{ "about": { "generatedBy": "pipeline/plasmid-map/reference.py", "scriptSha256": "6d99ac2790c5d6b6791dbd91a6d49db4a4cbfdf63424fe7465b11e85e74744a5", "recordedOn": "2026-10-17", "oracle": "Biopython 1.88", "oracleLicence": "Biopython Licence Agreement or BSD-3-Clause", "text": "Specificity of the annotation library, regenerated against the new manifest (the CSO's rulings of 17 2026), keeping version 1's test. Controls: ten seeded random sequences of 10,000 bases at the base composition of pUC19 and pBR322 together, and those two plasmids reversed without complementing, which keeps each one's composition and destroys its features. The gates are no match call on any control and at most two partial calls in all; the counts are published whatever they are. Every feature at or under the 29-base floor is tested five ways: present whole and exact, reverse-complemented, straddling the origin of a circular sequence, with one substitution in the middle, and one base short. The cross-check runs every member of a family against every other member's bases, where a family is a set of entries that are close by descent or that contain one another; it records every entry within thresholds at that locus, the best-scoring one and the rest, so that two identities are never shown as two matches at one locus. Biopython's PairwiseAligner in local mode with the engine's scoring gives every number; features at or under the floor are matched whole and exact, as the engine does. Nothing here is read from the engine. The cross-check runs all against all, every entry against every other entry's bases on both strands, and publishes every pair where either entry reaches a call threshold against the other, with the identity, the call kind and a bucket. The bucket is geometry's alone: entries within 90 percent of each other's length are an identity pair when the shorter is also covered over at least 90 percent of its own length; the same coverage with a length ratio under 90 percent is containment; coverage under 90 percent of the shorter entry is partial overlap. Four numbers are published per pair so a reader can recompute the bucket: the identity over aligned columns, the aligned fraction of the shorter entry's own length, the same for the longer, and the length ratio. Both 90 percents are display parameters and stated judgements, not match thresholds; no threshold and no seed length moves for either, so the calls are the same whatever they are set to. The coverage parameter sits below the engine's 0.95 match coverage and well above its 0.5 partial floor. Every published pair carries a marking, generated where it is not curated, because a blank is a defect and not a value. What geometry cannot decide for a containment pair, whether the two are elements their depositors annotated separately or one element and a variant or repeat of it, is marked per pair in library-pairs.csv and justified there and in both entries' review records; an unmarked containment pair takes the conservative default of the container alone with the contained entry named. `shown` says what the display does with each reported pair.", "scoring": { "match": 2, "mismatch": -3, "gapOpen": -5, "gapExtend": -2 }, "seed": 20261006, "sequences": 10, "length": 10000, "maxPartials": 2, "composition": { "A": "550/2349", "C": "65/243", "G": "1819/7047", "T": "1693/7047" } }, "counts": { "features": 90, "controls": 12, "matchCalls": 0, "partialCalls": 0, "shortFeatures": 6, "shortCases": 30, "families": 12, "familyCases": 47, "contestedLoci": 20, "pairsCompared": 4005, "pairsReported": 66, "identityPairs": 52, "containmentPairs": 12, "partialOverlapPairs": 2, "markedPairs": 14, "curatedMarkings": 14, "unsettledPairs": 7, "uncuratedPairs": 0 }, "controls": [ { "id": "R01", "how": "seeded random bases at the golden plasmids' composition, seed 20261006", "length": 10000, "circular": true, "sha256": "7d490f521b16624445bfbbae840ec9bd3509fb61ecf55c8236e20f60e68de0cd", "calls": [] }, { "id": "R02", "how": "seeded random bases at the golden plasmids' composition, seed 20261007", "length": 10000, "circular": true, "sha256": "37c19cb94575f3f96b158a1fbfcf32f77164d48b46a57338945422313db58d94", "calls": [] }, { "id": "R03", "how": "seeded random bases at the golden plasmids' composition, seed 20261008", "length": 10000, "circular": true, "sha256": "e8c09f9e83d8d649b423e7537b1dc903113615a0bed24de2d2155c6e34bd1c97", "calls": [] }, { "id": "R04", "how": "seeded random bases at the golden plasmids' composition, seed 20261009", "length": 10000, "circular": true, "sha256": "7b653e5a4b1118d886f1e916334025db40a267916176f45b4613686be3382c13", "calls": [] }, { "id": "R05", "how": "seeded random bases at the golden plasmids' composition, seed 20261010", "length": 10000, "circular": true, "sha256": "4b420f02afa191de076cf0f314aac35188c75b202d55c7fb29480df953cf7567", "calls": [] }, { "id": "R06", "how": "seeded random bases at the golden plasmids' composition, seed 20261011", "length": 10000, "circular": true, "sha256": "0c73f3a8b64149ba766fafc3b2a40c3416d92e444249db1277460d0283d973ec", "calls": [] }, { "id": "R07", "how": "seeded random bases at the golden plasmids' composition, seed 20261012", "length": 10000, "circular": true, "sha256": "9ddd9678e08ee24bae830dd75e44c02190a36147deb99ee3f38d444cbad7e9bc", "calls": [] }, { "id": "R08", "how": "seeded random bases at the golden plasmids' composition, seed 20261013", "length": 10000, "circular": true, "sha256": "0f84544e5cc81eaa7107aa050040944b8753bfe3f7e143eff42e8ead55b2b0d7", "calls": [] }, { "id": "R09", "how": "seeded random bases at the golden plasmids' composition, seed 20261014", "length": 10000, "circular": true, "sha256": "8610e96f70c01ffa23934bc51ce1032edce8beeb325ebaf5d11f712121e7ad8c", "calls": [] }, { "id": "R10", "how": "seeded random bases at the golden plasmids' composition, seed 20261015", "length": 10000, "circular": true, "sha256": "7d2cce44b0b67b0bfa361e906d874e7472bd8e484a4e77cba7ab04051dfcde2f", "calls": [] }, { "id": "X01", "how": "pUC19 (L09137.2) reversed without complementing", "length": 2686, "circular": true, "sha256": "395df60344d94555ccd6a5f1d127f625703a12b333c6f88e871054989ad4cbaa", "calls": [] }, { "id": "X02", "how": "pBR322 (J01749.1) reversed without complementing", "length": 4361, "circular": true, "sha256": "8732711d9d528ebc9a930393b4216ea159217481ac39689ee4e10e31dcae4d58", "calls": [] } ], "shortFeatures": [ { "feature": "t7Promoter", "length": 19, "way": "exact", "circular": false, "sha256": "023f38aa3e95271242a39855a9aada4a6396746ddf0cfc9dbb3f8c677fd745de", "sequence": "GATCATGCTTACCCGGTCAGCAAGGTGTTCCGGGTGTGGACCGTTAGGGCGTTACTAGTTGCAATCGATCACTCATAACTTAACGAAACAAATTGCGTGTATTGTGAATCCCCTGAAATAGTTACATGTCCTAGGTTTGTTTTCGTATGAATGGGGTTTTGACCGAATTGCTGATTTTTTGTCTCAGCTCCTGCTTTCTGGTGATGTTTACTATATATTGCACTTATACCTGTACTGTAGTCTGTAATGTCACAGTACTGGGCGGCGAAATACCCTTTGCTAACAAATTGGTCGCGTGGCCTTATGGACAAATTACCGCGGACATGAGGGCCGTTTCCAACGAGAAACCACCGAACGTCTGTTTCTTTTTTATCGCCTACTTCTCACACCGGTGCCCGTGAATCGAGCTCGTCGACTTATTTCTACGACCGGGTTTCCTGGCAAGTGGTGCAAATAGAGTGTAGGTGAATGCGACACCTAGTTGCTACGACTTTAGATAATAATACGACTCACTATAGGGATCATGCTTACCCGGTCAGCAAGGTGTTCCGGGTGTGGACCGTTAGGGCGTTACTAGTTGCAATCGATCACTCATAACTTAACGAAACAAATTGCGTGTATTGTGAATCCCCTGAAATAGTTACATGTCCTAGGTTTGTTTTCGTATGAATGGGGTTTTGACCGAATTGCTGATTTTTTGTCTCAGCTCCTGCTTTCTGGTGATGTTTACTATATATTGCACTTATACCTGTACTGTAGTCTGTAATGTCACAGTACTGGGCGGCGAAATACCCTTTGCTAACAAATTGGTCGCGTGGCCTTATGGACAAATTACCGCGGACATGAGGGCCGTTTCCAACGAGAAACCACCGAACGTCTGTTTCTTTTTTATCGCCTACTTCTCACACCGGTGCCCGTGAATCGAGCTCGTCGACTTATTTCTACGACCGGGTTTCCTGGCAAGTGGTGCAAATAGAGTGTAGGTGAATGCGACACCTAGTTGCTACGACTTTAGATAA", "expected": { "call": "match", "calls": [ { "featureId": "t7Promoter", "strand": "+", "start": 501, "end": 519, "call": "match", "identityExact": "19/19", "coverageExact": "19/19", "score": 38.0 } ] } }, { "feature": "t7Promoter", "length": 19, "way": "reverse-complemented", "circular": false, "sha256": "3e87208bb5d8306d0931a99b6a527842f81a02fe2fb826ecb21d3aaea30a6dfe", "sequence": "GATCATGCTTACCCGGTCAGCAAGGTGTTCCGGGTGTGGACCGTTAGGGCGTTACTAGTTGCAATCGATCACTCATAACTTAACGAAACAAATTGCGTGTATTGTGAATCCCCTGAAATAGTTACATGTCCTAGGTTTGTTTTCGTATGAATGGGGTTTTGACCGAATTGCTGATTTTTTGTCTCAGCTCCTGCTTTCTGGTGATGTTTACTATATATTGCACTTATACCTGTACTGTAGTCTGTAATGTCACAGTACTGGGCGGCGAAATACCCTTTGCTAACAAATTGGTCGCGTGGCCTTATGGACAAATTACCGCGGACATGAGGGCCGTTTCCAACGAGAAACCACCGAACGTCTGTTTCTTTTTTATCGCCTACTTCTCACACCGGTGCCCGTGAATCGAGCTCGTCGACTTATTTCTACGACCGGGTTTCCTGGCAAGTGGTGCAAATAGAGTGTAGGTGAATGCGACACCTAGTTGCTACGACTTTAGATAACCTATAGTGAGTCGTATTAGATCATGCTTACCCGGTCAGCAAGGTGTTCCGGGTGTGGACCGTTAGGGCGTTACTAGTTGCAATCGATCACTCATAACTTAACGAAACAAATTGCGTGTATTGTGAATCCCCTGAAATAGTTACATGTCCTAGGTTTGTTTTCGTATGAATGGGGTTTTGACCGAATTGCTGATTTTTTGTCTCAGCTCCTGCTTTCTGGTGATGTTTACTATATATTGCACTTATACCTGTACTGTAGTCTGTAATGTCACAGTACTGGGCGGCGAAATACCCTTTGCTAACAAATTGGTCGCGTGGCCTTATGGACAAATTACCGCGGACATGAGGGCCGTTTCCAACGAGAAACCACCGAACGTCTGTTTCTTTTTTATCGCCTACTTCTCACACCGGTGCCCGTGAATCGAGCTCGTCGACTTATTTCTACGACCGGGTTTCCTGGCAAGTGGTGCAAATAGAGTGTAGGTGAATGCGACACCTAGTTGCTACGACTTTAGATAA", "expected": { "call": "match", "calls": [ { "featureId": "t7Promoter", "strand": "-", "start": 501, "end": 519, "call": "match", "identityExact": "19/19", "coverageExact": "19/19", "score": 38.0 } ] } }, { "feature": "t7Promoter", "length": 19, "way": "across the origin", "circular": true, "sha256": "a471b08c679aee4ed122285aabecfbf245719fd8dc4eb11e64454987f682e42b", "sequence": "TCACTATAGGGATCATGCTTACCCGGTCAGCAAGGTGTTCCGGGTGTGGACCGTTAGGGCGTTACTAGTTGCAATCGATCACTCATAACTTAACGAAACAAATTGCGTGTATTGTGAATCCCCTGAAATAGTTACATGTCCTAGGTTTGTTTTCGTATGAATGGGGTTTTGACCGAATTGCTGATTTTTTGTCTCAGCTCCTGCTTTCTGGTGATGTTTACTATATATTGCACTTATACCTGTACTGTAGTCTGTAATGTCACAGTACTGGGCGGCGAAATACCCTTTGCTAACAAATTGGTCGCGTGGCCTTATGGACAAATTACCGCGGACATGAGGGCCGTTTCCAACGAGAAACCACCGAACGTCTGTTTCTTTTTTATCGCCTACTTCTCACACCGGTGCCCGTGAATCGAGCTCGTCGACTTATTTCTACGACCGGGTTTCCTGGCAAGTGGTGCAAATAGAGTGTAGGTGAATGCGACACCTAGTTGCTACGACTTTAGATAATAATACGAC", "expected": { "call": "match", "calls": [ { "featureId": "t7Promoter", "strand": "+", "start": 511, "end": 10, "call": "match", "identityExact": "19/19", "coverageExact": "19/19", "score": 38.0 } ] } }, { "feature": "t7Promoter", "length": 19, "way": "one mismatch", "circular": false, "sha256": "e58600a07e4efb06c62f01346335701ff6a313438e05db63e595f3ac24d2d01d", "sequence": "GATCATGCTTACCCGGTCAGCAAGGTGTTCCGGGTGTGGACCGTTAGGGCGTTACTAGTTGCAATCGATCACTCATAACTTAACGAAACAAATTGCGTGTATTGTGAATCCCCTGAAATAGTTACATGTCCTAGGTTTGTTTTCGTATGAATGGGGTTTTGACCGAATTGCTGATTTTTTGTCTCAGCTCCTGCTTTCTGGTGATGTTTACTATATATTGCACTTATACCTGTACTGTAGTCTGTAATGTCACAGTACTGGGCGGCGAAATACCCTTTGCTAACAAATTGGTCGCGTGGCCTTATGGACAAATTACCGCGGACATGAGGGCCGTTTCCAACGAGAAACCACCGAACGTCTGTTTCTTTTTTATCGCCTACTTCTCACACCGGTGCCCGTGAATCGAGCTCGTCGACTTATTTCTACGACCGGGTTTCCTGGCAAGTGGTGCAAATAGAGTGTAGGTGAATGCGACACCTAGTTGCTACGACTTTAGATAATAATACGACACACTATAGGGATCATGCTTACCCGGTCAGCAAGGTGTTCCGGGTGTGGACCGTTAGGGCGTTACTAGTTGCAATCGATCACTCATAACTTAACGAAACAAATTGCGTGTATTGTGAATCCCCTGAAATAGTTACATGTCCTAGGTTTGTTTTCGTATGAATGGGGTTTTGACCGAATTGCTGATTTTTTGTCTCAGCTCCTGCTTTCTGGTGATGTTTACTATATATTGCACTTATACCTGTACTGTAGTCTGTAATGTCACAGTACTGGGCGGCGAAATACCCTTTGCTAACAAATTGGTCGCGTGGCCTTATGGACAAATTACCGCGGACATGAGGGCCGTTTCCAACGAGAAACCACCGAACGTCTGTTTCTTTTTTATCGCCTACTTCTCACACCGGTGCCCGTGAATCGAGCTCGTCGACTTATTTCTACGACCGGGTTTCCTGGCAAGTGGTGCAAATAGAGTGTAGGTGAATGCGACACCTAGTTGCTACGACTTTAGATAA", "expected": { "call": null, "calls": [] }, "absenceScan": { "method": "brute-force scan of both strands at every offset, through the origin when circular; no engine and no aligner", "featureLength": 19, "mismatchesAllowed": 0, "offsetsScanned": 2002, "occurrences": [] } }, { "feature": "t7Promoter", "length": 19, "way": "truncated", "circular": false, "sha256": "ece3a8be0f0d96d44838634e657f6e80e1595958761aa613bf59521613d5ee49", "sequence": "GATCATGCTTACCCGGTCAGCAAGGTGTTCCGGGTGTGGACCGTTAGGGCGTTACTAGTTGCAATCGATCACTCATAACTTAACGAAACAAATTGCGTGTATTGTGAATCCCCTGAAATAGTTACATGTCCTAGGTTTGTTTTCGTATGAATGGGGTTTTGACCGAATTGCTGATTTTTTGTCTCAGCTCCTGCTTTCTGGTGATGTTTACTATATATTGCACTTATACCTGTACTGTAGTCTGTAATGTCACAGTACTGGGCGGCGAAATACCCTTTGCTAACAAATTGGTCGCGTGGCCTTATGGACAAATTACCGCGGACATGAGGGCCGTTTCCAACGAGAAACCACCGAACGTCTGTTTCTTTTTTATCGCCTACTTCTCACACCGGTGCCCGTGAATCGAGCTCGTCGACTTATTTCTACGACCGGGTTTCCTGGCAAGTGGTGCAAATAGAGTGTAGGTGAATGCGACACCTAGTTGCTACGACTTTAGATAATAATACGACTCACTATAGTATCATGCTTACCCGGTCAGCAAGGTGTTCCGGGTGTGGACCGTTAGGGCGTTACTAGTTGCAATCGATCACTCATAACTTAACGAAACAAATTGCGTGTATTGTGAATCCCCTGAAATAGTTACATGTCCTAGGTTTGTTTTCGTATGAATGGGGTTTTGACCGAATTGCTGATTTTTTGTCTCAGCTCCTGCTTTCTGGTGATGTTTACTATATATTGCACTTATACCTGTACTGTAGTCTGTAATGTCACAGTACTGGGCGGCGAAATACCCTTTGCTAACAAATTGGTCGCGTGGCCTTATGGACAAATTACCGCGGACATGAGGGCCGTTTCCAACGAGAAACCACCGAACGTCTGTTTCTTTTTTATCGCCTACTTCTCACACCGGTGCCCGTGAATCGAGCTCGTCGACTTATTTCTACGACCGGGTTTCCTGGCAAGTGGTGCAAATAGAGTGTAGGTGAATGCGACACCTAGTTGCTACGACTTTAGATAA", "expected": { "call": null, "calls": [] }, "absenceScan": { "method": "brute-force scan of both strands at every offset, through the origin when circular; no engine and no aligner", "featureLength": 19, "mismatchesAllowed": 0, "offsetsScanned": 2000, "occurrences": [] } }, { "feature": "t3Promoter", "length": 19, "way": "exact", "circular": false, "sha256": "41bcf433acb4e10618de6a15547397b8e69b88cb87e67b5753f90954c0156e7a", "sequence": "GATCATGCTTACCCGGTCAGCAAGGTGTTCCGGGTGTGGACCGTTAGGGCGTTACTAGTTGCAATCGATCACTCATAACTTAACGAAACAAATTGCGTGTATTGTGAATCCCCTGAAATAGTTACATGTCCTAGGTTTGTTTTCGTATGAATGGGGTTTTGACCGAATTGCTGATTTTTTGTCTCAGCTCCTGCTTTCTGGTGATGTTTACTATATATTGCACTTATACCTGTACTGTAGTCTGTAATGTCACAGTACTGGGCGGCGAAATACCCTTTGCTAACAAATTGGTCGCGTGGCCTTATGGACAAATTACCGCGGACATGAGGGCCGTTTCCAACGAGAAACCACCGAACGTCTGTTTCTTTTTTATCGCCTACTTCTCACACCGGTGCCCGTGAATCGAGCTCGTCGACTTATTTCTACGACCGGGTTTCCTGGCAAGTGGTGCAAATAGAGTGTAGGTGAATGCGACACCTAGTTGCTACGACTTTAGATAACCCTTTAGTGAGGGTTAATGATCATGCTTACCCGGTCAGCAAGGTGTTCCGGGTGTGGACCGTTAGGGCGTTACTAGTTGCAATCGATCACTCATAACTTAACGAAACAAATTGCGTGTATTGTGAATCCCCTGAAATAGTTACATGTCCTAGGTTTGTTTTCGTATGAATGGGGTTTTGACCGAATTGCTGATTTTTTGTCTCAGCTCCTGCTTTCTGGTGATGTTTACTATATATTGCACTTATACCTGTACTGTAGTCTGTAATGTCACAGTACTGGGCGGCGAAATACCCTTTGCTAACAAATTGGTCGCGTGGCCTTATGGACAAATTACCGCGGACATGAGGGCCGTTTCCAACGAGAAACCACCGAACGTCTGTTTCTTTTTTATCGCCTACTTCTCACACCGGTGCCCGTGAATCGAGCTCGTCGACTTATTTCTACGACCGGGTTTCCTGGCAAGTGGTGCAAATAGAGTGTAGGTGAATGCGACACCTAGTTGCTACGACTTTAGATAA", "expected": { "call": "match", "calls": [ { "featureId": "t3Promoter", "strand": "+", "start": 