cellsNeeded": 26, "bandLimited": false } }, { "refStart": 5, "refEnd": 12, "crossesOrigin": false, "wholeCircle": false, "readStart": 1, "readEnd": 8, "alignments": 1, "band": { "diagonalMin": 4, "diagonalMax": 4, "cellsNeeded": 27, "bandLimited": false } }, { "refStart": 9, "refEnd": 4, "crossesOrigin": true, "wholeCircle": false, "readStart": 1, "readEnd": 8, "alignments": 1, "band": { "diagonalMin": 8, "diagonalMax": 8, "cellsNeeded": 27, "bandLimited": false } } ] }, "minus": { "score": 16, "count": 3, "overCap": false, "state": "aligned", "biopython": { "score": 16, "count": 5, "tailScore": 16, "tailCountSubtracted": 2, "certifiedText": { "extension": 8, "textLength": 27, "reruns": 0, "differencesUpTo": 0 } }, "uniquePairs": [], "uniquePlacement": false, "placementNotDetermined": false, "noCommonColumn": false, "hull": { "refStart": 1, "refEnd": 12, "crossesOrigin": false, "wholeCircle": true }, "selected": { "coordinates": [ [ 0, 8 ], [ 0, 8 ] ], "gappedReference": "ACGTACGT", "gappedRead": "ACGTACGT", "columns": 8, "identical": 8, "mismatches": 0, "ambiguousColumns": 0, "gapColumns": 0, "gapOpens": 0, "identity": { "numerator": 8, "denominator": 8 }, "readAligned": { "bases": 8, "of": 8 }, "referenceCovered": { "bases": 8, "of": 12 }, "placement": { "refStart": 1, "refEnd": 8, "readStart": 1, "readEnd": 8, "crossesOrigin": false, "asSupplied": { "readStart": 1, "readEnd": 8 } }, "overhang": [], "differences": [] }, "band": { "diagonalMin": 0, "diagonalMax": 8, "cellsNeeded": 98, "unionBandLimited": false, "scope": "every optimal path", "gridCells": 252, "searchedBanded": false, "sharedWords": 0, "sharedWordsOverCap": false, "seedGuarantee": { "differencesUpTo": 0, "guaranteed": false } }, "enumeration": "listed", "alignments": [ [ [ 0, 8 ], [ 0, 8 ] ], [ [ 0, 4, 12 ], [ 0, 0, 8 ] ], [ [ 0, 8, 16 ], [ 0, 0, 8 ] ] ], "tuples": [ [ 8, 0, 8, 0, 0, 0, 8, 8 ] ], "tupleFields": [ "identical", "ambiguousColumns", "columns", "mismatches", "gapColumns", "gapOpens", "readAligned", "referenceCovered" ], "variation": { "readAligned": { "shared": true, "min": 8, "max": 8 }, "referenceCovered": { "shared": true, "min": 8, "max": 8 }, "identity": { "shared": true, "min": { "numerator": 1, "denominator": 1 }, "max": { "numerator": 1, "denominator": 1 } }, "overhangStart": { "shared": true, "min": 0, "max": 0 }, "overhangEnd": { "shared": true, "min": 0, "max": 0 } }, "placements": [ { "refStart": 1, "refEnd": 8, "crossesOrigin": false, "wholeCircle": false, "readStart": 1, "readEnd": 8, "asSupplied": { "readStart": 1, "readEnd": 8 }, "alignments": 1, "band": { "diagonalMin": 0, "diagonalMax": 0, "cellsNeeded": 26, "bandLimited": false } }, { "refStart": 5, "refEnd": 12, "crossesOrigin": false, "wholeCircle": false, "readStart": 1, "readEnd": 8, "asSupplied": { "readStart": 1, "readEnd": 8 }, "alignments": 1, "band": { "diagonalMin": 4, "diagonalMax": 4, "cellsNeeded": 27, "bandLimited": false } }, { "refStart": 9, "refEnd": 4, "crossesOrigin": true, "wholeCircle": false, "readStart": 1, "readEnd": 8, "asSupplied": { "readStart": 1, "readEnd": 8 }, "alignments": 1, "band": { "diagonalMin": 8, "diagonalMax": 8, "cellsNeeded": 27, "bandLimited": false } } ] } }, { "mode": "local", "region": null, "strand": "ambiguous", "strandUndetermined": false, "plus": { "score": 16, "count": 3, "overCap": false, "state": "aligned", "biopython": { "score": 16, "count": 5, "tailScore": 16, "tailCountSubtracted": 2, "certifiedText": { "extension": 8, "textLength": 27, "reruns": 0, "differencesUpTo": 0 } }, "uniquePairs": [], "uniquePlacement": false, "placementNotDetermined": false, "noCommonColumn": false, "hull": { "refStart": 1, "refEnd": 