501, "end": 519, "call": "match", "identityExact": "19/19", "coverageExact": "19/19", "score": 38.0 } ] } }, { "feature": "t3Promoter", "length": 19, "way": "reverse-complemented", "circular": false, "sha256": "7994cff5d2385875d6a847352c6217598015933e5e127f221b7b5af52eea21a8", "sequence": "GATCATGCTTACCCGGTCAGCAAGGTGTTCCGGGTGTGGACCGTTAGGGCGTTACTAGTTGCAATCGATCACTCATAACTTAACGAAACAAATTGCGTGTATTGTGAATCCCCTGAAATAGTTACATGTCCTAGGTTTGTTTTCGTATGAATGGGGTTTTGACCGAATTGCTGATTTTTTGTCTCAGCTCCTGCTTTCTGGTGATGTTTACTATATATTGCACTTATACCTGTACTGTAGTCTGTAATGTCACAGTACTGGGCGGCGAAATACCCTTTGCTAACAAATTGGTCGCGTGGCCTTATGGACAAATTACCGCGGACATGAGGGCCGTTTCCAACGAGAAACCACCGAACGTCTGTTTCTTTTTTATCGCCTACTTCTCACACCGGTGCCCGTGAATCGAGCTCGTCGACTTATTTCTACGACCGGGTTTCCTGGCAAGTGGTGCAAATAGAGTGTAGGTGAATGCGACACCTAGTTGCTACGACTTTAGATAAATTAACCCTCACTAAAGGGGATCATGCTTACCCGGTCAGCAAGGTGTTCCGGGTGTGGACCGTTAGGGCGTTACTAGTTGCAATCGATCACTCATAACTTAACGAAACAAATTGCGTGTATTGTGAATCCCCTGAAATAGTTACATGTCCTAGGTTTGTTTTCGTATGAATGGGGTTTTGACCGAATTGCTGATTTTTTGTCTCAGCTCCTGCTTTCTGGTGATGTTTACTATATATTGCACTTATACCTGTACTGTAGTCTGTAATGTCACAGTACTGGGCGGCGAAATACCCTTTGCTAACAAATTGGTCGCGTGGCCTTATGGACAAATTACCGCGGACATGAGGGCCGTTTCCAACGAGAAACCACCGAACGTCTGTTTCTTTTTTATCGCCTACTTCTCACACCGGTGCCCGTGAATCGAGCTCGTCGACTTATTTCTACGACCGGGTTTCCTGGCAAGTGGTGCAAATAGAGTGTAGGTGAATGCGACACCTAGTTGCTACGACTTTAGATAA", "expected": { "call": "match", "calls": [ { "featureId": "t3Promoter", "strand": "-", "start": 501, "end": 519, "call": "match", "identityExact": "19/19", "coverageExact": "19/19", "score": 38.0 } ] } }, { "feature": "t3Promoter", "length": 19, "way": "across the origin", "circular": true, "sha256": "3c8a0ab5e70ed0b1a8808234bf0be3d29d774cbc7a3ba2751105892b2b6f2e8a", "sequence": "GAGGGTTAATGATCATGCTTACCCGGTCAGCAAGGTGTTCCGGGTGTGGACCGTTAGGGCGTTACTAGTTGCAATCGATCACTCATAACTTAACGAAACAAATTGCGTGTATTGTGAATCCCCTGAAATAGTTACATGTCCTAGGTTTGTTTTCGTATGAATGGGGTTTTGACCGAATTGCTGATTTTTTGTCTCAGCTCCTGCTTTCTGGTGATGTTTACTATATATTGCACTTATACCTGTACTGTAGTCTGTAATGTCACAGTACTGGGCGGCGAAATACCCTTTGCTAACAAATTGGTCGCGTGGCCTTATGGACAAATTACCGCGGACATGAGGGCCGTTTCCAACGAGAAACCACCGAACGTCTGTTTCTTTTTTATCGCCTACTTCTCACACCGGTGCCCGTGAATCGAGCTCGTCGACTTATTTCTACGACCGGGTTTCCTGGCAAGTGGTGCAAATAGAGTGTAGGTGAATGCGACACCTAGTTGCTACGACTTTAGATAACCCTTTAGT", "expected": { "call": "match", "calls": [ { "featureId": "t3Promoter", "strand": "+", "start": 511, "end": 10, "call": "match", "identityExact": "19/19", "coverageExact": "19/19", "score": 38.0 } ] } }, { "feature": "t3Promoter", "length": 19, "way": "one mismatch", "circular": false, "sha256": "929b74501aa517557d8a7d5f7e6837cef773b9f4517ada68a3e3d40cd08f8df1", "sequence": "GATCATGCTTACCCGGTCAGCAAGGTGTTCCGGGTGTGGACCGTTAGGGCGTTACTAGTTGCAATCGATCACTCATAACTTAACGAAACAAATTGCGTGTATTGTGAATCCCCTGAAATAGTTACATGTCCTAGGTTTGTTTTCGTATGAATGGGGTTTTGACCGAATTGCTGATTTTTTGTCTCAGCTCCTGCTTTCTGGTGATGTTTACTATATATTGCACTTATACCTGTACTGTAGTCTGTAATGTCACAGTACTGGGCGGCGAAATACCCTTTGCTAACAAATTGGTCGCGTGGCCTTATGGACAAATTACCGCGGACATGAGGGCCGTTTCCAACGAGAAACCACCGAACGTCTGTTTCTTTTTTATCGCCTACTTCTCACACCGGTGCCCGTGAATCGAGCTCGTCGACTTATTTCTACGACCGGGTTTCCTGGCAAGTGGTGCAAATAGAGTGTAGGTGAATGCGACACCTAGTTGCTACGACTTTAGATAACCCTTTAGTTAGGGTTAATGATCATGCTTACCCGGTCAGCAAGGTGTTCCGGGTGTGGACCGTTAGGGCGTTACTAGTTGCAATCGATCACTCATAACTTAACGAAACAAATTGCGTGTATTGTGAATCCCCTGAAATAGTTACATGTCCTAGGTTTGTTTTCGTATGAATGGGGTTTTGACCGAATTGCTGATTTTTTGTCTCAGCTCCTGCTTTCTGGTGATGTTTACTATATATTGCACTTATACCTGTACTGTAGTCTGTAATGTCACAGTACTGGGCGGCGAAATACCCTTTGCTAACAAATTGGTCGCGTGGCCTTATGGACAAATTACCGCGGACATGAGGGCCGTTTCCAACGAGAAACCACCGAACGTCTGTTTCTTTTTTATCGCCTACTTCTCACACCGGTGCCCGTGAATCGAGCTCGTCGACTTATTTCTACGACCGGGTTTCCTGGCAAGTGGTGCAAATAGAGTGTAGGTGAATGCGACACCTAGTTGCTACGACTTTAGATAA", "expected": { "call": null, "calls": [] }, "absenceScan": { "method": "brute-force scan of both strands at every offset, through the origin when circular; no engine and no aligner", "featureLength": 19, "mismatchesAllowed": 0, "offsetsScanned": 2002, "occurrences": [] } }, { "feature": "t3Promoter", "length": 19, "way": "truncated", "circular": false, "sha256": "f43d0e26fcfe15f8db02169c3e4662c5f4df199fc3d944fefb38899a717494d3", "sequence": "GATCATGCTTACCCGGTCAGCAAGGTGTTCCGGGTGTGGACCGTTAGGGCGTTACTAGTTGCAATCGATCACTCATAACTTAACGAAACAAATTGCGTGTATTGTGAATCCCCTGAAATAGTTACATGTCCTAGGTTTGTTTTCGTATGAATGGGGTTTTGACCGAATTGCTGATTTTTTGTCTCAGCTCCTGCTTTCTGGTGATGTTTACTATATATTGCACTTATACCTGTACTGTAGTCTGTAATGTCACAGTACTGGGCGGCGAAATACCCTTTGCTAACAAATTGGTCGCGTGGCCTTATGGACAAATTACCGCGGACATGAGGGCCGTTTCCAACGAGAAACCACCGAACGTCTGTTTCTTTTTTATCGCCTACTTCTCACACCGGTGCCCGTGAATCGAGCTCGTCGACTTATTTCTACGACCGGGTTTCCTGGCAAGTGGTGCAAATAGAGTGTAGGTGAATGCGACACCTAGTTGCTACGACTTTAGATAACCCTTTAGTGAGGGTTAAAATCATGCTTACCCGGTCAGCAAGGTGTTCCGGGTGTGGACCGTTAGGGCGTTACTAGTTGCAATCGATCACTCATAACTTAACGAAACAAATTGCGTGTATTGTGAATCCCCTGAAATAGTTACATGTCCTAGGTTTGTTTTCGTATGAATGGGGTTTTGACCGAATTGCTGATTTTTTGTCTCAGCTCCTGCTTTCTGGTGATGTTTACTATATATTGCACTTATACCTGTACTGTAGTCTGTAATGTCACAGTACTGGGCGGCGAAATACCCTTTGCTAACAAATTGGTCGCGTGGCCTTATGGACAAATTACCGCGGACATGAGGGCCGTTTCCAACGAGAAACCACCGAACGTCTGTTTCTTTTTTATCGCCTACTTCTCACACCGGTGCCCGTGAATCGAGCTCGTCGACTTATTTCTACGACCGGGTTTCCTGGCAAGTGGTGCAAATAGAGTGTAGGTGAATGCGACACCTAGTTGCTACGACTTTAGATAA", "expected": { "call": null, "calls": [] }, "absenceScan": { "method": "brute-force scan of both strands at every offset, through the origin when circular; no engine and no aligner", "featureLength": 19, "mismatchesAllowed": 0, "offsetsScanned": 2000, "occurrences": [] } }, { "feature": "sp6Promoter", "length": 20, "way": "exact", "circular": false, "sha256": "df55f286f076af70ea7d099a09fddb716a9cbee69f7e69d0914448c48497f27d", "sequence": "GATCATGCTTACCCGGTCAGCAAGGTGTTCCGGGTGTGGACCGTTAGGGCGTTACTAGTTGCAATCGATCACTCATAACTTAACGAAACAAATTGCGTGTATTGTGAATCCCCTGAAATAGTTACATGTCCTAGGTTTGTTTTCGTATGAATGGGGTTTTGACCGAATTGCTGATTTTTTGTCTCAGCTCCTGCTTTCTGGTGATGTTTACTATATATTGCACTTATACCTGTACTGTAGTCTGTAATGTCACAGTACTGGGCGGCGAAATACCCTTTGCTAACAAATTGGTCGCGTGGCCTTATGGACAAATTACCGCGGACATGAGGGCCGTTTCCAACGAGAAACCACCGAACGTCTGTTTCTTTTTTATCGCCTACTTCTCACACCGGTGCCCGTGAATCGAGCTCGTCGACTTATTTCTACGACCGGGTTTCCTGGCAAGTGGTGCAAATAGAGTGTAGGTGAATGCGACACCTAGTTGCTACGACTTTAGATAATTCTATAGTGTCACCTAAATGATCATGCTTACCCGGTCAGCAAGGTGTTCCGGGTGTGGACCGTTAGGGCGTTACTAGTTGCAATCGATCACTCATAACTTAACGAAACAAATTGCGTGTATTGTGAATCCCCTGAAATAGTTACATGTCCTAGGTTTGTTTTCGTATGAATGGGGTTTTGACCGAATTGCTGATTTTTTGTCTCAGCTCCTGCTTTCTGGTGATGTTTACTATATATTGCACTTATACCTGTACTGTAGTCTGTAATGTCACAGTACTGGGCGGCGAAATACCCTTTGCTAACAAATTGGTCGCGTGGCCTTATGGACAAATTACCGCGGACATGAGGGCCGTTTCCAACGAGAAACCACCGAACGTCTGTTTCTTTTTTATCGCCTACTTCTCACACCGGTGCCCGTGAATCGAGCTCGTCGACTTATTTCTACGACCGGGTTTCCTGGCAAGTGGTGCAAATAGAGTGTAGGTGAATGCGACACCTAGTTGCTACGACTTTAGATAA", "expected": { "call": "match", "calls": [ { "featureId": "sp6Promoter", "strand": "+", "start": 501, "end": 520, "call": "match", "identityExact": "20/20", "coverageExact": "20/20", "score": 40.0 } ] } }, { "feature": "sp6Promoter", "length": 20, "way": "reverse-complemented", "circular": false, "sha256": "2d3a7e277d70fa58e2dcb04a7e14d64902d547add804099c040897e2d4559f12", "sequence": "GATCATGCTTACCCGGTCAGCAAGGTGTTCCGGGTGTGGACCGTTAGGGCGTTACTAGTTGCAATCGATCACTCATAACTTAACGAAACAAATTGCGTGTATTGTGAATCCCCTGAAATAGTTACATGTCCTAGGTTTGTTTTCGTATGAATGGGGTTTTGACCGAATTGCTGATTTTTTGTCTCAGCTCCTGCTTTCTGGTGATGTTTACTATATATTGCACTTATACCTGTACTGTAGTCTGTAATGTCACAGTACTGGGCGGCGAAATACCCTTTGCTAACAAATTGGTCGCGTGGCCTTATGGACAAATTACCGCGGACATGAGGGCCGTTTCCAACGAGAAACCACCGAACGTCTGTTTCTTTTTTATCGCCTACTTCTCACACCGGTGCCCGTGAATCGAGCTCGTCGACTTATTTCTACGACCGGGTTTCCTGGCAAGTGGTGCAAATAGAGTGTAGGTGAATGCGACACCTAGTTGCTACGACTTTAGATAAATTTAGGTGACACTATAGAAGATCATGCTTACCCGGTCAGCAAGGTGTTCCGGGTGTGGACCGTTAGGGCGTTACTAGTTGCAATCGATCACTCATAACTTAACGAAACAAATTGCGTGTATTGTGAATCCCCTGAAATAGTTACATGTCCTAGGTTTGTTTTCGTATGAATGGGGTTTTGACCGAATTGCTGATTTTTTGTCTCAGCTCCTGCTTTCTGGTGATGTTTACTATATATTGCACTTATACCTGTACTGTAGTCTGTAATGTCACAGTACTGGGCGGCGAAATACCCTTTGCTAACAAATTGGTCGCGTGGCCTTATGGACAAATTACCGCGGACATGAGGGCCGTTTCCAACGAGAAACCACCGAACGTCTGTTTCTTTTTTATCGCCTACTTCTCACACCGGTGCCCGTGAATCGAGCTCGTCGACTTATTTCTACGACCGGGTTTCCTGGCAAGTGGTGCAAATAGAGTGTAGGTGAATGCGACACCTAGTTGCTACGACTTTAGATAA", "expected": { "call": "match", "calls": [ { "featureId": "sp6Promoter", "strand": "-", "start": 501, "end": 520, "call": "match", "identityExact": "20/20", "coverageExact": "20/20", "score": 40.0 } ] } }, { "feature": "sp6Promoter", "length": 20, "way": "across the origin", "circular": true, "sha256": "0c1bc6e0e68280602dba2a24deba77cc907d56abf19f721f4e64211b11c973c1", "sequence": "TCACCTAAATGATCATGCTTACCCGGTCAGCAAGGTGTTCCGGGTGTGGACCGTTAGGGCGTTACTAGTTGCAATCGATCACTCATAACTTAACGAAACAAATTGCGTGTATTGTGAATCCCCTGAAATAGTTACATGTCCTAGGTTTGTTTTCGTATGAATGGGGTTTTGACCGAATTGCTGATTTTTTGTCTCAGCTCCTGCTTTCTGGTGATGTTTACTATATATTGCACTTATACCTGTACTGTAGTCTGTAATGTCACAGTACTGGGCGGCGAAATACCCTTTGCTAACAAATTGGTCGCGTGGCCTTATGGACAAATTACCGCGGACATGAGGGCCGTTTCCAACGAGAAACCACCGAACGTCTGTTTCTTTTTTATCGCCTACTTCTCACACCGGTGCCCGTGAATCGAGCTCGTCGACTTATTTCTACGACCGGGTTTCCTGGCAAGTGGTGCAAATAGAGTGTAGGTGAATGCGACACCTAGTTGCTACGACTTTAGATAATTCTATAGTG", "expected": { "call": "match", "calls": [ { "featureId": "sp6Promoter", "strand": "+", "start": 511, "end": 10, "call": "match", "identityExact": "20/20", "coverageExact": "20/20", "score": 40.0 } ] } }, { "feature": "sp6Promoter", "length": 20, "way": "one mismatch", "circular": false, "sha256": "132a8b60b9b21faf23219bf2f11a54004a1299404221178a49ff5180a32afb9e", "sequence": "GATCATGCTTACCCGGTCAGCAAGGTGTTCCGGGTGTGGACCGTTAGGGCGTTACTAGTTGCAATCGATCACTCATAACTTAACGAAACAAATTGCGTGTATTGTGAATCCCCTGAAATAGTTACATGTCCTAGGTTTGTTTTCGTATGAATGGGGTTTTGACCGAATTGCTGATTTTTTGTCTCAGCTCCTGCTTTCTGGTGATGTTTACTATATATTGCACTTATACCTGTACTGTAGTCTGTAATGTCACAGTACTGGGCGGCGAAATACCCTTTGCTAACAAATTGGTCGCGTGGCCTTATGGACAAATTACCGCGGACATGAGGGCCGTTTCCAACGAGAAACCACCGAACGTCTGTTTCTTTTTTATCGCCTACTTCTCACACCGGTGCCCGTGAATCGAGCTCGTCGACTTATTTCTACGACCGGGTTTCCTGGCAAGTGGTGCAAATAGAGTGTAGGTGAATGCGACACCTAGTTGCTACGACTTTAGATAATTCTATAGTGACACCTAAATGATCATGCTTACCCGGTCAGCAAGGTGTTCCGGGTGTGGACCGTTAGGGCGTTACTAGTTGCAATCGATCACTCATAACTTAACGAAACAAATTGCGTGTATTGTGAATCCCCTGAAATAGTTACATGTCCTAGGTTTGTTTTCGTATGAATGGGGTTTTGACCGAATTGCTGATTTTTTGTCTCAGCTCCTGCTTTCTGGTGATGTTTACTATATATTGCACTTATACCTGTACTGTAGTCTGTAATGTCACAGTACTGGGCGGCGAAATACCCTTTGCTAACAAATTGGTCGCGTGGCCTTATGGACAAATTACCGCGGACATGAGGGCCGTTTCCAACGAGAAACCACCGAACGTCTGTTTCTTTTTTATCGCCTACTTCTCACACCGGTGCCCGTGAATCGAGCTCGTCGACTTATTTCTACGACCGGGTTTCCTGGCAAGTGGTGCAAATAGAGTGTAGGTGAATGCGACACCTAGTTGCTACGACTTTAGATAA", "expected": { "call": null, "calls": [] }, "absenceScan": { "method": "brute-force scan of both strands at every offset, through the origin when circular; no engine and no aligner", "featureLength": 20, "mismatchesAllowed": 0, "offsetsScanned": 2002, "occurrences": [] } }, { "feature": "sp6Promoter", "length": 20, "way": "truncated", "circular": false, "sha256": "0e920c490fcba1b0af8f4e1e0f08c2446ca584c9983baa0335c066e83304ed8e", "sequence": "GATCATGCTTACCCGGTCAGCAAGGTGTTCCGGGTGTGGACCGTTAGGGCGTTACTAGTTGCAATCGATCACTCATAACTTAACGAAACAAATTGCGTGTATTGTGAATCCCCTGAAATAGTTACATGTCCTAGGTTTGTTTTCGTATGAATGGGGTTTTGACCGAATTGCTGATTTTTTGTCTCAGCTCCTGCTTTCTGGTGATGTTTACTATATATTGCACTTATACCTGTACTGTAGTCTGTAATGTCACAGTACTGGGCGGCGAAATACCCTTTGCTAACAAATTGGTCGCGTGGCCTTATGGACAAATTACCGCGGACATGAGGGCCGTTTCCAACGAGAAACCACCGAACGTCTGTTTCTTTTTTATCGCCTACTTCTCACACCGGTGCCCGTGAATCGAGCTCGTCGACTTATTTCTACGACCGGGTTTCCTGGCAAGTGGTGCAAATAGAGTGTAGGTGAATGCGACACCTAGTTGCTACGACTTTAGATAATTCTATAGTGTCACCTAAAAATCATGCTTACCCGGTCAGCAAGGTGTTCCGGGTGTGGACCGTTAGGGCGTTACTAGTTGCAATCGATCACTCATAACTTAACGAAACAAATTGCGTGTATTGTGAATCCCCTGAAATAGTTACATGTCCTAGGTTTGTTTTCGTATGAATGGGGTTTTGACCGAATTGCTGATTTTTTGTCTCAGCTCCTGCTTTCTGGTGATGTTTACTATATATTGCACTTATACCTGTACTGTAGTCTGTAATGTCACAGTACTGGGCGGCGAAATACCCTTTGCTAACAAATTGGTCGCGTGGCCTTATGGACAAATTACCGCGGACATGAGGGCCGTTTCCAACGAGAAACCACCGAACGTCTGTTTCTTTTTTATCGCCTACTTCTCACACCGGTGCCCGTGAATCGAGCTCGTCGACTTATTTCTACGACCGGGTTTCCTGGCAAGTGGTGCAAATAGAGTGTAGGTGAATGCGACACCTAGTTGCTACGACTTTAGATAA", "expected": { "call": null, "calls": [] }, "absenceScan": { "method": "brute-force scan of both strands at every offset, through the origin when circular; no engine and no aligner", "featureLength": 20, "mismatchesAllowed": 0, "offsetsScanned": 2000, "occurrences": [] } }, { "feature": "lacO", "length": 21, "way": "exact", "circular": false, "sha256": "5930c68a521ea4527542d0648f84de78b40c194afdeab937c1ff2e635fcc5ec2", "sequence": "GATCATGCTTACCCGGTCAGCAAGGTGTTCCGGGTGTGGACCGTTAGGGCGTTACTAGTTGCAATCGATCACTCATAACTTAACGAAACAAATTGCGTGTATTGTGAATCCCCTGAAATAGTTACATGTCCTAGGTTTGTTTTCGTATGAATGGGGTTTTGACCGAATTGCTGATTTTTTGTCTCAGCTCCTGCTTTCTGGTGATGTTTACTATATATTGCACTTATACCTGTACTGTAGTCTGTAATGTCACAGTACTGGGCGGCGAAATACCCTTTGCTAACAAATTGGTCGCGTGGCCTTATGGACAAATTACCGCGGACATGAGGGCCGTTTCCAACGAGAAACCACCGAACGTCTGTTTCTTTTTTATCGCCTACTTCTCACACCGGTGCCCGTGAATCGAGCTCGTCGACTTATTTCTACGACCGGGTTTCCTGGCAAGTGGTGCAAATAGAGTGTAGGTGAATGCGACACCTAGTTGCTACGACTTTAGATAAAATTGTGAGCGGATAACAATTGATCATGCTTACCCGGTCAGCAAGGTGTTCCGGGTGTGGACCGTTAGGGCGTTACTAGTTGCAATCGATCACTCATAACTTAACGAAACAAATTGCGTGTATTGTGAATCCCCTGAAATAGTTACATGTCCTAGGTTTGTTTTCGTATGAATGGGGTTTTGACCGAATTGCTGATTTTTTGTCTCAGCTCCTGCTTTCTGGTGATGTTTACTATATATTGCACTTATACCTGTACTGTAGTCTGTAATGTCACAGTACTGGGCGGCGAAATACCCTTTGCTAACAAATTGGTCGCGTGGCCTTATGGACAAATTACCGCGGACATGAGGGCCGTTTCCAACGAGAAACCACCGAACGTCTGTTTCTTTTTTATCGCCTACTTCTCACACCGGTGCCCGTGAATCGAGCTCGTCGACTTATTTCTACGACCGGGTTTCCTGGCAAGTGGTGCAAATAGAGTGTAGGTGAATGCGACACCTAGTTGCTACGACTTTAGATAA", "expected": { "call": "match", "calls": [ { "featureId": "lacO", "strand": "+", "start": 501, "end": 521, "call": "match", "identityExact": "21/21", "coverageExact": "21/21", "score": 42.0 } ] } }, { "feature": "lacO", "length": 21, "way": "reverse-complemented", "circular": false, "sha256": "6806ce2459ccdf5711ac1f3baad09de17304b0964ca3d08522f0c41e2ee8177e", "sequence": "GATCATGCTTACCCGGTCAGCAAGGTGTTCCGGGTGTGGACCGTTAGGGCGTTACTAGTTGCAATCGATCACTCATAACTTAACGAAACAAATTGCGTGTATTGTGAATCCCCTGAAATAGTTACATGTCCTAGGTTTGTTTTCGTATGAATGGGGTTTTGACCGAATTGCTGATTTTTTGTCTCAGCTCCTGCTTTCTGGTGATGTTTACTATATATTGCACTTATACCTGTACTGTAGTCTGTAATGTCACAGTACTGGGCGGCGAAATACCCTTTGCTAACAAATTGGTCGCGTGGCCTTATGGACAAATTACCGCGGACATGAGGGCCGTTTCCAACGAGAAACCACCGAACGTCTGTTTCTTTTTTATCGCCTACTTCTCACACCGGTGCCCGTGAATCGAGCTCGTCGACTTATTTCTACGACCGGGTTTCCTGGCAAGTGGTGCAAATAGAGTGTAGGTGAATGCGACACCTAGTTGCTACGACTTTAGATAAAATTGTTATCCGCTCACAATTGATCATGCTTACCCGGTCAGCAAGGTGTTCCGGGTGTGGACCGTTAGGGCGTTACTAGTTGCAATCGATCACTCATAACTTAACGAAACAAATTGCGTGTATTGTGAATCCCCTGAAATAGTTACATGTCCTAGGTTTGTTTTCGTATGAATGGGGTTTTGACCGAATTGCTGATTTTTTGTCTCAGCTCCTGCTTTCTGGTGATGTTTACTATATATTGCACTTATACCTGTACTGTAGTCTGTAATGTCACAGTACTGGGCGGCGAAATACCCTTTGCTAACAAATTGGTCGCGTGGCCTTATGGACAAATTACCGCGGACATGAGGGCCGTTTCCAACGAGAAACCACCGAACGTCTGTTTCTTTTTTATCGCCTACTTCTCACACCGGTGCCCGTGAATCGAGCTCGTCGACTTATTTCTACGACCGGGTTTCCTGGCAAGTGGTGCAAATAGAGTGTAGGTGAATGCGACACCTAGTTGCTACGACTTTAGATAA", "expected": { "call": "match", "calls": [ { "featureId": "lacO", "strand": "-", "start": 501, "end": 521, "call": "match", "identityExact": "21/21", "coverageExact": "21/21", "score": 42.0 } ] } }, { "feature": "lacO", "length": 21, "way": "across the origin", "circular": true, "sha256": "d6d40adc3ef84b43d341f29b59f04ac182eba2581f147bebf52289021538aaa0", "sequence": "GGATAACAATTGATCATGCTTACCCGGTCAGCAAGGTGTTCCGGGTGTGGACCGTTAGGGCGTTACTAGTTGCAATCGATCACTCATAACTTAACGAAACAAATTGCGTGTATTGTGAATCCCCTGAAATAGTTACATGTCCTAGGTTTGTTTTCGTATGAATGGGGTTTTGACCGAATTGCTGATTTTTTGTCTCAGCTCCTGCTTTCTGGTGATGTTTACTATATATTGCACTTATACCTGTACTGTAGTCTGTAATGTCACAGTACTGGGCGGCGAAATACCCTTTGCTAACAAATTGGTCGCGTGGCCTTATGGACAAATTACCGCGGACATGAGGGCCGTTTCCAACGAGAAACCACCGAACGTCTGTTTCTTTTTTATCGCCTACTTCTCACACCGGTGCCCGTGAATCGAGCTCGTCGACTTATTTCTACGACCGGGTTTCCTGGCAAGTGGTGCAAATAGAGTGTAGGTGAATGCGACACCTAGTTGCTACGACTTTAGATAAAATTGTGAGC", "expected": { "call": "match", "calls": [ { "featureId": "lacO", "strand": "+", "start": 512, "end": 11, "call": "match", "identityExact": "21/21", "coverageExact": "21/21", "score": 42.0 } ] } }, { "feature": "lacO", "length": 21, "way": "one mismatch", "circular": false, "sha256": "d8276099a38994cc8f6b433d525eb5d12477266e5d9ec6fa09e004ea3b366242", "sequence": "GATCATGCTTACCCGGTCAGCAAGGTGTTCCGGGTGTGGACCGTTAGGGCGTTACTAGTTGCAATCGATCACTCATAACTTAACGAAACAAATTGCGTGTATTGTGAATCCCCTGAAATAGTTACATGTCCTAGGTTTGTTTTCGTATGAATGGGGTTTTGACCGAATTGCTGATTTTTTGTCTCAGCTCCTGCTTTCTGGTGATGTTTACTATATATTGCACTTATACCTGTACTGTAGTCTGTAATGTCACAGTACTGGGCGGCGAAATACCCTTTGCTAACAAATTGGTCGCGTGGCCTTATGGACAAATTACCGCGGACATGAGGGCCGTTTCCAACGAGAAACCACCGAACGTCTGTTTCTTTTTTATCGCCTACTTCTCACACCGGTGCCCGTGAATCGAGCTCGTCGACTTATTTCTACGACCGGGTTTCCTGGCAAGTGGTGCAAATAGAGTGTAGGTGAATGCGACACCTAGTTGCTACGACTTTAGATAAAATTGTGAGCTGATAACAATTGATCATGCTTACCCGGTCAGCAAGGTGTTCCGGGTGTGGACCGTTAGGGCGTTACTAGTTGCAATCGATCACTCATAACTTAACGAAACAAATTGCGTGTATTGTGAATCCCCTGAAATAGTTACATGTCCTAGGTTTGTTTTCGTATGAATGGGGTTTTGACCGAATTGCTGATTTTTTGTCTCAGCTCCTGCTTTCTGGTGATGTTTACTATATATTGCACTTATACCTGTACTGTAGTCTGTAATGTCACAGTACTGGGCGGCGAAATACCCTTTGCTAACAAATTGGTCGCGTGGCCTTATGGACAAATTACCGCGGACATGAGGGCCGTTTCCAACGAGAAACCACCGAACGTCTGTTTCTTTTTTATCGCCTACTTCTCACACCGGTGCCCGTGAATCGAGCTCGTCGACTTATTTCTACGACCGGGTTTCCTGGCAAGTGGTGCAAATAGAGTGTAGGTGAATGCGACACCTAGTTGCTACGACTTTAGATAA", "expected": { "call": null, "calls": [] }, "absenceScan": { "method": "brute-force scan of both strands at every offset, through the origin when circular; no engine and no aligner", "featureLength": 21, "mismatchesAllowed": 0, "offsetsScanned": 2002, "occurrences": [] } }, { "feature": "lacO", "length": 21, "way": "truncated", "circular": false, "sha256": "8173630003982495a858fd94f5d7c5f74292881707863182727d8e37e468dd68", "sequence": "GATCATGCTTACCCGGTCAGCAAGGTGTTCCGGGTGTGGACCGTTAGGGCGTTACTAGTTGCAATCGATCACTCATAACTTAACGAAACAAATTGCGTGTATTGTGAATCCCCTGAAATAGTTACATGTCCTAGGTTTGTTTTCGTATGAATGGGGTTTTGACCGAATTGCTGATTTTTTGTCTCAGCTCCTGCTTTCTGGTGATGTTTACTATATATTGCACTTATACCTGTACTGTAGTCTGTAATGTCACAGTACTGGGCGGCGAAATACCCTTTGCTAACAAATTGGTCGCGTGGCCTTATGGACAAATTACCGCGGACATGAGGGCCGTTTCCAACGAGAAACCACCGAACGTCTGTTTCTTTTTTATCGCCTACTTCTCACACCGGTGCCCGTGAATCGAGCTCGTCGACTTATTTCTACGACCGGGTTTCCTGGCAAGTGGTGCAAATAGAGTGTAGGTGAATGCGACACCTAGTTGCTACGACTTTAGATAAAATTGTGAGCGGATAACAATAATCATGCTTACCCGGTCAGCAAGGTGTTCCGGGTGTGGACCGTTAGGGCGTTACTAGTTGCAATCGATCACTCATAACTTAACGAAACAAATTGCGTGTATTGTGAATCCCCTGAAATAGTTACATGTCCTAGGTTTGTTTTCGTATGAATGGGGTTTTGACCGAATTGCTGATTTTTTGTCTCAGCTCCTGCTTTCTGGTGATGTTTACTATATATTGCACTTATACCTGTACTGTAGTCTGTAATGTCACAGTACTGGGCGGCGAAATACCCTTTGCTAACAAATTGGTCGCGTGGCCTTATGGACAAATTACCGCGGACATGAGGGCCGTTTCCAACGAGAAACCACCGAACGTCTGTTTCTTTTTTATCGCCTACTTCTCACACCGGTGCCCGTGAATCGAGCTCGTCGACTTATTTCTACGACCGGGTTTCCTGGCAAGTGGTGCAAATAGAGTGTAGGTGAATGCGACACCTAGTTGCTACGACTTTAGATAA", "expected": { "call": null, "calls": [] }, "absenceScan": { "method": "brute-force scan of both strands at every offset, through the origin when circular; no engine and no aligner", "featureLength": 21, "mismatchesAllowed": 0, "offsetsScanned": 2000, "occurrences": [] } }, { "feature": "tac", "length": 29, "way": "exact", "circular": false, "sha256": "254bf87e1aa0e03e4d9b04a667be10b6c6a70b0d2890b2de0879c4065b58920d", "sequence": "GATCATGCTTACCCGGTCAGCAAGGTGTTCCGGGTGTGGACCGTTAGGGCGTTACTAGTTGCAATCGATCACTCATAACTTAACGAAACAAATTGCGTGTATTGTGAATCCCCTGAAATAGTTACATGTCCTAGGTTTGTTTTCGTATGAATGGGGTTTTGACCGAATTGCTGATTTTTTGTCTCAGCTCCTGCTTTCTGGTGATGTTTACTATATATTGCACTTATACCTGTACTGTAGTCTGTAATGTCACAGTACTGGGCGGCGAAATACCCTTTGCTAACAAATTGGTCGCGTGGCCTTATGGACAAATTACCGCGGACATGAGGGCCGTTTCCAACGAGAAACCACCGAACGTCTGTTTCTTTTTTATCGCCTACTTCTCACACCGGTGCCCGTGAATCGAGCTCGTCGACTTATTTCTACGACCGGGTTTCCTGGCAAGTGGTGCAAATAGAGTGTAGGTGAATGCGACACCTAGTTGCTACGACTTTAGATAATTGACAATTAATCATCGGCTCGTATAATGGATCATGCTTACCCGGTCAGCAAGGTGTTCCGGGTGTGGACCGTTAGGGCGTTACTAGTTGCAATCGATCACTCATAACTTAACGAAACAAATTGCGTGTATTGTGAATCCCCTGAAATAGTTACATGTCCTAGGTTTGTTTTCGTATGAATGGGGTTTTGACCGAATTGCTGATTTTTTGTCTCAGCTCCTGCTTTCTGGTGATGTTTACTATATATTGCACTTATACCTGTACTGTAGTCTGTAATGTCACAGTACTGGGCGGCGAAATACCCTTTGCTAACAAATTGGTCGCGTGGCCTTATGGACAAATTACCGCGGACATGAGGGCCGTTTCCAACGAGAAACCACCGAACGTCTGTTTCTTTTTTATCGCCTACTTCTCACACCGGTGCCCGTGAATCGAGCTCGTCGACTTATTTCTACGACCGGGTTTCCTGGCAAGTGGTGCAAATAGAGTGTAGGTGAATGCGACACCTAGTTGCTACGACTTTAGATAA", "expected": { "call": "match", "calls": [ { "featureId": "tac", "strand": "+", "start": 501, "end": 529, "call": "match", "identityExact": "29/29", "coverageExact": "29/29", "score": 58.0 } ] } }, { "feature": "tac", "length": 29, "way": "reverse-complemented", "circular": false, "sha256": "0951cb86d5aa7a4a1f7fcc142aba05793f8dfa05dddcccba111b7e8032dc743f", "sequence": "GATCATGCTTACCCGGTCAGCAAGGTGTTCCGGGTGTGGACCGTTAGGGCGTTACTAGTTGCAATCGATCACTCATAACTTAACGAAACAAATTGCGTGTATTGTGAATCCCCTGAAATAGTTACATGTCCTAGGTTTGTTTTCGTATGAATGGGGTTTTGACCGAATTGCTGATTTTTTGTCTCAGCTCCTGCTTTCTGGTGATGTTTACTATATATTGCACTTATACCTGTACTGTAGTCTGTAATGTCACAGTACTGGGCGGCGAAATACCCTTTGCTAACAAATTGGTCGCGTGGCCTTATGGACAAATTACCGCGGACATGAGGGCCGTTTCCAACGAGAAACCACCGAACGTCTGTTTCTTTTTTATCGCCTACTTCTCACACCGGTGCCCGTGAATCGAGCTCGTCGACTTATTTCTACGACCGGGTTTCCTGGCAAGTGGTGCAAATAGAGTGTAGGTGAATGCGACACCTAGTTGCTACGACTTTAGATAACATTATACGAGCCGATGATTAATTGTCAAGATCATGCTTACCCGGTCAGCAAGGTGTTCCGGGTGTGGACCGTTAGGGCGTTACTAGTTGCAATCGATCACTCATAACTTAACGAAACAAATTGCGTGTATTGTGAATCCCCTGAAATAGTTACATGTCCTAGGTTTGTTTTCGTATGAATGGGGTTTTGACCGAATTGCTGATTTTTTGTCTCAGCTCCTGCTTTCTGGTGATGTTTACTATATATTGCACTTATACCTGTACTGTAGTCTGTAATGTCACAGTACTGGGCGGCGAAATACCCTTTGCTAACAAATTGGTCGCGTGGCCTTATGGACAAATTACCGCGGACATGAGGGCCGTTTCCAACGAGAAACCACCGAACGTCTGTTTCTTTTTTATCGCCTACTTCTCACACCGGTGCCCGTGAATCGAGCTCGTCGACTTATTTCTACGACCGGGTTTCCTGGCAAGTGGTGCAAATAGAGTGTAGGTGAATGCGACACCTAGTTGCTACGACTTTAGATAA", "expected": { "call": "match", "calls": [ { "featureId": "tac", "strand": "-", "start": 501, "end": 529, "call": "match", "identityExact": "29/29", "coverageExact": "29/29", "score": 58.0 } ] } }, { "feature": "tac", "length": 29, "way": "across the origin", "circular": true, "sha256": "4518bce0cca49cadba440e28530be07abcd62dc2319ec35ad69efe1a11607145", "sequence": "TCGGCTCGTATAATGGATCATGCTTACCCGGTCAGCAAGGTGTTCCGGGTGTGGACCGTTAGGGCGTTACTAGTTGCAATCGATCACTCATAACTTAACGAAACAAATTGCGTGTATTGTGAATCCCCTGAAATAGTTACATGTCCTAGGTTTGTTTTCGTATGAATGGGGTTTTGACCGAATTGCTGATTTTTTGTCTCAGCTCCTGCTTTCTGGTGATGTTTACTATATATTGCACTTATACCTGTACTGTAGTCTGTAATGTCACAGTACTGGGCGGCGAAATACCCTTTGCTAACAAATTGGTCGCGTGGCCTTATGGACAAATTACCGCGGACATGAGGGCCGTTTCCAACGAGAAACCACCGAACGTCTGTTTCTTTTTTATCGCCTACTTCTCACACCGGTGCCCGTGAATCGAGCTCGTCGACTTATTTCTACGACCGGGTTTCCTGGCAAGTGGTGCAAATAGAGTGTAGGTGAATGCGACACCTAGTTGCTACGACTTTAGATAATTGACAATTAATCA", "expected": { "call": "match", "calls": [ { "featureId": "tac", "strand": "+", "start": 516, "end": 15, "call": "match", "identityExact": "29/29", "coverageExact": "29/29", "score": 58.0 } ] } }, { "feature": "tac", "length": 29, "way": "one mismatch", "circular": false, "sha256": "d2d181785e40943531c554ab5073c55dbdb866d24b98e07c9d761d42746aeff8", "sequence": "GATCATGCTTACCCGGTCAGCAAGGTGTTCCGGGTGTGGACCGTTAGGGCGTTACTAGTTGCAATCGATCACTCATAACTTAACGAAACAAATTGCGTGTATTGTGAATCCCCTGAAATAGTTACATGTCCTAGGTTTGTTTTCGTATGAATGGGGTTTTGACCGAATTGCTGATTTTTTGTCTCAGCTCCTGCTTTCTGGTGATGTTTACTATATATTGCACTTATACCTGTACTGTAGTCTGTAATGTCACAGTACTGGGCGGCGAAATACCCTTTGCTAACAAATTGGTCGCGTGGCCTTATGGACAAATTACCGCGGACATGAGGGCCGTTTCCAACGAGAAACCACCGAACGTCTGTTTCTTTTTTATCGCCTACTTCTCACACCGGTGCCCGTGAATCGAGCTCGTCGACTTATTTCTACGACCGGGTTTCCTGGCAAGTGGTGCAAATAGAGTGTAGGTGAATGCGACACCTAGTTGCTACGACTTTAGATAATTGACAATTAATCAACGGCTCGTATAATGGATCATGCTTACCCGGTCAGCAAGGTGTTCCGGGTGTGGACCGTTAGGGCGTTACTAGTTGCAATCGATCACTCATAACTTAACGAAACAAATTGCGTGTATTGTGAATCCCCTGAAATAGTTACATGTCCTAGGTTTGTTTTCGTATGAATGGGGTTTTGACCGAATTGCTGATTTTTTGTCTCAGCTCCTGCTTTCTGGTGATGTTTACTATATATTGCACTTATACCTGTACTGTAGTCTGTAATGTCACAGTACTGGGCGGCGAAATACCCTTTGCTAACAAATTGGTCGCGTGGCCTTATGGACAAATTACCGCGGACATGAGGGCCGTTTCCAACGAGAAACCACCGAACGTCTGTTTCTTTTTTATCGCCTACTTCTCACACCGGTGCCCGTGAATCGAGCTCGTCGACTTATTTCTACGACCGGGTTTCCTGGCAAGTGGTGCAAATAGAGTGTAGGTGAATGCGACACCTAGTTGCTACGACTTTAGATAA", "expected": { "call": null, "calls": [] }, "absenceScan": { "method": "brute-force scan of both strands at every offset, through the origin when circular; no engine and no aligner", "featureLength": 29, "mismatchesAllowed": 0, "offsetsScanned": 2002, "occurrences": [] } }, { "feature": "tac", "length": 29, "way": "truncated", "circular": false, "sha256": "3a5065780a599d43712f7d1b1632caaabe8a0d26d5d380ba19ab3283fb0a1278", "sequence": "GATCATGCTTACCCGGTCAGCAAGGTGTTCCGGGTGTGGACCGTTAGGGCGTTACTAGTTGCAATCGATCACTCATAACTTAACGAAACAAATTGCGTGTATTGTGAATCCCCTGAAATAGTTACATGTCCTAGGTTTGTTTTCGTATGAATGGGGTTTTGACCGAATTGCTGATTTTTTGTCTCAGCTCCTGCTTTCTGGTGATGTTTACTATATATTGCACTTATACCTGTACTGTAGTCTGTAATGTCACAGTACTGGGCGGCGAAATACCCTTTGCTAACAAATTGGTCGCGTGGCCTTATGGACAAATTACCGCGGACATGAGGGCCGTTTCCAACGAGAAACCACCGAACGTCTGTTTCTTTTTTATCGCCTACTTCTCACACCGGTGCCCGTGAATCGAGCTCGTCGACTTATTTCTACGACCGGGTTTCCTGGCAAGTGGTGCAAATAGAGTGTAGGTGAATGCGACACCTAGTTGCTACGACTTTAGATAATTGACAATTAATCATCGGCTCGTATAATTATCATGCTTACCCGGTCAGCAAGGTGTTCCGGGTGTGGACCGTTAGGGCGTTACTAGTTGCAATCGATCACTCATAACTTAACGAAACAAATTGCGTGTATTGTGAATCCCCTGAAATAGTTACATGTCCTAGGTTTGTTTTCGTATGAATGGGGTTTTGACCGAATTGCTGATTTTTTGTCTCAGCTCCTGCTTTCTGGTGATGTTTACTATATATTGCACTTATACCTGTACTGTAGTCTGTAATGTCACAGTACTGGGCGGCGAAATACCCTTTGCTAACAAATTGGTCGCGTGGCCTTATGGACAAATTACCGCGGACATGAGGGCCGTTTCCAACGAGAAACCACCGAACGTCTGTTTCTTTTTTATCGCCTACTTCTCACACCGGTGCCCGTGAATCGAGCTCGTCGACTTATTTCTACGACCGGGTTTCCTGGCAAGTGGTGCAAATAGAGTGTAGGTGAATGCGACACCTAGTTGCTACGACTTTAGATAA", "expected": { "call": null, "calls": [] }, "absenceScan": { "method": "brute-force scan of both strands at every offset, through the origin when circular; no engine and no aligner", "featureLength": 29, "mismatchesAllowed": 0, "offsetsScanned": 2000, "occurrences": [] } }, { "feature": "flagTag", "length": 24, "way": "exact", "circular": false, "sha256": "b3b9d86c3edb52caf81afa8fa697f461aca21e88ab59e4ba729d8473a6abde14", "sequence": "GATCATGCTTACCCGGTCAGCAAGGTGTTCCGGGTGTGGACCGTTAGGGCGTTACTAGTTGCAATCGATCACTCATAACTTAACGAAACAAATTGCGTGTATTGTGAATCCCCTGAAATAGTTACATGTCCTAGGTTTGTTTTCGTATGAATGGGGTTTTGACCGAATTGCTGATTTTTTGTCTCAGCTCCTGCTTTCTGGTGATGTTTACTATATATTGCACTTATACCTGTACTGTAGTCTGTAATGTCACAGTACTGGGCGGCGAAATACCCTTTGCTAACAAATTGGTCGCGTGGCCTTATGGACAAATTACCGCGGACATGAGGGCCGTTTCCAACGAGAAACCACCGAACGTCTGTTTCTTTTTTATCGCCTACTTCTCACACCGGTGCCCGTGAATCGAGCTCGTCGACTTATTTCTACGACCGGGTTTCCTGGCAAGTGGTGCAAATAGAGTGTAGGTGAATGCGACACCTAGTTGCTACGACTTTAGATAAGACTACAAGGATGACGACGACAAGGATCATGCTTACCCGGTCAGCAAGGTGTTCCGGGTGTGGACCGTTAGGGCGTTACTAGTTGCAATCGATCACTCATAACTTAACGAAACAAATTGCGTGTATTGTGAATCCCCTGAAATAGTTACATGTCCTAGGTTTGTTTTCGTATGAATGGGGTTTTGACCGAATTGCTGATTTTTTGTCTCAGCTCCTGCTTTCTGGTGATGTTTACTATATATTGCACTTATACCTGTACTGTAGTCTGTAATGTCACAGTACTGGGCGGCGAAATACCCTTTGCTAACAAATTGGTCGCGTGGCCTTATGGACAAATTACCGCGGACATGAGGGCCGTTTCCAACGAGAAACCACCGAACGTCTGTTTCTTTTTTATCGCCTACTTCTCACACCGGTGCCCGTGAATCGAGCTCGTCGACTTATTTCTACGACCGGGTTTCCTGGCAAGTGGTGCAAATAGAGTGTAGGTGAATGCGACACCTAGTTGCTACGACTTTAGATAA", "expected": { "call": "match", "calls": [ { "featureId": "flagTag", "strand": "+", "start": 501, "end": 524, "call": "match", "identityExact": "24/24", "coverageExact": "24/24", "score": 48.0 } ] } }, { "feature": "flagTag", "length": 24, "way": "reverse-complemented", "circular": false, "sha256": "d296d168a85c74907e2346f53ea61b121aee22c819037d4ad9e2a5a57247d11e", "sequence": "GATCATGCTTACCCGGTCAGCAAGGTGTTCCGGGTGTGGACCGTTAGGGCGTTACTAGTTGCAATCGATCACTCATAACTTAACGAAACAAATTGCGTGTATTGTGAATCCCCTGAAATAGTTACATGTCCTAGGTTTGTTTTCGTATGAATGGGGTTTTGACCGAATTGCTGATTTTTTGTCTCAGCTCCTGCTTTCTGGTGATGTTTACTATATATTGCACTTATACCTGTACTGTAGTCTGTAATGTCACAGTACTGGGCGGCGAAATACCCTTTGCTAACAAATTGGTCGCGTGGCCTTATGGACAAATTACCGCGGACATGAGGGCCGTTTCCAACGAGAAACCACCGAACGTCTGTTTCTTTTTTATCGCCTACTTCTCACACCGGTGCCCGTGAATCGAGCTCGTCGACTTATTTCTACGACCGGGTTTCCTGGCAAGTGGTGCAAATAGAGTGTAGGTGAATGCGACACCTAGTTGCTACGACTTTAGATAACTTGTCGTCGTCATCCTTGTAGTCGATCATGCTTACCCGGTCAGCAAGGTGTTCCGGGTGTGGACCGTTAGGGCGTTACTAGTTGCAATCGATCACTCATAACTTAACGAAACAAATTGCGTGTATTGTGAATCCCCTGAAATAGTTACATGTCCTAGGTTTGTTTTCGTATGAATGGGGTTTTGACCGAATTGCTGATTTTTTGTCTCAGCTCCTGCTTTCTGGTGATGTTTACTATATATTGCACTTATACCTGTACTGTAGTCTGTAATGTCACAGTACTGGGCGGCGAAATACCCTTTGCTAACAAATTGGTCGCGTGGCCTTATGGACAAATTACCGCGGACATGAGGGCCGTTTCCAACGAGAAACCACCGAACGTCTGTTTCTTTTTTATCGCCTACTTCTCACACCGGTGCCCGTGAATCGAGCTCGTCGACTTATTTCTACGACCGGGTTTCCTGGCAAGTGGTGCAAATAGAGTGTAGGTGAATGCGACACCTAGTTGCTACGACTTTAGATAA", "expected": { "call": "match", "calls": [ { "featureId": "flagTag", "strand": "-", "start": 501, "end": 524, "call": "match", "identityExact": "24/24", "coverageExact": "24/24", "score": 48.0 } ] } }, { "feature": "flagTag", "length": 24, "way": "across the origin", "circular": true, "sha256": "67ab0c1a9acb439175d3f21656e0ef14bb5eb6319c09189a716e9e42f1ad2911", "sequence": "GACGACGACAAGGATCATGCTTACCCGGTCAGCAAGGTGTTCCGGGTGTGGACCGTTAGGGCGTTACTAGTTGCAATCGATCACTCATAACTTAACGAAACAAATTGCGTGTATTGTGAATCCCCTGAAATAGTTACATGTCCTAGGTTTGTTTTCGTATGAATGGGGTTTTGACCGAATTGCTGATTTTTTGTCTCAGCTCCTGCTTTCTGGTGATGTTTACTATATATTGCACTTATACCTGTACTGTAGTCTGTAATGTCACAGTACTGGGCGGCGAAATACCCTTTGCTAACAAATTGGTCGCGTGGCCTTATGGACAAATTACCGCGGACATGAGGGCCGTTTCCAACGAGAAACCACCGAACGTCTGTTTCTTTTTTATCGCCTACTTCTCACACCGGTGCCCGTGAATCGAGCTCGTCGACTTATTTCTACGACCGGGTTTCCTGGCAAGTGGTGCAAATAGAGTGTAGGTGAATGCGACACCTAGTTGCTACGACTTTAGATAAGACTACAAGGAT", "expected": { "call": "match", "calls": [ { "featureId": "flagTag", "strand": "+", "start": 513, "end": 12, "call": "match", "identityExact": "24/24", "coverageExact": "24/24", "score": 48.0 } ] } }, { "feature": "flagTag", "length": 24, "way": "one mismatch", "circular": false, "sha256": "d364a06a1805085574672671edbb79b6352ac3be2bdf5c2dbbabf642216734ec", "sequence": "GATCATGCTTACCCGGTCAGCAAGGTGTTCCGGGTGTGGACCGTTAGGGCGTTACTAGTTGCAATCGATCACTCATAACTTAACGAAACAAATTGCGTGTATTGTGAATCCCCTGAAATAGTTACATGTCCTAGGTTTGTTTTCGTATGAATGGGGTTTTGACCGAATTGCTGATTTTTTGTCTCAGCTCCTGCTTTCTGGTGATGTTTACTATATATTGCACTTATACCTGTACTGTAGTCTGTAATGTCACAGTACTGGGCGGCGAAATACCCTTTGCTAACAAATTGGTCGCGTGGCCTTATGGACAAATTACCGCGGACATGAGGGCCGTTTCCAACGAGAAACCACCGAACGTCTGTTTCTTTTTTATCGCCTACTTCTCACACCGGTGCCCGTGAATCGAGCTCGTCGACTTATTTCTACGACCGGGTTTCCTGGCAAGTGGTGCAAATAGAGTGTAGGTGAATGCGACACCTAGTTGCTACGACTTTAGATAAGACTACAAGGATTACGACGACAAGGATCATGCTTACCCGGTCAGCAAGGTGTTCCGGGTGTGGACCGTTAGGGCGTTACTAGTTGCAATCGATCACTCATAACTTAACGAAACAAATTGCGTGTATTGTGAATCCCCTGAAATAGTTACATGTCCTAGGTTTGTTTTCGTATGAATGGGGTTTTGACCGAATTGCTGATTTTTTGTCTCAGCTCCTGCTTTCTGGTGATGTTTACTATATATTGCACTTATACCTGTACTGTAGTCTGTAATGTCACAGTACTGGGCGGCGAAATACCCTTTGCTAACAAATTGGTCGCGTGGCCTTATGGACAAATTACCGCGGACATGAGGGCCGTTTCCAACGAGAAACCACCGAACGTCTGTTTCTTTTTTATCGCCTACTTCTCACACCGGTGCCCGTGAATCGAGCTCGTCGACTTATTTCTACGACCGGGTTTCCTGGCAAGTGGTGCAAATAGAGTGTAGGTGAATGCGACACCTAGTTGCTACGACTTTAGATAA", "expected": { "call": null, "calls": [] }, "absenceScan": { "method": "brute-force scan of both strands at every offset, through the origin when circular; no engine and no aligner", "featureLength": 24, "mismatchesAllowed": 0, "offsetsScanned": 2002, "occurrences": [] } }, { "feature": "flagTag", "length": 24, "way": "truncated", "circular": false, "sha256": "a9986e69a6452ba15090cbf726349572373f6e16550b9cc4b17dc7c6d07e997f", "sequence": "GATCATGCTTACCCGGTCAGCAAGGTGTTCCGGGTGTGGACCGTTAGGGCGTTACTAGTTGCAATCGATCACTCATAACTTAACGAAACAAATTGCGTGTATTGTGAATCCCCTGAAATAGTTACATGTCCTAGGTTTGTTTTCGTATGAATGGGGTTTTGACCGAATTGCTGATTTTTTGTCTCAGCTCCTGCTTTCTGGTGATGTTTACTATATATTGCACTTATACCTGTACTGTAGTCTGTAATGTCACAGTACTGGGCGGCGAAATACCCTTTGCTAACAAATTGGTCGCGTGGCCTTATGGACAAATTACCGCGGACATGAGGGCCGTTTCCAACGAGAAACCACCGAACGTCTGTTTCTTTTTTATCGCCTACTTCTCACACCGGTGCCCGTGAATCGAGCTCGTCGACTTATTTCTACGACCGGGTTTCCTGGCAAGTGGTGCAAATAGAGTGTAGGTGAATGCGACACCTAGTTGCTACGACTTTAGATAAGACTACAAGGATGACGACGACAATATCATGCTTACCCGGTCAGCAAGGTGTTCCGGGTGTGGACCGTTAGGGCGTTACTAGTTGCAATCGATCACTCATAACTTAACGAAACAAATTGCGTGTATTGTGAATCCCCTGAAATAGTTACATGTCCTAGGTTTGTTTTCGTATGAATGGGGTTTTGACCGAATTGCTGATTTTTTGTCTCAGCTCCTGCTTTCTGGTGATGTTTACTATATATTGCACTTATACCTGTACTGTAGTCTGTAATGTCACAGTACTGGGCGGCGAAATACCCTTTGCTAACAAATTGGTCGCGTGGCCTTATGGACAAATTACCGCGGACATGAGGGCCGTTTCCAACGAGAAACCACCGAACGTCTGTTTCTTTTTTATCGCCTACTTCTCACACCGGTGCCCGTGAATCGAGCTCGTCGACTTATTTCTACGACCGGGTTTCCTGGCAAGTGGTGCAAATAGAGTGTAGGTGAATGCGACACCTAGTTGCTACGACTTTAGATAA", "expected": { "call": null, "calls": [] }, "absenceScan": { "method": "brute-force scan of both strands at every offset, through the origin when circular; no engine and no aligner", "featureLength": 24, "mismatchesAllowed": 0, "offsetsScanned": 2000, "occurrences": [] } } ], "family": [ { "family": "fluorescent proteins", "target": "egfp", "targetLength": 720, "best": "egfp", "withinThresholds": [ { "feature": "egfp", "call": "match", "score": 1440.0, "identityExact": "720/720", "coverageExact": "720/720" }, { "feature": "ebfp2", "call": "partial", "score": 1335.0, "identityExact": "699/720", "coverageExact": "720/720" }, { "feature": "mKalama1", "call": "partial", "score": 1205.0, "identityExact": "673/720", "coverageExact": "720/720" } ], "alsoWithinThresholds": [ "ebfp2", "mKalama1" ], "shownInside": [] }, { "family": "fluorescent proteins", "target": "gfp", "targetLength": 717, "best": "gfp", "withinThresholds": [ { "feature": "gfp", "call": "match", "score": 1434.0, "identityExact": "717/717", "coverageExact": "717/717" } ], "alsoWithinThresholds": [], "shownInside": [] }, { "family": "fluorescent proteins", "target": "mCherry", "targetLength": 711, "best": "mCherry", "withinThresholds": [ { "feature": "mCherry", "call": "match", "score": 1422.0, "identityExact": "711/711", "coverageExact": "711/711" }, { "feature": "mStrawberry", "call": "partial", "score": 1347.0, "identityExact": "696/711", "coverageExact": "711/711" }, { "feature": "mOrange", "call": "partial", "score": 1332.0, "identityExact": "693/711", "coverageExact": "711/711" }, { "feature": "mOrange2", "call": "partial", "score": 1322.0, "identityExact": "691/711", "coverageExact": "711/711" }, { "feature": "mBlueberry2", "call": "partial", "score": 1285.0, "identityExact": "685/712", "coverageExact": "711/711" }, { "feature": "mApple", "call": "partial", "score": 1257.0, "identityExact": "678/711", "coverageExact": "711/711" }, { "feature": "mBanana", "call": "partial", "score": 1245.0, "identityExact": "677/712", "coverageExact": "711/711" }, { "feature": "mRfp1", "call": "partial", "score": 1233.0, "identityExact": "639/654", "coverageExact": "654/678" }, { "feature": "mTangerine", "call": "partial", "score": 1226.0, "identityExact": "639/655", "coverageExact": "654/678" }, { "feature": "mHoneydew", "call": "partial", "score": 1208.0, "identityExact": "634/654", "coverageExact": "654/678" }, { "feature": "dTomato", "call": "partial", "score": 1096.0, "identityExact": "648/719", "coverageExact": "705/705" } ], "alsoWithinThresholds": [ "mStrawberry", "mOrange", "mOrange2", "mBlueberry2", "mApple", "mBanana", "mRfp1", "mTangerine", "mHoneydew", "dTomato" ], "shownInside": [] }, { "family": "fluorescent proteins", "target": "tdTomato", "targetLength": 1431, "best": "tdTomato", "withinThresholds": [ { "feature": "tdTomato", "call": "match", "score": 2862.0, "identityExact": "1431/1431", "coverageExact": "1431/1431" }, { "feature": "dTomato", "call": "match", "score": 1368.0, "identityExact": "684/684", "coverageExact": "684/705" }, { "feature": "mCherry", "call": "partial", "score": 1099.0, "identityExact": "642/705", "coverageExact": "697/711" }, { "feature": "mStrawberry", "call": "partial", "score": 1066.0, "identityExact": "637/707", "coverageExact": "697/711" }, { "feature": "mRfp1", "call": "partial", "score": 1062.0, "identityExact": "609/660", "coverageExact": "658/678" }, { "feature": "mHoneydew", "call": "partial", "score": 1047.0, "identityExact": "606/660", "coverageExact": "658/678" }, { "feature": "mTangerine", "call": "partial", "score": 1045.0, "identityExact": "607/661", "coverageExact": "658/678" } ], "alsoWithinThresholds": [ "dTomato", "mCherry", "mStrawberry", "mRfp1", "mHoneydew", "mTangerine" ], "shownInside": [] }, { "family": "fluorescent proteins", "target": "dTomato", "targetLength": 705, "best": "dTomato", "withinThresholds": [ { "feature": "dTomato", "call": "match", "score": 1410.0, "identityExact": "705/705", "coverageExact": "705/705" }, { "feature": "mCherry", "call": "partial", "score": 1096.0, "identityExact": "648/719", "coverageExact": "711/711" }, { "feature": "mRfp1", "call": "partial", "score": 1062.0, "identityExact": "609/660", "coverageExact": "658/678" }, { "feature": "mHoneydew", "call": "partial", "score": 1047.0, "identityExact": "606/660", "coverageExact": "658/678" }, { "feature": "mTangerine", "call": "partial", "score": 1045.0, "identityExact": "607/661", "coverageExact": "658/678" } ], "alsoWithinThresholds": [ "mCherry", "mRfp1", "mHoneydew", "mTangerine" ], "shownInside": [] }, { "family": "fluorescent proteins", "target": "mOrange", "targetLength": 711, "best": "mOrange", "withinThresholds": [ { "feature": "mOrange", "call": "match", "score": 1422.0, "identityExact": "711/711", "coverageExact": "711/711" }, { "feature": "mOrange2", "call": "match", "score": 1402.0, "identityExact": "707/711", "coverageExact": "711/711" }, { "feature": "mStrawberry", "call": "partial", "score": 1347.0, "identityExact": "696/711", "coverageExact": "711/711" }, { "feature": "mCherry", "call": "partial", "score": 1332.0, "identityExact": "693/711", "coverageExact": "711/711" }, { "feature": "mApple", "call": "partial", "score": 1277.0, "identityExact": "682/711", "coverageExact": "711/711" }, { "feature": "mBanana", "call": "partial", "score": 1272.0, "identityExact": "681/711", "coverageExact": "711/711" }, { "feature": "mBlueberry2", "call": "partial", "score": 1240.0, "identityExact": "676/712", "coverageExact": "711/711" }, { "feature": "mRfp1", "call": "partial", "score": 1203.0, "identityExact": "633/654", "coverageExact": "654/678" }, { "feature": "mTangerine", "call": "partial", "score": 1198.0, "identityExact": "632/654", "coverageExact": "654/678" }, { "feature": "mHoneydew", "call": "partial", "score": 1174.0, "identityExact": "629/657", "coverageExact": "654/678" } ], "alsoWithinThresholds": [ "mOrange2", "mStrawberry", "mCherry", "mApple", "mBanana", "mBlueberry2", "mRfp1", "mTangerine", "mHoneydew" ], "shownInside": [] }, { "family": "fluorescent proteins", "target": "mOrange2", "targetLength": 711, "best": "mOrange2", "withinThresholds": [ { "feature": "mOrange2", "call": "match", "score": 1422.0, "identityExact": "711/711", "coverageExact": "711/711" }, { "feature": "mOrange", "call": "match", "score": 1402.0, "identityExact": "707/711", "coverageExact": "711/711" }, { "feature": "mStrawberry", "call": "partial", "score": 1332.0, "identityExact": "693/711", "coverageExact": "711/711" }, { "feature": "mCherry", "call": "partial", "score": 1322.0, "identityExact": "691/711", "coverageExact": "711/711" }, { "feature": "mApple", "call": "partial", "score": 1267.0, "identityExact": "680/711", "coverageExact": "711/711" }, { "feature": "mBanana", "call": "partial", "score": 1252.0, "identityExact": "677/711", "coverageExact": "711/711" }, { "feature": "mBlueberry2", "call": "partial", "score": 1230.0, "identityExact": "674/712", "coverageExact": "711/711" }, { "feature": "mRfp1", "call": "partial", "score": 1193.0, "identityExact": "631/654", "coverageExact": "654/678" }, { "feature": "mTangerine", "call": "partial", "score": 1188.0, "identityExact": "630/654", "coverageExact": "654/678" }, { "feature": "mHoneydew", "call": "partial", "score": 1163.0, "identityExact": "625/654", "coverageExact": "654/678" } ], "alsoWithinThresholds": [ "mOrange", "mStrawberry", "mCherry", "mApple", "mBanana", "mBlueberry2", "mRfp1", "mTangerine", "mHoneydew" ], "shownInside": [] }, { "family": "fluorescent proteins", "target": "mStrawberry", "targetLength": 711, "best": "mStrawberry", "withinThresholds": [ { "feature": "mStrawberry", "call": "match", "score": 1422.0, "identityExact": "711/711", "coverageExact": "711/711" }, { "feature": "mCherry", "call": "partial", "score": 1347.0, "identityExact": "696/711", "coverageExact": "711/711" }, { "feature": "mOrange", "call": "partial", "score": 1347.0, "identityExact": "696/711", "coverageExact": "711/711" }, { "feature": "mOrange2", "call": "partial", "score": 1332.0, "identityExact": "693/711", "coverageExact": "711/711" }, { "feature": "mBanana", "call": "partial", "score": 1262.0, "identityExact": "679/711", "coverageExact": "711/711" }, { "feature": "mBlueberry2", "call": "partial", "score": 1245.0, "identityExact": "677/712", "coverageExact": "711/711" }, { "feature": "mApple", "call": "partial", "score": 1222.0, "identityExact": "671/711", "coverageExact": "711/711" }, { "feature": "mTangerine", "call": "partial", "score": 1213.0, "identityExact": "635/654", "coverageExact": "654/678" }, { "feature": "mRfp1", "call": "partial", "score": 1208.0, "identityExact": "634/654", "coverageExact": "654/678" }, { "feature": "mHoneydew", "call": "partial", "score": 1179.0, "identityExact": "630/657", "coverageExact": "654/678" } ], "alsoWithinThresholds": [ "mCherry", "mOrange", "mOrange2", "mBanana", "mBlueberry2", "mApple", "mTangerine", "mRfp1", "mHoneydew" ], "shownInside": [] }, { "family": "fluorescent proteins", "target": "mBanana", "targetLength": 711, "best": "mBanana", "withinThresholds": [ { "feature": "mBanana", "call": "match", "score": 1422.0, "identityExact": "711/711", "coverageExact": "711/711" }, { "feature": "mOrange", "call": "partial", "score": 1272.0, "identityExact": "681/711", "coverageExact": "711/711" }, { "feature": "mStrawberry", "call": "partial", "score": 1262.0, "identityExact": "679/711", "coverageExact": "711/711" }, { "feature": "mOrange2", "call": "partial", "score": 1252.0, "identityExact": "677/711", "coverageExact": "711/711" }, { "feature": "mCherry", "call": "partial", "score": 1245.0, "identityExact": "677/712", "coverageExact": "711/711" }, { "feature": "mTangerine", "call": "partial", "score": 1186.0, "identityExact": "634/660", "coverageExact": "659/678" }, { "feature": "mRfp1", "call": "partial", "score": 1161.0, "identityExact": "629/660", "coverageExact": "659/678" }, { "feature": "mBlueberry2", "call": "partial", "score": 1153.0, "identityExact": "660/713", "coverageExact": "711/711" }, { "feature": "mApple", "call": "partial", "score": 1145.0, "identityExact": "657/712", "coverageExact": "711/711" }, { "feature": "mHoneydew", "call": "partial", "score": 1144.0, "identityExact": "627/661", "coverageExact": "659/678" } ], "alsoWithinThresholds": [ "mOrange", "mStrawberry", "mOrange2", "mCherry", "mTangerine", "mRfp1", "mBlueberry2", "mApple", "mHoneydew" ], "shownInside": [] }, { "family": "fluorescent proteins", "target": "mTangerine", "targetLength": 678, "best": "mTangerine", "withinThresholds": [ { "feature": "mTangerine", "call": "match", "score": 1356.0, "identityExact": "678/678", "coverageExact": "678/678" }, { "feature": "mRfp1", "call": "match", "score": 1326.0, "identityExact": "672/678", "coverageExact": "678/678" }, { "feature": "mHoneydew", "call": "partial", "score": 1284.0, "identityExact": "665/679", "coverageExact": "678/678" }, { "feature": "mCherry", "call": "partial", "score": 1226.0, "identityExact": "639/655", "coverageExact": "654/711" }, { "feature": "mStrawberry", "call": "partial", "score": 1213.0, "identityExact": "635/654", "coverageExact": "654/711" }, { "feature": "mOrange", "call": "partial", "score": 1198.0, "identityExact": "632/654", "coverageExact": "654/711" }, { "feature": "mOrange2", "call": "partial", "score": 