12, "crossesOrigin": false, "wholeCircle": true }, "selected": { "coordinates": [ [ 0, 8 ], [ 0, 8 ] ], "gappedReference": "ACGTACGT", "gappedRead": "ACGTACGT", "columns": 8, "identical": 8, "mismatches": 0, "ambiguousColumns": 0, "gapColumns": 0, "gapOpens": 0, "identity": { "numerator": 8, "denominator": 8 }, "readAligned": { "bases": 8, "of": 8 }, "referenceCovered": { "bases": 8, "of": 12 }, "placement": { "refStart": 1, "refEnd": 8, "readStart": 1, "readEnd": 8, "crossesOrigin": false }, "overhang": [], "differences": [] }, "band": { "diagonalMin": 0, "diagonalMax": 8, "cellsNeeded": 98, "unionBandLimited": false, "scope": "every optimal path", "gridCells": 252, "searchedBanded": false, "sharedWords": 0, "sharedWordsOverCap": false, "seedGuarantee": { "differencesUpTo": 0, "guaranteed": false } }, "enumeration": "listed", "alignments": [ [ [ 0, 8 ], [ 0, 8 ] ], [ [ 4, 12 ], [ 0, 8 ] ], [ [ 8, 16 ], [ 0, 8 ] ] ], "tuples": [ [ 8, 0, 8, 0, 0, 0, 8, 8 ] ], "tupleFields": [ "identical", "ambiguousColumns", "columns", "mismatches", "gapColumns", "gapOpens", "readAligned", "referenceCovered" ], "variation": { "readAligned": { "shared": true, "min": 8, "max": 8 }, "referenceCovered": { "shared": true, "min": 8, "max": 8 }, "identity": { "shared": true, "min": { "numerator": 1, "denominator": 1 }, "max": { "numerator": 1, "denominator": 1 } }, "overhangStart": { "shared": true, "min": 0, "max": 0 }, "overhangEnd": { "shared": true, "min": 0, "max": 0 } }, "placements": [ { "refStart": 1, "refEnd": 8, "crossesOrigin": false, "wholeCircle": false, "readStart": 1, "readEnd": 8, "alignments": 1, "band": { "diagonalMin": 0, "diagonalMax": 0, "cellsNeeded": 26, "bandLimited": false } }, { "refStart": 5, "refEnd": 12, "crossesOrigin": false, "wholeCircle": false, "readStart": 1, "readEnd": 8, "alignments": 1, "band": { "diagonalMin": 4, "diagonalMax": 4, "cellsNeeded": 27, "bandLimited": false } }, { "refStart": 9, "refEnd": 4, "crossesOrigin": true, "wholeCircle": false, "readStart": 1, "readEnd": 8, "alignments": 1, "band": { "diagonalMin": 8, "diagonalMax": 8, "cellsNeeded": 27, "bandLimited": false } } ] }, "minus": { "score": 16, "count": 3, "overCap": false, "state": "aligned", "biopython": { "score": 16, "count": 5, "tailScore": 16, "tailCountSubtracted": 2, "certifiedText": { "extension": 8, "textLength": 27, "reruns": 0, "differencesUpTo": 0 } }, "uniquePairs": [], "uniquePlacement": false, "placementNotDetermined": false, "noCommonColumn": false, "hull": { "refStart": 1, "refEnd": 12, "crossesOrigin": false, "wholeCircle": true }, "selected": { "coordinates": [ [ 0, 8 ], [ 0, 8 ] ], "gappedReference": "ACGTACGT", "gappedRead": "ACGTACGT", "columns": 8, "identical": 8, "mismatches": 0, "ambiguousColumns": 0, "gapColumns": 0, "gapOpens": 0, "identity": { "numerator": 8, "denominator": 8 }, "readAligned": { "bases": 8, "of": 8 }, "referenceCovered": { "bases": 8, "of": 12 }, "placement": { "refStart": 1, "refEnd": 8, "readStart": 1, "readEnd": 8, "crossesOrigin": false, "asSupplied": { "readStart": 1, "readEnd": 8 } }, "overhang": [], "differences": [] }, "band": { "diagonalMin": 0, "diagonalMax": 8, "cellsNeeded": 98, "unionBandLimited": false, "scope": "every optimal path", "gridCells": 252, "searchedBanded": false, "sharedWords": 0, "sharedWordsOverCap": false, "seedGuarantee": { "differencesUpTo": 0, "guaranteed": false } }, "enumeration": "listed", "alignments": [ [ [ 0, 8 ], [ 0, 8 ] ], [ [ 4, 12 ], [ 0, 8 ] ], [ [ 8, 16 ], [ 0, 8 ] ] ], "tuples": [ [ 8, 0, 8, 0, 0, 0, 8, 8 ] ], "tupleFields": [ "identical", "ambiguousColumns", "columns", "mismatches", "gapColumns", "gapOpens", "readAligned", "referenceCovered" ], "variation": { "readAligned": { "shared": true, "min": 8, "max": 8 }, "referenceCovered": { "shared": true, "min": 8, "max": 8 }, "identity": { "shared": true, "min": { "numerator": 1, "denominator": 1 }, "max": { "numerator": 1, "denominator": 1 } }, "overhangStart": { "shared": true, "min": 0, "max": 0 }, "overhangEnd": { "shared": true, "min": 0, "max": 0 } }, "placements": [ { "refStart": 1, "refEnd": 8, "crossesOrigin": false, "wholeCircle": false, "readStart": 1, "readEnd": 8, "asSupplied": { "readStart": 1, "readEnd": 8 }, "alignments": 1, "band": { "diagonalMin": 0, "diagonalMax": 0, "cellsNeeded": 26, "bandLimited": false } }, { "refStart": 5, "refEnd": 12, "crossesOrigin": false, "wholeCircle": false, "readStart": 1, "readEnd": 8, "asSupplied": { "readStart": 1, "readEnd": 8 }, "alignments": 1, "band": { "diagonalMin": 4, "diagonalMax": 4, "cellsNeeded": 27, "bandLimited": false } }, { "refStart": 9, "refEnd": 4, "crossesOrigin": true, "wholeCircle": false, "readStart": 1, "readEnd": 8, "asSupplied": { "readStart": 1, "readEnd": 8 }, "alignments": 1, "band": { "diagonalMin": 8, "diagonalMax": 8, "cellsNeeded": 27, "bandLimited": false } } ] } } ] } }, { "id": "placement-not-determined", "note": "AAAA against AAA in semiglobal-read: the extra A is overhang at either end or an insertion at either of two places, four alignments linked by shared pairs with no pair common to all: one group, placement not determined.", "input": { "reference": { "residues": "AAA", "topology": "linear" }, "read": { "residues": "AAAA" }, "modes": [ "semiglobal-read" ] }, "expected": { "results": [ { "mode": "semiglobal-read", "region": null, "strand": "+", "strandUndetermined": false, "plus": { "score": 1, "count": 4, "overCap": false, "state": "aligned", "biopython": { "score": 1, "count": 4 }, "uniquePairs": [], "uniquePlacement": false, "placementNotDetermined": true, "noCommonColumn": false, "hull": { "refStart": 1, "refEnd": 3, "crossesOrigin": false, "wholeCircle": false }, "selected": { "coordinates": [ [ 0, 0, 3 ], [ 0, 1, 4 ] ], "gappedReference": "AAA", "gappedRead": "AAA", "columns": 3, "identical": 3, "mismatches": 0, "ambiguousColumns": 0, "gapColumns": 0, "gapOpens": 0, "identity": { "numerator": 3, "denominator": 3 }, "readAligned": { "bases": 3, "of": 4 }, "referenceCovered": { "bases": 3, "of": 3 }, "placement": { "refStart": 1, "refEnd": 3, "readStart": 2, "readEnd": 4, "crossesOrigin": false }, "overhang": [ { "side": "start", "at": "reference-end", "length": 1, "bases": "A", "readStart": 1, "readEnd": 1 } ], "differences": [] }, "band": { "diagonalMin": -1, "diagonalMax": 0, "cellsNeeded": 14, "unionBandLimited": false, "scope": "every optimal path", "gridCells": 20, "searchedBanded": false, "sharedWords": 0, "sharedWordsOverCap": false, "seedGuarantee": { "differencesUpTo": 3, "guaranteed": false } }, "enumeration": "listed", "alignments": [ [ [ 0, 0, 3 ], [ 0, 1, 4 ] ], [ [ 0, 1, 1, 3 ], [ 0, 1, 2, 4 ] ], [ [ 0, 2, 2, 3 ], [ 0, 2, 3, 4 ] ], [ [ 0, 3, 3 ], [ 0, 3, 4 ] ] ], "tuples": [ [ 3, 0, 3, 0, 0, 0, 3, 3 ], [ 3, 0, 4, 0, 1, 1, 4, 3 ] ], "tupleFields": [ "identical", "ambiguousColumns", "columns", "mismatches", "gapColumns", "gapOpens", "readAligned", "referenceCovered" ], "variation": { "readAligned": { "shared": false, "min": 3, "max": 4 }, "referenceCovered": { "shared": true, "min": 3, "max": 3 }, "identity": { "shared": false, "min": { "numerator": 3, "denominator": 4 }, "max": { "numerator": 1, "denominator": 1 } }, "overhangStart": { "shared": false, "min": 0, "max": 1 }, "overhangEnd": { "shared": false, "min": 0, "max": 1 } }, "placements": [ { "refStart": 1, "refEnd": 3, "crossesOrigin": false, "wholeCircle": false, "readStart": 1, "readEnd": 