1188.0, "identityExact": "630/654", "coverageExact": "654/711" }, { "feature": "mBanana", "call": "partial", "score": 1186.0, "identityExact": "634/660", "coverageExact": "659/711" }, { "feature": "mBlueberry2", "call": "partial", "score": 1124.0, "identityExact": "620/656", "coverageExact": "654/711" }, { "feature": "mApple", "call": "partial", "score": 1096.0, "identityExact": "613/655", "coverageExact": "654/711" }, { "feature": "dTomato", "call": "partial", "score": 1045.0, "identityExact": "607/661", "coverageExact": "656/705" } ], "alsoWithinThresholds": [ "mRfp1", "mHoneydew", "mCherry", "mStrawberry", "mOrange", "mOrange2", "mBanana", "mBlueberry2", "mApple", "dTomato" ], "shownInside": [] }, { "family": "fluorescent proteins", "target": "mHoneydew", "targetLength": 678, "best": "mHoneydew", "withinThresholds": [ { "feature": "mHoneydew", "call": "match", "score": 1356.0, "identityExact": "678/678", "coverageExact": "678/678" }, { "feature": "mRfp1", "call": "partial", "score": 1301.0, "identityExact": "667/678", "coverageExact": "678/678" }, { "feature": "mTangerine", "call": "partial", "score": 1284.0, "identityExact": "665/679", "coverageExact": "678/678" }, { "feature": "mCherry", "call": "partial", "score": 1208.0, "identityExact": "634/654", "coverageExact": "654/711" }, { "feature": "mStrawberry", "call": "partial", "score": 1179.0, "identityExact": "630/657", "coverageExact": "654/711" }, { "feature": "mOrange", "call": "partial", "score": 1174.0, "identityExact": "629/657", "coverageExact": "654/711" }, { "feature": "mOrange2", "call": "partial", "score": 1163.0, "identityExact": "625/654", "coverageExact": "654/711" }, { "feature": "mBanana", "call": "partial", "score": 1144.0, "identityExact": "627/661", "coverageExact": "659/711" }, { "feature": "mBlueberry2", "call": "partial", "score": 1116.0, "identityExact": "617/655", "coverageExact": "654/711" }, { "feature": "mApple", "call": "partial", "score": 1083.0, "identityExact": "609/654", "coverageExact": "654/711" }, { "feature": "dTomato", "call": "partial", "score": 1047.0, "identityExact": "606/660", "coverageExact": "656/705" } ], "alsoWithinThresholds": [ "mRfp1", "mTangerine", "mCherry", "mStrawberry", "mOrange", "mOrange2", "mBanana", "mBlueberry2", "mApple", "dTomato" ], "shownInside": [] }, { "family": "fluorescent proteins", "target": "mApple", "targetLength": 711, "best": "mApple", "withinThresholds": [ { "feature": "mApple", "call": "match", "score": 1422.0, "identityExact": "711/711", "coverageExact": "711/711" }, { "feature": "mOrange", "call": "partial", "score": 1277.0, "identityExact": "682/711", "coverageExact": "711/711" }, { "feature": "mBlueberry2", "call": "partial", "score": 1270.0, "identityExact": "682/712", "coverageExact": "711/711" }, { "feature": "mOrange2", "call": "partial", "score": 1267.0, "identityExact": "680/711", "coverageExact": "711/711" }, { "feature": "mCherry", "call": "partial", "score": 1257.0, "identityExact": "678/711", "coverageExact": "711/711" }, { "feature": "mStrawberry", "call": "partial", "score": 1222.0, "identityExact": "671/711", "coverageExact": "711/711" }, { "feature": "mBanana", "call": "partial", "score": 1145.0, "identityExact": "657/712", "coverageExact": "711/711" }, { "feature": "mRfp1", "call": "partial", "score": 1108.0, "identityExact": "614/654", "coverageExact": "654/678" }, { "feature": "mTangerine", "call": "partial", "score": 1096.0, "identityExact": "613/655", "coverageExact": "654/678" }, { "feature": "mHoneydew", "call": "partial", "score": 1083.0, "identityExact": "609/654", "coverageExact": "654/678" } ], "alsoWithinThresholds": [ "mOrange", "mBlueberry2", "mOrange2", "mCherry", "mStrawberry", "mBanana", "mRfp1", "mTangerine", "mHoneydew" ], "shownInside": [] }, { "family": "fluorescent proteins", "target": "tagRfpT", "targetLength": 735, "best": "tagRfpT", "withinThresholds": [ { "feature": "tagRfpT", "call": "match", "score": 1470.0, "identityExact": "735/735", "coverageExact": "735/735" } ], "alsoWithinThresholds": [], "shownInside": [] }, { "family": "fluorescent proteins", "target": "mRfp1", "targetLength": 678, "best": "mRfp1", "withinThresholds": [ { "feature": "mRfp1", "call": "match", "score": 1356.0, "identityExact": "678/678", "coverageExact": "678/678" }, { "feature": "mTangerine", "call": "match", "score": 1326.0, "identityExact": "672/678", "coverageExact": "678/678" }, { "feature": "mHoneydew", "call": "partial", "score": 1301.0, "identityExact": "667/678", "coverageExact": "678/678" }, { "feature": "mCherry", "call": "partial", "score": 1233.0, "identityExact": "639/654", "coverageExact": "654/711" }, { "feature": "mStrawberry", "call": "partial", "score": 1208.0, "identityExact": "634/654", "coverageExact": "654/711" }, { "feature": "mOrange", "call": "partial", "score": 1203.0, "identityExact": "633/654", "coverageExact": "654/711" }, { "feature": "mOrange2", "call": "partial", "score": 1193.0, "identityExact": "631/654", "coverageExact": "654/711" }, { "feature": "mBanana", "call": "partial", "score": 1161.0, "identityExact": "629/660", "coverageExact": "659/711" }, { "feature": "mBlueberry2", "call": "partial", "score": 1136.0, "identityExact": "621/655", "coverageExact": "654/711" }, { "feature": "mApple", "call": "partial", "score": 1108.0, "identityExact": "614/654", "coverageExact": "654/711" }, { "feature": "dTomato", "call": "partial", "score": 1062.0, "identityExact": "609/660", "coverageExact": "656/705" } ], "alsoWithinThresholds": [ "mTangerine", "mHoneydew", "mCherry", "mStrawberry", "mOrange", "mOrange2", "mBanana", "mBlueberry2", "mApple", "dTomato" ], "shownInside": [] }, { "family": "fluorescent proteins", "target": "mBlueberry2", "targetLength": 711, "best": "mBlueberry2", "withinThresholds": [ { "feature": "mBlueberry2", "call": "match", "score": 1422.0, "identityExact": "711/711", "coverageExact": "711/711" }, { "feature": "mCherry", "call": "partial", "score": 1285.0, "identityExact": "685/712", "coverageExact": "711/711" }, { "feature": "mApple", "call": "partial", "score": 1270.0, "identityExact": "682/712", "coverageExact": "711/711" }, { "feature": "mStrawberry", "call": "partial", "score": 1245.0, "identityExact": "677/712", "coverageExact": "711/711" }, { "feature": "mOrange", "call": "partial", "score": 1240.0, "identityExact": "676/712", "coverageExact": "711/711" }, { "feature": "mOrange2", "call": "partial", "score": 1230.0, "identityExact": "674/712", "coverageExact": "711/711" }, { "feature": "mBanana", "call": "partial", "score": 1153.0, "identityExact": "660/713", "coverageExact": "711/711" }, { "feature": "mRfp1", "call": "partial", "score": 1136.0, "identityExact": "621/655", "coverageExact": "654/678" }, { "feature": "mTangerine", "call": "partial", "score": 1124.0, "identityExact": "620/656", "coverageExact": "654/678" }, { "feature": "mHoneydew", "call": "partial", "score": 1116.0, "identityExact": "617/655", "coverageExact": "654/678" } ], "alsoWithinThresholds": [ "mCherry", "mApple", "mStrawberry", "mOrange", "mOrange2", "mBanana", "mRfp1", "mTangerine", "mHoneydew" ], "shownInside": [] }, { "family": "fluorescent proteins", "target": "ebfp2", "targetLength": 720, "best": "ebfp2", "withinThresholds": [ { "feature": "ebfp2", "call": "match", "score": 1440.0, "identityExact": "720/720", "coverageExact": "720/720" }, { "feature": "egfp", "call": "partial", "score": 1335.0, "identityExact": "699/720", "coverageExact": "720/720" }, { "feature": "mKalama1", "call": "partial", "score": 1206.0, "identityExact": "675/723", "coverageExact": "720/720" } ], "alsoWithinThresholds": [ "egfp", "mKalama1" ], "shownInside": [] }, { "family": "fluorescent proteins", "target": "mKalama1", "targetLength": 720, "best": "mKalama1", "withinThresholds": [ { "feature": "mKalama1", "call": "match", "score": 1440.0, "identityExact": "720/720", "coverageExact": "720/720" }, { "feature": "ebfp2", "call": "partial", "score": 1206.0, "identityExact": "675/723", "coverageExact": "720/720" }, { "feature": "egfp", "call": "partial", "score": 1205.0, "identityExact": "673/720", "coverageExact": "720/720" } ], "alsoWithinThresholds": [ "ebfp2", "egfp" ], "shownInside": [] }, { "family": "luciferases", "target": "lucPlus", "targetLength": 1653, "best": "lucPlus", "withinThresholds": [ { "feature": "lucPlus", "call": "match", "score": 3306.0, "identityExact": "1653/1653", "coverageExact": "1653/1653" } ], "alsoWithinThresholds": [], "shownInside": [] }, { "family": "luciferases", "target": "luc2", "targetLength": 1653, "best": "luc2", "withinThresholds": [ { "feature": "luc2", "call": "match", "score": 3306.0, "identityExact": "1653/1653", "coverageExact": "1653/1653" } ], "alsoWithinThresholds": [], "shownInside": [] }, { "family": "luciferases", "target": "rluc", "targetLength": 936, "best": "rluc", "withinThresholds": [ { "feature": "rluc", "call": "match", "score": 1872.0, "identityExact": "936/936", "coverageExact": "936/936" } ], "alsoWithinThresholds": [], "shownInside": [] }, { "family": "aminoglycoside phosphotransferases", "target": "nptII", "targetLength": 795, "best": "nptII", "withinThresholds": [ { "feature": "nptII", "call": "match", "score": 1590.0, "identityExact": "795/795", "coverageExact": "795/795" } ], "alsoWithinThresholds": [], "shownInside": [] }, { "family": "aminoglycoside phosphotransferases", "target": "aph3Ia", "targetLength": 816, "best": "aph3Ia", "withinThresholds": [ { "feature": "aph3Ia", "call": "match", "score": 1632.0, "identityExact": "816/816", "coverageExact": "816/816" } ], "alsoWithinThresholds": [], "shownInside": [] }, { "family": "phage RNA polymerase promoters", "target": "t7Promoter", "targetLength": 19, "best": "t7Promoter", "withinThresholds": [ { "feature": "t7Promoter", "call": "match", "score": 38.0, "identityExact": "19/19", "coverageExact": "19/19" } ], "alsoWithinThresholds": [], "shownInside": [] }, { "family": "phage RNA polymerase promoters", "target": "t3Promoter", "targetLength": 19, "best": "t3Promoter", "withinThresholds": [ { "feature": "t3Promoter", "call": "match", "score": 38.0, "identityExact": "19/19", "coverageExact": "19/19" } ], "alsoWithinThresholds": [], "shownInside": [] }, { "family": "phage RNA polymerase promoters", "target": "sp6Promoter", "targetLength": 20, "best": "sp6Promoter", "withinThresholds": [ { "feature": "sp6Promoter", "call": "match", "score": 40.0, "identityExact": "20/20", "coverageExact": "20/20" } ], "alsoWithinThresholds": [], "shownInside": [] }, { "family": "lac and tac promoters", "target": "lacPromoter", "targetLength": 122, "best": "lacPromoter", "withinThresholds": [ { "feature": "lacPromoter", "call": "match", "score": 244.0, "identityExact": "122/122", "coverageExact": "122/122" }, { "feature": "capSite", "call": "match", "score": 76.0, "identityExact": "38/38", "coverageExact": "38/38" }, { "feature": "lacO", "call": "match", "score": 42.0, "identityExact": "21/21", "coverageExact": "21/21" } ], "alsoWithinThresholds": [], "shownInside": [ { "feature": "capSite", "container": "lacPromoter", "marking": "different-element" }, { "feature": "lacO", "container": "lacPromoter", "marking": "different-element" } ] }, { "family": "lac and tac promoters", "target": "tac", "targetLength": 29, "best": "tac", "withinThresholds": [ { "feature": "tac", "call": "match", "score": 58.0, "identityExact": "29/29", "coverageExact": "29/29" } ], "alsoWithinThresholds": [], "shownInside": [] }, { "family": "lac and tac promoters", "target": "trc", "targetLength": 246, "best": "trc", "withinThresholds": [ { "feature": "trc", "call": "match", "score": 492.0, "identityExact": "246/246", "coverageExact": "246/246" }, { "feature": "lacPromoter", "call": "partial", "score": 107.0, "identityExact": "65/72", "coverageExact": "72/122" }, { "feature": "lacO", "call": "match", "score": 42.0, "identityExact": "21/21", "coverageExact": "21/21" } ], "alsoWithinThresholds": [ "lacPromoter" ], "shownInside": [ { "feature": "lacO", "container": "trc", "marking": "different-element" } ] }, { "family": "lac and tac promoters", "target": "lacO", "targetLength": 21, "best": "lacO", "withinThresholds": [ { "feature": "lacO", "call": "match", "score": 42.0, "identityExact": "21/21", "coverageExact": "21/21" } ], "alsoWithinThresholds": [], "shownInside": [] }, { "family": "lac and tac promoters", "target": "capSite", "targetLength": 38, "best": "capSite", "withinThresholds": [ { "feature": "capSite", "call": "match", "score": 76.0, "identityExact": "38/38", "coverageExact": "38/38" } ], "alsoWithinThresholds": [], "shownInside": [] }, { "family": "lentiviral long terminal repeats", "target": "hiv1Ltr5", "targetLength": 634, "best": "hiv1Ltr5", "withinThresholds": [ { "feature": "hiv1Ltr5", "call": "match", "score": 1268.0, "identityExact": "634/634", "coverageExact": "634/634" }, { "feature": "hiv1Ltr3", "call": "partial", "score": 393.0, "identityExact": "198/199", "coverageExact": "199/235" } ], "alsoWithinThresholds": [ "hiv1Ltr3" ], "shownInside": [] }, { "family": "lentiviral long terminal repeats", "target": "hiv1Ltr3", "targetLength": 235, "best": "hiv1Ltr3", "withinThresholds": [ { "feature": "hiv1Ltr3", "call": "match", "score": 470.0, "identityExact": "235/235", "coverageExact": "235/235" } ], "alsoWithinThresholds": [], "shownInside": [] }, { "family": "ColE1-type and pUC origins", "target": "pucOri", "targetLength": 668, "best": "pucOri", "withinThresholds": [ { "feature": "pucOri", "call": "match", "score": 1336.0, "identityExact": "668/668", "coverageExact": "668/668" }, { "feature": "rnaI", "call": "match", "score": 209.0, "identityExact": "106/107", "coverageExact": "107/107" } ], "alsoWithinThresholds": [], "shownInside": [ { "feature": "rnaI", "container": "pucOri", "marking": "different-element" } ] }, { "family": "ColE1-type and pUC origins", "target": "rnaI", "targetLength": 107, "best": "rnaI", "withinThresholds": [ { "feature": "rnaI", "call": "match", "score": 214.0, "identityExact": "107/107", "coverageExact": "107/107" } ], "alsoWithinThresholds": [], "shownInside": [] }, { "family": "SV40 elements", "target": "sv40Promoter", "targetLength": 417, "best": "sv40Promoter", "withinThresholds": [ { "feature": "sv40Promoter", "call": "match", "score": 