4, "alignments": 4, "band": { "diagonalMin": -1, "diagonalMax": 0, "cellsNeeded": 14, "bandLimited": false } } ] }, "minus": { "score": -11, "count": 4, "overCap": false, "state": "no-paired-letter", "biopython": { "score": -11, "count": 4 } } } ] } }, { "id": "free-gap-bound-circle", "note": "The CSO's re-reading, D2: ACGACAC as a circle and the read CCGTTTT. Every co-optimal alignment inserts TTTT after position 3, one of them a turn of the text later; the free end gap next to the insertion adds no condition, so it is common.", "input": { "reference": { "residues": "ACGACAC", "topology": "circular" }, "read": { "residues": "CCGTTTT" }, "modes": [ "semiglobal-read", "local" ] }, "expected": { "results": [ { "mode": "semiglobal-read", "region": null, "strand": "-", "strandUndetermined": false, "plus": { "score": -10, "count": 2, "overCap": false, "state": "aligned", "biopython": { "score": -10, "count": 7, "tailScore": -10, "tailCountSubtracted": 5, "certifiedText": { "extension": 12, "textLength": 25, "reruns": 1, "differencesUpTo": 12 } }, "uniquePairs": [ [ 2, 2 ], [ 3, 3 ] ], "uniquePlacement": true, "placementNotDetermined": false, "noCommonColumn": false, "hull": { "refStart": 7, "refEnd": 3, "crossesOrigin": true, "wholeCircle": false }, "selected": { "coordinates": [ [ 0, 3, 3 ], [ 0, 3, 7 ] ], "gappedReference": "ACG----", "gappedRead": "CCGTTTT", "columns": 7, "identical": 2, "mismatches": 1, "ambiguousColumns": 0, "gapColumns": 4, "gapOpens": 1, "identity": { "numerator": 2, "denominator": 7 }, "readAligned": { "bases": 3, "of": 7 }, "referenceCovered": { "bases": 3, "of": 7 }, "placement": { "refStart": 1, "refEnd": 3, "readStart": 1, "readEnd": 3, "crossesOrigin": false }, "overhang": [], "differences": [ { "kind": "substitution", "ref": 1, "refBase": "A", "readBase": "C", "read": 1, "common": false, "notFixed": { "from": null, "to": { "ref": 2, "read": 2 } } }, { "kind": "insertion", "refAfter": 3, "length": 4, "bases": "TTTT", "readStart": 4, "readEnd": 7, "common": true } ] }, "band": { "diagonalMin": -4, "diagonalMax": 7, "cellsNeeded": 97, "unionBandLimited": false, "scope": "every optimal path", "gridCells": 208, "searchedBanded": false, "sharedWords": 0, "sharedWordsOverCap": false, "seedGuarantee": { "differencesUpTo": 12, "guaranteed": false } }, "enumeration": "listed", "alignments": [ [ [ 0, 3, 3 ], [ 0, 3, 7 ] ], [ [ 0, 6, 7, 8, 10, 10 ], [ 0, 0, 1, 1, 3, 7 ] ] ], "tuples": [ [ 2, 0, 7, 1, 4, 1, 3, 3 ], [ 3, 0, 8, 0, 5, 2, 3, 4 ] ], "tupleFields": [ "identical", "ambiguousColumns", "columns", "mismatches", "gapColumns", "gapOpens", "readAligned", "referenceCovered" ], "variation": { "readAligned": { "shared": true, "min": 3, "max": 3 }, "referenceCovered": { "shared": false, "min": 3, "max": 4 }, "identity": { "shared": false, "min": { "numerator": 2, "denominator": 7 }, "max": { "numerator": 3, "denominator": 8 } }, "overhangStart": { "shared": true, "min": 0, "max": 0 }, "overhangEnd": { "shared": true, "min": 0, "max": 0 } }, "placements": [ { "refStart": 7, "refEnd": 3, "crossesOrigin": true, "wholeCircle": false, "readStart": 1, "readEnd": 3, "alignments": 2, "band": { "diagonalMin": -4, "diagonalMax": 7, "cellsNeeded": 97, "bandLimited": false } } ] }, "minus": { "score": -1, "count": 3, "overCap": false, "state": "wraps-past-one-turn", "biopython": { "score": -1, "count": 6, "tailScore": -1, "tailCountSubtracted": 3, "certifiedText": { "extension": 7, "textLength": 20, "reruns": 0, "differencesUpTo": 7 } }, "enumeration": "listed" } }, { "mode": "local", "region": null, "strand": "-", "strandUndetermined": false, "plus": { "score": 4, "count": 1, "overCap": false, "state": "aligned", "biopython": { "score": 4, "count": 3, "tailScore": 4, "tailCountSubtracted": 2, "certifiedText": { "extension": 7, "textLength": 20, "reruns": 0, "differencesUpTo": 5 } }, "uniquePairs": [ [ 2, 2 ], [ 3, 3 ] ], "uniquePlacement": true, "placementNotDetermined": false, "noCommonColumn": false, "hull": { "refStart": 2, "refEnd": 3, "crossesOrigin": false, "wholeCircle": false }, "selected": { "coordinates": [ [ 1, 3 ], [ 1, 3 ] ], "gappedReference": "CG", "gappedRead": "CG", "columns": 2, "identical": 2, "mismatches": 0, "ambiguousColumns": 0, "gapColumns": 0, "gapOpens": 0, "identity": { "numerator": 2, "denominator": 2 }, "readAligned": { "bases": 2, "of": 7 }, "referenceCovered": { "bases": 2, "of": 7 }, "placement": { "refStart": 2, "refEnd": 3, "readStart": 2, "readEnd": 3, "crossesOrigin": false }, "overhang": [], "differences": [] }, "band": { "diagonalMin": 0, "diagonalMax": 0, "cellsNeeded": 23, "unionBandLimited": false, "scope": "every optimal path", "gridCells": 168, "searchedBanded": false, "sharedWords": 0, "sharedWordsOverCap": false, "seedGuarantee": { "differencesUpTo": 5, "guaranteed": false } }, "enumeration": "listed", "alignments": [ [ [ 1, 3 ], [ 1, 3 ] ] ], "tuples": [ [ 2, 0, 2, 0, 0, 0, 2, 2 ] ], "tupleFields": [ "identical", "ambiguousColumns", "columns", "mismatches", "gapColumns", "gapOpens", "readAligned", "referenceCovered" ], "variation": { "readAligned": { "shared": true, "min": 2, "max": 2 }, "referenceCovered": { "shared": true, "min": 2, "max": 2 }, "identity": { "shared": true, "min": { "numerator": 1, "denominator": 1 }, "max": { "numerator": 1, "denominator": 1 } }, "overhangStart": { "shared": true, "min": 0, "max": 0 }, "overhangEnd": { "shared": true, "min": 0, "max": 0 } }, "placements": [ { "refStart": 2, "refEnd": 3, "crossesOrigin": false, "wholeCircle": false, "readStart": 2, "readEnd": 3, "alignments": 1, "band": { "diagonalMin": 0, "diagonalMax": 0, "cellsNeeded": 23, "bandLimited": false } } ] }, "minus": { "score": 6, "count": 1, "overCap": false, "state": "aligned", "biopython": { "score": 6, "count": 3, "tailScore": 6, "tailCountSubtracted": 2, "certifiedText": { "extension": 7, "textLength": 20, "reruns": 0, "differencesUpTo": 4 } }, "uniquePairs": [ [ 1, 4 ], [ 2, 5 ], [ 3, 6 ] ], "uniquePlacement": true, "placementNotDetermined": false, "noCommonColumn": false, "hull": { "refStart": 1, "refEnd": 3, "crossesOrigin": false, "wholeCircle": false }, "selected": { "coordinates": [ [ 0, 3 ], [ 3, 6 ] ], "gappedReference": "ACG", "gappedRead": "ACG", "columns": 3, "identical": 3, "mismatches": 0, "ambiguousColumns": 0, "gapColumns": 0, "gapOpens": 0, "identity": { "numerator": 3, "denominator": 3 }, "readAligned": { "bases": 3, "of": 7 }, "referenceCovered": { "bases": 3, "of": 7 }, "placement": { "refStart": 1, "refEnd": 3, "readStart": 4, "readEnd": 6, "crossesOrigin": false, "asSupplied": { "readStart": 2, "readEnd": 4 } }, "overhang": [], "differences": [] }, "band": { "diagonalMin": -3, "diagonalMax": -3, "cellsNeeded": 15, "unionBandLimited": false, "scope": "every optimal path", "gridCells": 168, "searchedBanded": false, "sharedWords": 0, "sharedWordsOverCap": false, "seedGuarantee": { "differencesUpTo": 4, "guaranteed": false } }, "enumeration": "listed", "alignments": [ [ [ 0, 3 ], [ 3, 6 ] ] ], "tuples": [ [ 3, 0, 3, 0, 0, 0, 3, 3 ] ], "tupleFields": [ "identical", "ambiguousColumns", "columns", "mismatches", "gapColumns", "gapOpens", "readAligned", "referenceCovered" ], "variation": { "readAligned": { "shared": true, "min": 3, "max": 3 }, "referenceCovered": { "shared": true, "min": 3, "max": 3 }, "identity": { "shared": true, "min": { "numerator": 1, "denominator": 1 }, "max": { "numerator": 