834.0, "identityExact": "417/417", "coverageExact": "417/417" }, { "feature": "sv40Ori", "call": "match", "score": 132.0, "identityExact": "66/66", "coverageExact": "66/66" } ], "alsoWithinThresholds": [], "shownInside": [ { "feature": "sv40Ori", "container": "sv40Promoter", "marking": "different-element" } ] }, { "family": "SV40 elements", "target": "sv40Ori", "targetLength": 66, "best": "sv40Ori", "withinThresholds": [ { "feature": "sv40Ori", "call": "match", "score": 132.0, "identityExact": "66/66", "coverageExact": "66/66" } ], "alsoWithinThresholds": [], "shownInside": [] }, { "family": "SV40 elements", "target": "sv40LatePA", "targetLength": 222, "best": "sv40LatePA", "withinThresholds": [ { "feature": "sv40LatePA", "call": "match", "score": 444.0, "identityExact": "222/222", "coverageExact": "222/222" } ], "alsoWithinThresholds": [], "shownInside": [] }, { "family": "CMV elements", "target": "cmvEnhancer", "targetLength": 659, "best": "cmvEnhancer", "withinThresholds": [ { "feature": "cmvEnhancer", "call": "match", "score": 1318.0, "identityExact": "659/659", "coverageExact": "659/659" } ], "alsoWithinThresholds": [], "shownInside": [] }, { "family": "CMV elements", "target": "cmvPromoter", "targetLength": 82, "best": "cmvPromoter", "withinThresholds": [ { "feature": "cmvPromoter", "call": "match", "score": 164.0, "identityExact": "82/82", "coverageExact": "82/82" } ], "alsoWithinThresholds": [], "shownInside": [] }, { "family": "poly(A) signals", "target": "bghPA", "targetLength": 223, "best": "bghPA", "withinThresholds": [ { "feature": "bghPA", "call": "match", "score": 446.0, "identityExact": "223/223", "coverageExact": "223/223" } ], "alsoWithinThresholds": [], "shownInside": [] }, { "family": "poly(A) signals", "target": "syntheticPA", "targetLength": 49, "best": "syntheticPA", "withinThresholds": [ { "feature": "syntheticPA", "call": "match", "score": 98.0, "identityExact": "49/49", "coverageExact": "49/49" } ], "alsoWithinThresholds": [], "shownInside": [] }, { "family": "poly(A) signals", "target": "sv40LatePA", "targetLength": 222, "best": "sv40LatePA", "withinThresholds": [ { "feature": "sv40LatePA", "call": "match", "score": 444.0, "identityExact": "222/222", "coverageExact": "222/222" } ], "alsoWithinThresholds": [], "shownInside": [] }, { "family": "recombination sites", "target": "loxP", "targetLength": 34, "best": "loxP", "withinThresholds": [ { "feature": "loxP", "call": "match", "score": 68.0, "identityExact": "34/34", "coverageExact": "34/34" } ], "alsoWithinThresholds": [], "shownInside": [] }, { "family": "recombination sites", "target": "frt", "targetLength": 48, "best": "frt", "withinThresholds": [ { "feature": "frt", "call": "match", "score": 96.0, "identityExact": "48/48", "coverageExact": "48/48" } ], "alsoWithinThresholds": [], "shownInside": [] }, { "family": "polylinkers", "target": "pucMcs", "targetLength": 57, "best": "pucMcs", "withinThresholds": [ { "feature": "pucMcs", "call": "match", "score": 114.0, "identityExact": "57/57", "coverageExact": "57/57" } ], "alsoWithinThresholds": [], "shownInside": [] }, { "family": "polylinkers", "target": "pgexMcs", "targetLength": 37, "best": "pgexMcs", "withinThresholds": [ { "feature": "pgexMcs", "call": "match", "score": 74.0, "identityExact": "37/37", "coverageExact": "37/37" } ], "alsoWithinThresholds": [], "shownInside": [] }, { "family": "polylinkers", "target": "pmblMcs", "targetLength": 128, "best": "pmblMcs", "withinThresholds": [ { "feature": "pmblMcs", "call": "match", "score": 256.0, "identityExact": "128/128", "coverageExact": "128/128" } ], "alsoWithinThresholds": [], "shownInside": [] } ], "pairs": [ { "a": "capSite", "b": "lacPromoter", "bucket": "containment", "identity": "1/1", "covShort": "1/1", "covLong": "0/1", "lengthRatio": "19/61", "shorter": "capSite", "longer": "lacPromoter", "marking": "different-element", "justification": "J01636.1's depositors annotate a CAP-binding site in their own words; the container is a promoter region named by other depositors. Different kinds of element, so different-element, under 2026-10-17-cso-asisi-lac-pairs-and-fixture-guard.md ruling 2. It is a sibling of lacO inside the promoter, never nested in it: the two are disjoint in J01636.1.", "markingSource": "library-pairs.csv", "display": { "decidedBy": "the marking and the two calls' spans on the person's sequence, per locus", "rule": "pipeline/plasmid-map/fixtures/specificity-display.json and docs/technical/app-plasmid.md", "bucketDecidesNothing": true }, "reported": { "capSite": { "call": "match", "identityExact": "38/38", "coverageExact": "38/38", "score": 76.0, "alignedFeatureBases": 38, "offsets": [ { "strand": "+", "start": 1, "end": 38, "call": "match" } ] } } }, { "a": "lacO", "b": "lacPromoter", "bucket": "containment", "identity": "1/1", "covShort": "1/1", "covLong": "0/1", "lengthRatio": "21/122", "shorter": "lacO", "longer": "lacPromoter", "marking": "different-element", "justification": "The submitters annotated different kinds of element: J01636.1's depositors a repressor-binding site in their own words, DQ059139.1's a promoter region. Named different-element by the CSO's memo 2026-10-17-cso-asisi-lac-pairs-and-fixture-guard.md, ruling 2, which supersedes the library-review memo's partial-overlap expectation; confirmed in 2026-10-17-cso-buckets-against-markings.md, ruling 1.", "markingSource": "library-pairs.csv", "display": { "decidedBy": "the marking and the two calls' spans on the person's sequence, per locus", "rule": "pipeline/plasmid-map/fixtures/specificity-display.json and docs/technical/app-plasmid.md", "bucketDecidesNothing": true }, "reported": { "lacO": { "call": "match", "identityExact": "21/21", "coverageExact": "21/21", "score": 42.0, "offsets": [ { "strand": "+", "start": 85, "call": "match" } ] } } }, { "a": "mCherry", "b": "tdTomato", "bucket": "containment", "offsetsReached": { "mCherry": 2 }, "identity": "214/235", "covShort": "697/711", "covLong": "0/1", "lengthRatio": "79/159", "shorter": "mCherry", "longer": "tdTomato", "marking": "unsettled", "justification": "SUPERSEDED on 17 October 2026 from same-element, by the CSO's memo 2026-10-17-cso-the-five-causes-and-the-absence-narrowing.md section 3: the warrant for same-element was AY678269.1 describing the dimer as a tandem of the dTomato monomer, which is a warrant for the dTomato pair and not for this one, because mCherry is no part of the dimer. Neither record contains a sentence making one a copy of the other's element: AY678264.1 calls mCherry an engineered variant of mRFP1 with EGFP termini, and AY678269.1 calls tdTomato an engineered variant of dimer2 with the same termini, which is derivation from a common ancestor and is explicitly not that sentence. mCherry reaches partial inside the dimer at two offsets (642/705 identical, 697/711 of its length aligned). Not settled by the records; checked 17 October 2026.", "markingSource": "library-pairs.csv", "display": { "decidedBy": "the marking and the two calls' spans on the person's sequence, per locus", "rule": "pipeline/plasmid-map/fixtures/specificity-display.json and docs/technical/app-plasmid.md", "bucketDecidesNothing": true }, "reported": { "mCherry": { "call": "partial", "identityExact": "642/705", "coverageExact": "697/711", "score": 1099.0, "alignedFeatureBases": 697, "offsets": [ { "strand": "+", "start": 729, "end": 1431, "call": "partial" }, { "strand": "+", "start": 1, "end": 670, "call": "partial" } ] } } }, { "a": "rnaI", "b": "pucOri", "bucket": "containment", "identity": "106/107", "covShort": "1/1", "covLong": "0/1", "lengthRatio": "107/668", "shorter": "rnaI", "longer": "pucOri", "marking": "different-element", "justification": "The submitters annotated two different kinds of element: J01566.1's depositors a misc_RNA, the antisense regulator of ColE1-type copy number, and DQ059139.1's a replication origin. A call on RNA I marks its locus and does not assert that its 107 bases are the origin's bounds. The CSO's cross-check memo of 17 October 2026, ruling 6.", "markingSource": "library-pairs.csv", "display": { "decidedBy": "the marking and the two calls' spans on the person's sequence, per locus", "rule": "pipeline/plasmid-map/fixtures/specificity-display.json and docs/technical/app-plasmid.md", "bucketDecidesNothing": true }, "reported": { "rnaI": { "call": "match", "identityExact": "106/107", "coverageExact": "107/107", "score": 209.0, "alignedFeatureBases": 107, "offsets": [ { "strand": "+", "start": 499, "end": 605, "call": "match" } ] } } }, { "a": "sv40Promoter", "b": "sv40Ori", "bucket": "containment", "identity": "1/1", "covShort": "1/1", "covLong": "0/1", "lengthRatio": "22/139", "shorter": "sv40Ori", "longer": "sv40Promoter", "marking": "different-element", "justification": "Two elements the makers of U47120.2 annotated as separate features in one record: the minimum origin of replication inside the enhancer and early promoter. Suppressing either would lose a fact the depositors asserted.", "markingSource": "library-pairs.csv", "display": { "decidedBy": "the marking and the two calls' spans on the person's sequence, per locus", "rule": "pipeline/plasmid-map/fixtures/specificity-display.json and docs/technical/app-plasmid.md", "bucketDecidesNothing": true }, "reported": { "sv40Ori": { "call": "match", "identityExact": "66/66", "coverageExact": "66/66", "score": 132.0, "alignedFeatureBases": 66, "offsets": [ { "strand": "+", "start": 315, "end": 380, "call": "match" } ] } } }, { "a": "syntheticPA", "b": "pauseSite", "bucket": "containment", "identity": "1/1", "covShort": "1/1", "covLong": "0/1", "lengthRatio": "7/22", "shorter": "syntheticPA", "longer": "pauseSite", "marking": "unsettled", "justification": "The 49 bases are found whole inside the 154. AY738222.1 annotates ONE feature wearing both names: /regulatory_class=\"polyA_signal_sequence\" with the note \"synthetic; transcriptional pause site\". Neither record annotates the two as separate elements, so it is not different-element; and two records at two extents with no statement that they are one cassette is not enough to assert same-element. Both directional checks were made on 17 October 2026 and both are negative: U47120.2 annotates no pause site anywhere, and AY738222.1 annotates no separate poly(A) signal inside 4089..4242 (its only other poly(A) annotation, \"SV40 late poly(A) region\" at 1787..2008, is another element at another locus). The bases are identical over the 49, which the cross-check measures, but no submitter description names one cassette. The document that would settle this in a line is the vendor's own vector documentation, which is source kind 5 and held for the General Counsel, so nobody has looked at it rather than nobody having thought of it. Not settled by the records; checked 17 October 2026. The CSO, 2026-10-17-cso-buckets-against-markings.md, ruling 4.", "markingSource": "library-pairs.csv", "display": { "decidedBy": "the marking and the two calls' spans on the person's sequence, per locus", "rule": "pipeline/plasmid-map/fixtures/specificity-display.json and docs/technical/app-plasmid.md", "bucketDecidesNothing": true }, "reported": { "syntheticPA": { "call": "match", "identityExact": "49/49", "coverageExact": "49/49", "score": 98.0, "alignedFeatureBases": 49, "offsets": [ { "strand": "+", "start": 1, "end": 49, "call": "match" } ] } } }, { "a": "tdTomato", "b": "dTomato", "bucket": "containment", "offsetsReached": { "dTomato": 2 }, "identity": "1/1", "covShort": "228/235", "covLong": "0/1", "lengthRatio": "235/477", "shorter": "dTomato", "longer": "tdTomato", "marking": "same-element", "justification": "AY678269.1 describes tdTomato as a tandem dimer of the dTomato monomer, so the dimer literally consists of two copies of this entry's element; that is the sentence the marking needs, and it is the only pair in this library that has it (the CSO, 2026-10-17-cso-the-five-causes-and-the-absence-narrowing.md section 3). dTomato reaches match inside the dimer at two offsets, 1..686 and 748..1431, 684/684 identical over 684 of its 705 bases. One call is shown at the locus; the offsets are published in the cross-check output rather than drawn. Checked 17 October 2026.", "markingSource": "library-pairs.csv", "display": { "decidedBy": "the marking and the two calls' spans on the person's sequence, per locus", "rule": "pipeline/plasmid-map/fixtures/specificity-display.json and docs/technical/app-plasmid.md", "bucketDecidesNothing": true }, "reported": { "dTomato": { "call": "match", "identityExact": "684/684", "coverageExact": "684/705", "score": 1368.0, "alignedFeatureBases": 684, "offsets": [ { "strand": "+", "start": 748, "end": 1431, "call": "match" }, { "strand": "+", "start": 1, "end": 686, "call": "match" } ] } } }, { "a": "tdTomato", "b": "mHoneydew", "bucket": "containment", "offsetsReached": { "mHoneydew": 2 }, "identity": "101/110", "covShort": "329/339", "covLong": "0/1", "lengthRatio": "226/477", "shorter": "mHoneydew", "longer": "tdTomato", "marking": "unsettled", "justification": "A distinct engineered protein of the DsRed lineage, differing from the dimer's own element by point substitutions, which reaches partial inside it at 15..670 and 744..1396 (606/660 identical over 658/678 of its length) because of shared ancestry at high identity. No sentence in either record makes it a copy of the dimer's element, so same-element would write a falsehood into a published table, and the display not changing is no licence to record something untrue (the CSO, 2026-10-17-cso-the-five-causes-and-the-absence-narrowing.md section 3). Not settled by the records; checked 17 October 2026.", "markingSource": "library-pairs.csv", "display": { "decidedBy": "the marking and the two calls' spans on the person's sequence, per locus", "rule": "pipeline/plasmid-map/fixtures/specificity-display.json and docs/technical/app-plasmid.md", "bucketDecidesNothing": true }, "reported": { "mHoneydew": { "call": "partial", "identityExact": "606/660", "coverageExact": "658/678", "score": 1047.0, "alignedFeatureBases": 658, "offsets": [ { "strand": "+", "start": 15, "end": 670, "call": "partial" }, { "strand": "+", "start": 744, "end": 1396, "call": "partial" } ] } } }, { "a": "tdTomato", "b": "mRfp1", "bucket": "containment", "offsetsReached": { "mRfp1": 2 }, "identity": "203/220", "covShort": "329/339", "covLong": "0/1", "lengthRatio": "226/477", "shorter": "mRfp1", "longer": "tdTomato", "marking": "unsettled", "justification": "A distinct engineered protein of the DsRed lineage, differing from the dimer's own element by point substitutions, which reaches partial inside it at 15..670 and 744..1396 (609/660 identical over 658/678 of its length) because of shared ancestry at high identity. No sentence in either record makes it a copy of the dimer's element, so same-element would write a falsehood into a published table, and the display not changing is no licence to record something untrue (the CSO, 2026-10-17-cso-the-five-causes-and-the-absence-narrowing.md section 3). Not settled by the records; checked 17 October 2026.", "markingSource": "library-pairs.csv", "display": { "decidedBy": "the marking and the two calls' spans on the person's sequence, per locus", "rule": "pipeline/plasmid-map/fixtures/specificity-display.json and docs/technical/app-plasmid.md", "bucketDecidesNothing": true }, "reported": { "mRfp1": { "call": "partial", "identityExact": "609/660", "coverageExact": "658/678", "score": 1062.0, "alignedFeatureBases": 658, "offsets": [ { "strand": "+", "start": 15, "end": 670, "call": "partial" }, { "strand": "+", "start": 744, "end": 1396, "call": "partial" } ] } } }, { "a": "tdTomato", "b": "mStrawberry", "bucket": "containment", "identity": "91/101", "covShort": "697/711", "covLong": "0/1", "lengthRatio": "79/159", "shorter": "mStrawberry", "longer": "tdTomato", "marking": "unsettled", "justification": "A distinct engineered protein of the DsRed lineage, differing from the dimer's own element by point substitutions, which reaches partial inside it at 729..1431 (637/707 identical over 697/711 of its length) because of shared ancestry at high identity. No sentence in either record makes it a copy of the dimer's element, so same-element would write a falsehood into a published table, and the display not changing is no licence to record something untrue (the CSO, 2026-10-17-cso-the-five-causes-and-the-absence-narrowing.md section 3). Not settled by the records; checked 17 October 2026.", "markingSource": "library-pairs.csv", "display": { "decidedBy": "the marking and the two calls' spans on the person's sequence, per locus", "rule": "pipeline/plasmid-map/fixtures/specificity-display.json and docs/technical/app-plasmid.md", "bucketDecidesNothing": true }, "reported": { "mStrawberry": { "call": "partial", "identityExact": "637/707", "coverageExact": "697/711", "score": 1066.0, "alignedFeatureBases": 697, "offsets": [ { "strand": "+", "start": 729, "end": 1431, "call": "partial" } ] } } }, { "a": "tdTomato", "b": "mTangerine", "bucket": "containment", "offsetsReached": { "mTangerine": 2 }, "identity": "607/661", "covShort": "329/339", "covLong": "0/1", "lengthRatio": "226/477", "shorter": "mTangerine", "longer": "tdTomato", "marking": "unsettled", "justification": "A distinct engineered protein of the DsRed lineage, differing from the dimer's own element by point substitutions, which reaches partial inside it at 15..670 and 744..1396 (607/661 identical over 658/678 of its length) because of shared ancestry at high identity. No sentence in either record makes it a copy of the dimer's element, so same-element would write a falsehood into a published table, and the display not changing is no licence to record something untrue (the CSO, 2026-10-17-cso-the-five-causes-and-the-absence-narrowing.md section 3). Not settled by the records; checked 17 October 2026.", "markingSource": "library-pairs.csv", "display": { "decidedBy": "the marking and the two calls' spans on the person's sequence, per locus", "rule": "pipeline/plasmid-map/fixtures/specificity-display.json and docs/technical/app-plasmid.md", "bucketDecidesNothing": true }, "reported": { "mTangerine": { "call": "partial", "identityExact": "607/661", "coverageExact": "658/678", "score": 1045.0, "alignedFeatureBases": 658, "offsets": [ { "strand": "+", "start": 15, "end": 670, "call": "partial" }, { "strand": "+", "start": 744, "end": 1396, "call": "partial" } ] } } }, { "a": "trc", "b": "lacO", "bucket": "containment", "identity": "1/1", "covShort": "1/1", "covLong": "0/1", "lengthRatio": "7/82", "shorter": "lacO", "longer": "trc", "marking": "different-element", "justification": "Marked separately from the lacO/lacPromoter pair and for its own reason: M22744.1's makers annotate a promoter region they transferred into their vector, and J01636.1's depositors annotate a repressor-binding site. Different kinds of element, under 2026-10-17-cso-asisi-lac-pairs-and-fixture-guard.md ruling 2.", "markingSource": "library-pairs.csv", "display": { "decidedBy": "the marking and the two calls' spans on the person's sequence, per locus", "rule": "pipeline/plasmid-map/fixtures/specificity-display.json and docs/technical/app-plasmid.md", "bucketDecidesNothing": true }, "reported": { "lacO": { "call": "match", "identityExact": "21/21", "coverageExact": "21/21", "score": 42.0, "offsets": [ { "strand": "+", "start": 211, "call": "match" } ] } } }, { "a": "dTomato", "b": "mHoneydew", "bucket": "identity", "identity": "101/110", "covShort": "329/339", "covLong": "656/705", "lengthRatio": "226/235", "shorter": "mHoneydew", "longer": "dTomato", "marking": "identity", "justification": null, "markingSource": "generated: the identity route", "display": { "decidedBy": "the marking and the two calls' spans on the person's sequence, per locus", "rule": "pipeline/plasmid-map/fixtures/specificity-display.json and docs/technical/app-plasmid.md", "bucketDecidesNothing": true }, "reported": { "dTomato": { "call": "partial", "identityExact": "606/660", "coverageExact": "656/705", "score": 1047.0, "alignedFeatureBases": 656, "offsets": [ { "strand": "+", "start": 12, "end": 669, "call": "partial" } ] }, "mHoneydew": { "call": "partial", "identityExact": "606/660", "coverageExact": "658/678", "score": 1047.0, "alignedFeatureBases": 658, "offsets": [ { "strand": "+", "start": 15, "end": 670, "call": "partial" } ] } } }, { "a": "dTomato", "b": "mRfp1", "bucket": "identity", "identity": "203/220", "covShort": "329/339", "covLong": "656/705", "lengthRatio": "226/235", "shorter": "mRfp1", "longer": "dTomato", "marking": "identity", "justification": null, "markingSource": "generated: the identity route", "display": { "decidedBy": "the marking and the two calls' spans on the person's sequence, per locus", "rule": "pipeline/plasmid-map/fixtures/specificity-display.json and docs/technical/app-plasmid.md", "bucketDecidesNothing": true }, "reported": { "dTomato": { "call": "partial", "identityExact": "609/660", "coverageExact": "656/705", "score": 1062.0, "alignedFeatureBases": 656, "offsets": [ { "strand": "+", "start": 12, "end": 669, "call": "partial" } ] }, "mRfp1": { "call": "partial", "identityExact": "609/660", "coverageExact": "658/678", "score": 1062.0, "alignedFeatureBases": 658, "offsets": [ { "strand": "+", "start": 15, "end": 670, "call": "partial" } ] } } }, { "a": "dTomato", "b": "mTangerine", "bucket": "identity", "identity": "607/661", "covShort": "329/339", "covLong": "656/705", "lengthRatio": "226/235", "shorter": "mTangerine", "longer": "dTomato", "marking": "identity", "justification": null, "markingSource": "generated: the identity route", "display": { "decidedBy": "the marking and the two calls' spans on the person's sequence, per locus", "rule": "pipeline/plasmid-map/fixtures/specificity-display.json and docs/technical/app-plasmid.md", "bucketDecidesNothing": true }, "reported": { "dTomato": { "call": "partial", "identityExact": "607/661", "coverageExact": "656/705", "score": 1045.0, "alignedFeatureBases": 656, "offsets": [ { "strand": "+", "start": 12, "end": 669, "call": "partial" } ] }, "mTangerine": { "call": "partial", "identityExact": "607/661", "coverageExact": "658/678", "score": 1045.0, "alignedFeatureBases": 658, "offsets": [ { "strand": "+", "start": 15, "end": 670, "call": "partial" } ] } } }, { "a": "ebfp2", "b": "mKalama1", "bucket": "identity", "identity": "225/241", "covShort": "1/1", "covLong": "1/1", "lengthRatio": "1/1", "shorter": "ebfp2", "longer": "mKalama1", "marking": "identity", "justification": null, "markingSource": "generated: the identity route", "display": { "decidedBy": "the marking and the two calls' spans on the person's sequence, per locus", "rule": "pipeline/plasmid-map/fixtures/specificity-display.json and docs/technical/app-plasmid.md", "bucketDecidesNothing": true }, "reported": { "ebfp2": { "call": "partial", "identityExact": "675/723", "coverageExact": "720/720", "score": 1206.0, "alignedFeatureBases": 720, "offsets": [ { "strand": "+", "start": 1, "end": 720, "call": "partial" } ] }, "mKalama1": { "call": "partial", "identityExact": "675/723", "coverageExact": "720/720", "score": 1206.0, "alignedFeatureBases": 720, "offsets": [ { "strand": "+", "start": 1, "end": 720, "call": "partial" } ] } } }, { "a": "egfp", "b": "ebfp2", "bucket": "identity", "identity": "233/240", "covShort": "1/1", "covLong": "1/1", "lengthRatio": "1/1", "shorter": "egfp", "longer": "ebfp2", "marking": "identity", "justification": null, "markingSource": "generated: the identity route", "display": { "decidedBy": "the marking and the two calls' spans on the person's sequence, per locus", "rule": "pipeline/plasmid-map/fixtures/specificity-display.json and docs/technical/app-plasmid.md", "bucketDecidesNothing": true }, "reported": { "egfp": { "call": "partial", "identityExact": "699/720", "coverageExact": "720/720", "score": 1335.0, "alignedFeatureBases": 720, "offsets": [ { "strand": "+", "start": 1, "end": 720, "call": "partial" } ] }, "ebfp2": { "call": "partial", "identityExact": "699/720", "coverageExact": "720/720", "score": 1335.0, "alignedFeatureBases": 720, "offsets": [ { "strand": "+", "start": 1, "end": 720, "call": "partial" } ] } } }, { "a": "egfp", "b": "mKalama1", "bucket": "identity", "identity": "673/720", "covShort": "1/1", "covLong": "1/1", "lengthRatio": "1/1", "shorter": "egfp", "longer": "mKalama1", "marking": "identity", "justification": null, "markingSource": "generated: the identity route", "display": { "decidedBy": "the marking and the two calls' spans on the person's sequence, per locus", "rule": "pipeline/plasmid-map/fixtures/specificity-display.json and docs/technical/app-plasmid.md", "bucketDecidesNothing": true }, "reported": { "egfp": { "call": "partial", "identityExact": "673/720", "coverageExact": "720/720", "score": 1205.0, "alignedFeatureBases": 720, "offsets": [ { "strand": "+", "start": 1, "end": 720, "call": "partial" } ] }, "mKalama1": { "call": "partial", "identityExact": "673/720", "coverageExact": "720/720", "score": 1205.0, "alignedFeatureBases": 720, "offsets": [ { "strand": "+", "start": 1, "end": 720, "call": "partial" } ] } } }, { "a": "mApple", "b": "mBlueberry2", "bucket": "identity", "identity": "341/356", "covShort": "1/1", "covLong": "1/1", "lengthRatio": "1/1", "shorter": "mApple", "longer": "mBlueberry2", "marking": "identity", "justification": null, "markingSource": "generated: the identity route", "display": { "decidedBy": "the marking and the two calls' spans on the person's sequence, per locus", "rule": "pipeline/plasmid-map/fixtures/specificity-display.json and docs/technical/app-plasmid.md", "bucketDecidesNothing": true }, "reported": { "mApple": { "call": "partial", "identityExact": "682/712", "coverageExact": "711/711", "score": 1270.0, "alignedFeatureBases": 711, "offsets": [ { "strand": "+", "start": 1, "end": 711, "call": "partial" } ] }, "mBlueberry2": { "call": "partial", "identityExact": "682/712", "coverageExact": "711/711", "score": 1270.0, "alignedFeatureBases": 711, "offsets": [ { "strand": "+", "start": 1, "end": 711, "call": "partial" } ] } } }, { "a": "mApple", "b": "mOrange2", "bucket": "identity", "identity": "680/711", "covShort": "1/1", "covLong": "1/1", "lengthRatio": "1/1", "shorter": "mApple", "longer": "mOrange2", "marking": "identity", "justification": null, "markingSource": "generated: the identity route", "display": { "decidedBy": "the marking and the two calls' spans on the person's sequence, per locus", "rule": "pipeline/plasmid-map/fixtures/specificity-display.json and docs/technical/app-plasmid.md", "bucketDecidesNothing": true }, "reported": { "mApple": { "call": "partial", "identityExact": "680/711", "coverageExact": "711/711", "score": 1267.0, "alignedFeatureBases": 711, "offsets": [ { "strand": "+", "start": 1, "end": 711, "call": "partial" } ] }, "mOrange2": { "call": "partial", "identityExact": "680/711", "coverageExact": "711/711", "score": 1267.0, "alignedFeatureBases": 711, "offsets": [ { "strand": "+", "start": 1, "end": 711, "call": "partial" } ] } } }, { "a": "mApple", "b": "mRfp1", "bucket": "identity", "identity": "307/327", "covShort": "109/113", "covLong": "218/237", "lengthRatio": "226/237", "shorter": "mRfp1", "longer": "mApple", "marking": "identity", "justification": null, "markingSource": "generated: the identity route", "display": { "decidedBy": "the marking and the two calls' spans on the person's sequence, per locus", "rule": "pipeline/plasmid-map/fixtures/specificity-display.json and docs/technical/app-plasmid.md", "bucketDecidesNothing": true }, "reported": { "mApple": { "call": "partial", "identityExact": "614/654", "coverageExact": "654/711", "score": 1108.0, "alignedFeatureBases": 654, "offsets": [ { "strand": "+", "start": 20, "end": 673, "call": "partial" } ] }, "mRfp1": { "call": "partial", "identityExact": "614/654", "coverageExact": "654/678", "score": 1108.0, "alignedFeatureBases": 654, "offsets": [ { "strand": "+", "start": 35, "end": 688, "call": "partial" } ] } } }, { "a": "mBanana", "b": "mApple", "bucket": "identity", "identity": "657/712", "covShort": "1/1", "covLong": "1/1", "lengthRatio": "1/1", "shorter": "mBanana", "longer": "mApple", "marking": "identity", "justification": null, "markingSource": "generated: the identity route", "display": { "decidedBy": "the marking and the two calls' spans on the person's sequence, per locus", "rule": "pipeline/plasmid-map/fixtures/specificity-display.json and docs/technical/app-plasmid.md", "bucketDecidesNothing": true }, "reported": { "mBanana": { "call": "partial", "identityExact": "657/712", "coverageExact": "711/711", "score": 