1, "denominator": 1 } }, "overhangStart": { "shared": true, "min": 0, "max": 0 }, "overhangEnd": { "shared": true, "min": 0, "max": 0 } }, "placements": [ { "refStart": 1, "refEnd": 3, "crossesOrigin": false, "wholeCircle": false, "readStart": 4, "readEnd": 6, "asSupplied": { "readStart": 2, "readEnd": 4 }, "alignments": 1, "band": { "diagonalMin": -3, "diagonalMax": -3, "cellsNeeded": 15, "bandLimited": false } } ] } } ] } }, { "id": "region-hull-inside", "note": "The CSO's re-reading, D3: TCCCT as a circle, region 2 to 5, and the read G in global. The hull runs from the least to the greatest paired position in the region's own order, inside the region, never across position 1.", "input": { "reference": { "residues": "TCCCT", "topology": "circular", "region": { "from": 2, "to": 5 } }, "read": { "residues": "G" }, "modes": [ "global" ] }, "expected": { "results": [ { "mode": "global", "region": { "from": 2, "to": 5, "length": 4, "acrossOrigin": false }, "strand": "-", "strandUndetermined": false, "plus": { "score": -12, "count": 2, "overCap": false, "state": "aligned", "biopython": { "score": -12, "count": 2 }, "uniquePairs": [], "uniquePlacement": false, "placementNotDetermined": false, "noCommonColumn": true, "hull": { "refStart": 2, "refEnd": 5, "crossesOrigin": false, "wholeCircle": false }, "selected": { "coordinates": [ [ 0, 3, 4 ], [ 0, 0, 1 ] ], "gappedReference": "CCCT", "gappedRead": "---G", "columns": 4, "identical": 0, "mismatches": 1, "ambiguousColumns": 0, "gapColumns": 3, "gapOpens": 1, "identity": { "numerator": 0, "denominator": 4 }, "readAligned": { "bases": 1, "of": 1 }, "referenceCovered": { "bases": 1, "of": 4 }, "placement": { "refStart": 5, "refEnd": 5, "readStart": 1, "readEnd": 1, "crossesOrigin": false }, "overhang": [], "differences": [ { "kind": "deletion", "refStart": 2, "refEnd": 4, "length": 3, "bases": "CCC", "readAfter": 0, "common": false, "notFixed": { "from": null, "to": null } }, { "kind": "substitution", "ref": 5, "refBase": "T", "readBase": "G", "read": 1, "common": false, "notFixed": { "from": null, "to": null } } ] }, "band": { "diagonalMin": 0, "diagonalMax": 3, "cellsNeeded": 10, "unionBandLimited": false, "scope": "every optimal path", "gridCells": 10, "searchedBanded": false, "sharedWords": 0, "sharedWordsOverCap": false, "seedGuarantee": { "differencesUpTo": 7, "guaranteed": false } }, "enumeration": "listed", "alignments": [ [ [ 0, 3, 4 ], [ 0, 0, 1 ] ], [ [ 0, 1, 4 ], [ 0, 1, 1 ] ] ], "tuples": [ [ 0, 0, 4, 1, 3, 1, 1, 1 ] ], "tupleFields": [ "identical", "ambiguousColumns", "columns", "mismatches", "gapColumns", "gapOpens", "readAligned", "referenceCovered" ], "variation": { "readAligned": { "shared": true, "min": 1, "max": 1 }, "referenceCovered": { "shared": true, "min": 1, "max": 1 }, "identity": { "shared": true, "min": { "numerator": 0, "denominator": 1 }, "max": { "numerator": 0, "denominator": 1 } }, "overhangStart": { "shared": true, "min": 0, "max": 0 }, "overhangEnd": { "shared": true, "min": 0, "max": 0 } }, "placements": [ { "refStart": 2, "refEnd": 2, "crossesOrigin": false, "wholeCircle": false, "readStart": 1, "readEnd": 1, "alignments": 1, "band": { "diagonalMin": 0, "diagonalMax": 3, "cellsNeeded": 10, "bandLimited": false } }, { "refStart": 5, "refEnd": 5, "crossesOrigin": false, "wholeCircle": false, "readStart": 1, "readEnd": 1, "alignments": 1, "band": { "diagonalMin": 0, "diagonalMax": 3, "cellsNeeded": 10, "bandLimited": false } } ] }, "minus": { "score": -7, "count": 1, "overCap": false, "state": "aligned", "biopython": { "score": -7, "count": 1 }, "uniquePairs": [ [ 2, 1 ] ], "uniquePlacement": true, "placementNotDetermined": false, "noCommonColumn": false, "hull": { "refStart": 2, "refEnd": 2, "crossesOrigin": false, "wholeCircle": false }, "selected": { "coordinates": [ [ 0, 1, 4 ], [ 0, 1, 1 ] ], "gappedReference": "CCCT", "gappedRead": "C---", "columns": 4, "identical": 1, "mismatches": 0, "ambiguousColumns": 0, "gapColumns": 3, "gapOpens": 1, "identity": { "numerator": 1, "denominator": 4 }, "readAligned": { "bases": 1, "of": 1 }, "referenceCovered": { "bases": 1, "of": 4 }, "placement": { "refStart": 2, "refEnd": 2, "readStart": 1, "readEnd": 1, "crossesOrigin": false, "asSupplied": { "readStart": 1, "readEnd": 1 } }, "overhang": [], "differences": [ { "kind": "deletion", "refStart": 3, "refEnd": 5, "length": 3, "bases": "CCT", "readAfter": 1, "asSupplied": { "readBetween": [ 0, 1 ] }, "common": true } ] }, "band": { "diagonalMin": 0, "diagonalMax": 3, "cellsNeeded": 10, "unionBandLimited": false, "scope": "every optimal path", "gridCells": 10, "searchedBanded": false, "sharedWords": 0, "sharedWordsOverCap": false, "seedGuarantee": { "differencesUpTo": 4, "guaranteed": false } }, "enumeration": "listed", "alignments": [ [ [ 0, 1, 4 ], [ 0, 1, 1 ] ] ], "tuples": [ [ 1, 0, 4, 0, 3, 1, 1, 1 ] ], "tupleFields": [ "identical", "ambiguousColumns", "columns", "mismatches", "gapColumns", "gapOpens", "readAligned", "referenceCovered" ], "variation": { "readAligned": { "shared": true, "min": 1, "max": 1 }, "referenceCovered": { "shared": true, "min": 1, "max": 1 }, "identity": { "shared": true, "min": { "numerator": 1, "denominator": 4 }, "max": { "numerator": 1, "denominator": 4 } }, "overhangStart": { "shared": true, "min": 0, "max": 0 }, "overhangEnd": { "shared": true, "min": 0, "max": 0 } }, "placements": [ { "refStart": 2, "refEnd": 2, "crossesOrigin": false, "wholeCircle": false, "readStart": 1, "readEnd": 1, "asSupplied": { "readStart": 1, "readEnd": 1 }, "alignments": 1, "band": { "diagonalMin": 0, "diagonalMax": 3, "cellsNeeded": 10, "bandLimited": false } } ] } } ] } }, { "id": "no-paired-letter-mixed", "note": "The CSO's re-reading, D4: CCC against AAAA in semiglobal-read. A three-base gap at any of five places scores -9, and so does pairing CCC with AAA at 1-3 or 2-4: seven alignments, five of which place nothing, so nothing is placed.", "input": { "reference": { "residues": "AAAA", "topology": "linear" }, "read": { "residues": "CCC" }, "modes": [ "semiglobal-read" ] }, "expected": { "results": [ { "mode": "semiglobal-read", "region": null, "strand": "none", "strandUndetermined": false, "plus": { "score": -9, "count": 7, "overCap": false, "state": "no-paired-letter", "biopython": { "score": -9, "count": 7 } }, "minus": { "score": -9, "count": 7, "overCap": false, "state": "no-paired-letter", "biopython": { "score": -9, "count": 7 } } } ] } }, { "id": "refuse-region-whole-circle", "note": "A region covering a whole circle (positions 21 to 20 of 80) refuses: comparing a whole circle from a stated origin needs its own method (ruling 2 (3)).", "input": { "reference": { "residues": "GATGCTGGTTGCCAACGATCAGATGGCGCTGGGCGCAATGCGCGCCATTACCGAGTCCGGGCTGCGCGTTGGTGCGGATA", "topology": "circular", "region": { "from": 21, "to": 20 } }, "read": { "residues": "GATGCTGGTTGCCAACGATC" }, "modes": [ "global" ] }, "expected": { "refused": { "kind": "region-whole-circle", "from": 21, "to": 20, "length": 80 } } }, { "id": "refuse-read-longer-than-circular-region", "note": "A read longer than a circular reference refuses with a region too (ruling 2 (3)).", "input": { "reference": { "residues": "ACGTTGCAAC", "topology": "circular", "region": { "from": 2, "to": 5 } }, "read": { "residues": "ACGTTGCAACG" }, "modes": [ "global" ] }, "expected": { "refused": { "kind": "read-longer-than-circular-reference", "read": 11, "reference": 10 } } }, { "id": "refuse-region", "note": "A region running backwards on a linear reference refuses.", "input": { "reference": { "residues": "GACACCATCGAATGGCGCAAAACCTTTCGCGGTATGGCATGATAGCGCCC", "topology": "linear", "region": { "from": 30, "to": 10 } }, "read": { "residues": "ACGTACGT" }, "modes": [ "semiglobal-read" ] }, "expected": { "refused": { "kind": "region", "from": 30, "to": 10, "length": 50 } } }, { "id": "refuse-empty-reference", "note": "An empty reference refuses.", "input": { "reference": { "residues": "", "topology": "linear" }, "read": { "residues": "ACGTACGT" }, "modes": [ "semiglobal-read" ] }, "expected": { "refused": { "kind": "empty", "which": "reference" } } }, { "id": "refuse-u-in-dna-reference", "note": "A U in a reference not declared RNA refuses with its position.", "input": { "reference": { "residues": "ACGTUACGTA", "topology": "linear" }, "read": { "residues": "ACGTACGT" }, "modes": [ "semiglobal-read" ] }, "expected": { "refused": { "kind": "u-in-dna", "which": "reference", "position": 5 } } }, { "id": "refuse-u-in-dna", "note": "A U in a read not declared RNA refuses with its position.", "input": { "reference": { "residues": "GACACCATCGAATGGCGCAAAACCTTTCGCGGTATGGCATGATAGCGCCC", "topology": "linear" }, "read": { "residues": "ACGUACGT" }, "modes": [ "semiglobal-read" ] }, "expected": { "refused": { "kind": "u-in-dna", "which": "read", "position": 4 } } }, { "id": "refuse-letter", "note": "An X in the read refuses with its position.", "input": { "reference": { "residues": "GACACCATCGAATGGCGCAAAACCTTTCGCGGTATGGCATGATAGCGCCC", "topology": "linear" }, "read": { "residues": "ACGTXACG" }, "modes": [ "semiglobal-read" ] }, "expected": { "refused": { "kind": "letter", "which": "read", "letter": "X", "position": 5 } } }, { "id": "refuse-read-longer-than-circular", "note": "A read longer than a circular reference refuses: the one-turn mapping would count a base twice.", "input": { "reference": { "residues": "ACGTTGCAAC", "topology": "circular" }, "read": { "residues": "ACGTTGCAACG" }, "modes": [ "semiglobal-read" ] }, "expected": { "refused": { "kind": "read-longer-than-circular-reference", "read": 11, "reference": 10 } } }, { "id": "refuse-global-circular", "note": "global on a circular reference refuses: a circle has no ends.", "input": { "reference": { "residues": "GATGCTGGTTGCCAACGATCAGATGGCGCTGGGCGCAATGCGCGCCATTACCGAGTCCGGGCTGCGCGTTGGTGCGGATA", "topology": "circular" }, "read": { "residues": "GCCAACGATCAGATGGCGCT" }, "modes": [ "global" ] }, "expected": { "refused": { "kind": "global-circular" } } }, { "id": "refuse-read-cap", "note": "A read of 20,001 bases refuses before any table is made.", "input": { "reference": { "residues": "GACACCATCGAATGGCGCAAAACCTTTCGCGGTATGGCATGATAGCGCCC", "topology": "linear" }, "read": { "residues": { "parts": [ [ "ACGT", 5000 ], [ "A", 1 ] ] } }, "modes": [ "semiglobal-read" ] }, "expected": { "refused": { "kind": "read-cap", "length": 20001, "cap": 20000 } } }, { "id": "refuse-reference-cap", "note": "A reference of 1,000,001 bases refuses before any table is made.", "input": { "reference": { "residues": { "parts": [ [ "ACGT", 250000 ], [ "A", 1 ] ] }, "topology": "linear" }, "read": { "residues": "ACGTACGTACGT" }, "modes": [ "semiglobal-read" ] }, "expected": { "refused": { "kind": "reference-cap", "length": 1000001, "cap": 1000000 } } }, { "id": "refuse-empty-read", "note": "An empty read refuses.", "input": { "reference": { "residues": "GACACCATCGAATGGCGCAAAACCTTTCGCGGTATGGCATGATAGCGCCC", "topology": "linear" }, "read": { "residues": "" }, "modes": [ "semiglobal-read" ] }, "expected": { "refused": { "kind": "empty", "which": "read" } } } ] }