1145.0, "alignedFeatureBases": 711, "offsets": [ { "strand": "+", "start": 1, "end": 711, "call": "partial" } ] }, "mApple": { "call": "partial", "identityExact": "657/712", "coverageExact": "711/711", "score": 1145.0, "alignedFeatureBases": 711, "offsets": [ { "strand": "+", "start": 1, "end": 711, "call": "partial" } ] } } }, { "a": "mBanana", "b": "mBlueberry2", "bucket": "identity", "identity": "660/713", "covShort": "1/1", "covLong": "1/1", "lengthRatio": "1/1", "shorter": "mBanana", "longer": "mBlueberry2", "marking": "identity", "justification": null, "markingSource": "generated: the identity route", "display": { "decidedBy": "the marking and the two calls' spans on the person's sequence, per locus", "rule": "pipeline/plasmid-map/fixtures/specificity-display.json and docs/technical/app-plasmid.md", "bucketDecidesNothing": true }, "reported": { "mBanana": { "call": "partial", "identityExact": "660/713", "coverageExact": "711/711", "score": 1153.0, "alignedFeatureBases": 711, "offsets": [ { "strand": "+", "start": 1, "end": 711, "call": "partial" } ] }, "mBlueberry2": { "call": "partial", "identityExact": "660/713", "coverageExact": "711/711", "score": 1153.0, "alignedFeatureBases": 711, "offsets": [ { "strand": "+", "start": 1, "end": 711, "call": "partial" } ] } } }, { "a": "mBanana", "b": "mHoneydew", "bucket": "identity", "identity": "627/661", "covShort": "659/678", "covLong": "659/711", "lengthRatio": "226/237", "shorter": "mHoneydew", "longer": "mBanana", "marking": "identity", "justification": null, "markingSource": "generated: the identity route", "display": { "decidedBy": "the marking and the two calls' spans on the person's sequence, per locus", "rule": "pipeline/plasmid-map/fixtures/specificity-display.json and docs/technical/app-plasmid.md", "bucketDecidesNothing": true }, "reported": { "mBanana": { "call": "partial", "identityExact": "627/661", "coverageExact": "659/711", "score": 1144.0, "alignedFeatureBases": 659, "offsets": [ { "strand": "+", "start": 15, "end": 673, "call": "partial" } ] }, "mHoneydew": { "call": "partial", "identityExact": "627/661", "coverageExact": "659/678", "score": 1144.0, "alignedFeatureBases": 659, "offsets": [ { "strand": "+", "start": 30, "end": 688, "call": "partial" } ] } } }, { "a": "mBanana", "b": "mOrange2", "bucket": "identity", "identity": "677/711", "covShort": "1/1", "covLong": "1/1", "lengthRatio": "1/1", "shorter": "mBanana", "longer": "mOrange2", "marking": "identity", "justification": null, "markingSource": "generated: the identity route", "display": { "decidedBy": "the marking and the two calls' spans on the person's sequence, per locus", "rule": "pipeline/plasmid-map/fixtures/specificity-display.json and docs/technical/app-plasmid.md", "bucketDecidesNothing": true }, "reported": { "mBanana": { "call": "partial", "identityExact": "677/711", "coverageExact": "711/711", "score": 1252.0, "alignedFeatureBases": 711, "offsets": [ { "strand": "+", "start": 1, "end": 711, "call": "partial" } ] }, "mOrange2": { "call": "partial", "identityExact": "677/711", "coverageExact": "711/711", "score": 1252.0, "alignedFeatureBases": 711, "offsets": [ { "strand": "+", "start": 1, "end": 711, "call": "partial" } ] } } }, { "a": "mBanana", "b": "mRfp1", "bucket": "identity", "identity": "629/660", "covShort": "659/678", "covLong": "659/711", "lengthRatio": "226/237", "shorter": "mRfp1", "longer": "mBanana", "marking": "identity", "justification": null, "markingSource": "generated: the identity route", "display": { "decidedBy": "the marking and the two calls' spans on the person's sequence, per locus", "rule": "pipeline/plasmid-map/fixtures/specificity-display.json and docs/technical/app-plasmid.md", "bucketDecidesNothing": true }, "reported": { "mBanana": { "call": "partial", "identityExact": "629/660", "coverageExact": "659/711", "score": 1161.0, "alignedFeatureBases": 659, "offsets": [ { "strand": "+", "start": 15, "end": 673, "call": "partial" } ] }, "mRfp1": { "call": "partial", "identityExact": "629/660", "coverageExact": "659/678", "score": 1161.0, "alignedFeatureBases": 659, "offsets": [ { "strand": "+", "start": 30, "end": 688, "call": "partial" } ] } } }, { "a": "mBanana", "b": "mTangerine", "bucket": "identity", "identity": "317/330", "covShort": "659/678", "covLong": "659/711", "lengthRatio": "226/237", "shorter": "mTangerine", "longer": "mBanana", "marking": "identity", "justification": null, "markingSource": "generated: the identity route", "display": { "decidedBy": "the marking and the two calls' spans on the person's sequence, per locus", "rule": "pipeline/plasmid-map/fixtures/specificity-display.json and docs/technical/app-plasmid.md", "bucketDecidesNothing": true }, "reported": { "mBanana": { "call": "partial", "identityExact": "634/660", "coverageExact": "659/711", "score": 1186.0, "alignedFeatureBases": 659, "offsets": [ { "strand": "+", "start": 15, "end": 673, "call": "partial" } ] }, "mTangerine": { "call": "partial", "identityExact": "634/660", "coverageExact": "659/678", "score": 1186.0, "alignedFeatureBases": 659, "offsets": [ { "strand": "+", "start": 30, "end": 688, "call": "partial" } ] } } }, { "a": "mBlueberry2", "b": "mRfp1", "bucket": "identity", "identity": "621/655", "covShort": "109/113", "covLong": "218/237", "lengthRatio": "226/237", "shorter": "mRfp1", "longer": "mBlueberry2", "marking": "identity", "justification": null, "markingSource": "generated: the identity route", "display": { "decidedBy": "the marking and the two calls' spans on the person's sequence, per locus", "rule": "pipeline/plasmid-map/fixtures/specificity-display.json and docs/technical/app-plasmid.md", "bucketDecidesNothing": true }, "reported": { "mBlueberry2": { "call": "partial", "identityExact": "621/655", "coverageExact": "654/711", "score": 1136.0, "alignedFeatureBases": 654, "offsets": [ { "strand": "+", "start": 20, "end": 673, "call": "partial" } ] }, "mRfp1": { "call": "partial", "identityExact": "621/655", "coverageExact": "654/678", "score": 1136.0, "alignedFeatureBases": 654, "offsets": [ { "strand": "+", "start": 35, "end": 688, "call": "partial" } ] } } }, { "a": "mCherry", "b": "dTomato", "bucket": "identity", "identity": "648/719", "covShort": "1/1", "covLong": "1/1", "lengthRatio": "235/237", "shorter": "dTomato", "longer": "mCherry", "marking": "identity", "justification": null, "markingSource": "generated: the identity route", "display": { "decidedBy": "the marking and the two calls' spans on the person's sequence, per locus", "rule": "pipeline/plasmid-map/fixtures/specificity-display.json and docs/technical/app-plasmid.md", "bucketDecidesNothing": true }, "reported": { "mCherry": { "call": "partial", "identityExact": "648/719", "coverageExact": "711/711", "score": 1096.0, "alignedFeatureBases": 711, "offsets": [ { "strand": "+", "start": 1, "end": 705, "call": "partial" } ] }, "dTomato": { "call": "partial", "identityExact": "648/719", "coverageExact": "705/705", "score": 1096.0, "alignedFeatureBases": 705, "offsets": [ { "strand": "+", "start": 1, "end": 711, "call": "partial" } ] } } }, { "a": "mCherry", "b": "mApple", "bucket": "identity", "identity": "226/237", "covShort": "1/1", "covLong": "1/1", "lengthRatio": "1/1", "shorter": "mCherry", "longer": "mApple", "marking": "identity", "justification": null, "markingSource": "generated: the identity route", "display": { "decidedBy": "the marking and the two calls' spans on the person's sequence, per locus", "rule": "pipeline/plasmid-map/fixtures/specificity-display.json and docs/technical/app-plasmid.md", "bucketDecidesNothing": true }, "reported": { "mCherry": { "call": "partial", "identityExact": "678/711", "coverageExact": "711/711", "score": 1257.0, "alignedFeatureBases": 711, "offsets": [ { "strand": "+", "start": 1, "end": 711, "call": "partial" } ] }, "mApple": { "call": "partial", "identityExact": "678/711", "coverageExact": "711/711", "score": 1257.0, "alignedFeatureBases": 711, "offsets": [ { "strand": "+", "start": 1, "end": 711, "call": "partial" } ] } } }, { "a": "mCherry", "b": "mBanana", "bucket": "identity", "identity": "677/712", "covShort": "1/1", "covLong": "1/1", "lengthRatio": "1/1", "shorter": "mCherry", "longer": "mBanana", "marking": "identity", "justification": null, "markingSource": "generated: the identity route", "display": { "decidedBy": "the marking and the two calls' spans on the person's sequence, per locus", "rule": "pipeline/plasmid-map/fixtures/specificity-display.json and docs/technical/app-plasmid.md", "bucketDecidesNothing": true }, "reported": { "mCherry": { "call": "partial", "identityExact": "677/712", "coverageExact": "711/711", "score": 1245.0, "alignedFeatureBases": 711, "offsets": [ { "strand": "+", "start": 1, "end": 711, "call": "partial" } ] }, "mBanana": { "call": "partial", "identityExact": "677/712", "coverageExact": "711/711", "score": 1245.0, "alignedFeatureBases": 711, "offsets": [ { "strand": "+", "start": 1, "end": 711, "call": "partial" } ] } } }, { "a": "mCherry", "b": "mBlueberry2", "bucket": "identity", "identity": "685/712", "covShort": "1/1", "covLong": "1/1", "lengthRatio": "1/1", "shorter": "mCherry", "longer": "mBlueberry2", "marking": "identity", "justification": null, "markingSource": "generated: the identity route", "display": { "decidedBy": "the marking and the two calls' spans on the person's sequence, per locus", "rule": "pipeline/plasmid-map/fixtures/specificity-display.json and docs/technical/app-plasmid.md", "bucketDecidesNothing": true }, "reported": { "mCherry": { "call": "partial", "identityExact": "685/712", "coverageExact": "711/711", "score": 1285.0, "alignedFeatureBases": 711, "offsets": [ { "strand": "+", "start": 1, "end": 711, "call": "partial" } ] }, "mBlueberry2": { "call": "partial", "identityExact": "685/712", "coverageExact": "711/711", "score": 1285.0, "alignedFeatureBases": 711, "offsets": [ { "strand": "+", "start": 1, "end": 711, "call": "partial" } ] } } }, { "a": "mCherry", "b": "mHoneydew", "bucket": "identity", "identity": "317/327", "covShort": "109/113", "covLong": "218/237", "lengthRatio": "226/237", "shorter": "mHoneydew", "longer": "mCherry", "marking": "identity", "justification": null, "markingSource": "generated: the identity route", "display": { "decidedBy": "the marking and the two calls' spans on the person's sequence, per locus", "rule": "pipeline/plasmid-map/fixtures/specificity-display.json and docs/technical/app-plasmid.md", "bucketDecidesNothing": true }, "reported": { "mCherry": { "call": "partial", "identityExact": "634/654", "coverageExact": "654/711", "score": 1208.0, "alignedFeatureBases": 654, "offsets": [ { "strand": "+", "start": 20, "end": 673, "call": "partial" } ] }, "mHoneydew": { "call": "partial", "identityExact": "634/654", "coverageExact": "654/678", "score": 1208.0, "alignedFeatureBases": 654, "offsets": [ { "strand": "+", "start": 35, "end": 688, "call": "partial" } ] } } }, { "a": "mCherry", "b": "mOrange", "bucket": "identity", "identity": "77/79", "covShort": "1/1", "covLong": "1/1", "lengthRatio": "1/1", "shorter": "mCherry", "longer": "mOrange", "marking": "identity", "justification": null, "markingSource": "generated: the identity route", "display": { "decidedBy": "the marking and the two calls' spans on the person's sequence, per locus", "rule": "pipeline/plasmid-map/fixtures/specificity-display.json and docs/technical/app-plasmid.md", "bucketDecidesNothing": true }, "reported": { "mCherry": { "call": "partial", "identityExact": "693/711", "coverageExact": "711/711", "score": 1332.0, "alignedFeatureBases": 711, "offsets": [ { "strand": "+", "start": 1, "end": 711, "call": "partial" } ] }, "mOrange": { "call": "partial", "identityExact": "693/711", "coverageExact": "711/711", "score": 1332.0, "alignedFeatureBases": 711, "offsets": [ { "strand": "+", "start": 1, "end": 711, "call": "partial" } ] } } }, { "a": "mCherry", "b": "mOrange2", "bucket": "identity", "identity": "691/711", "covShort": "1/1", "covLong": "1/1", "lengthRatio": "1/1", "shorter": "mCherry", "longer": "mOrange2", "marking": "identity", "justification": null, "markingSource": "generated: the identity route", "display": { "decidedBy": "the marking and the two calls' spans on the person's sequence, per locus", "rule": "pipeline/plasmid-map/fixtures/specificity-display.json and docs/technical/app-plasmid.md", "bucketDecidesNothing": true }, "reported": { "mCherry": { "call": "partial", "identityExact": "691/711", "coverageExact": "711/711", "score": 1322.0, "alignedFeatureBases": 711, "offsets": [ { "strand": "+", "start": 1, "end": 711, "call": "partial" } ] }, "mOrange2": { "call": "partial", "identityExact": "691/711", "coverageExact": "711/711", "score": 1322.0, "alignedFeatureBases": 711, "offsets": [ { "strand": "+", "start": 1, "end": 711, "call": "partial" } ] } } }, { "a": "mCherry", "b": "mRfp1", "bucket": "identity", "identity": "213/218", "covShort": "109/113", "covLong": "218/237", "lengthRatio": "226/237", "shorter": "mRfp1", "longer": "mCherry", "marking": "identity", "justification": null, "markingSource": "generated: the identity route", "display": { "decidedBy": "the marking and the two calls' spans on the person's sequence, per locus", "rule": "pipeline/plasmid-map/fixtures/specificity-display.json and docs/technical/app-plasmid.md", "bucketDecidesNothing": true }, "reported": { "mCherry": { "call": "partial", "identityExact": "639/654", "coverageExact": "654/711", "score": 1233.0, "alignedFeatureBases": 654, "offsets": [ { "strand": "+", "start": 20, "end": 673, "call": "partial" } ] }, "mRfp1": { "call": "partial", "identityExact": "639/654", "coverageExact": "654/678", "score": 1233.0, "alignedFeatureBases": 654, "offsets": [ { "strand": "+", "start": 35, "end": 688, "call": "partial" } ] } } }, { "a": "mCherry", "b": "mStrawberry", "bucket": "identity", "identity": "232/237", "covShort": "1/1", "covLong": "1/1", "lengthRatio": "1/1", "shorter": "mCherry", "longer": "mStrawberry", "marking": "identity", "justification": null, "markingSource": "generated: the identity route", "display": { "decidedBy": "the marking and the two calls' spans on the person's sequence, per locus", "rule": "pipeline/plasmid-map/fixtures/specificity-display.json and docs/technical/app-plasmid.md", "bucketDecidesNothing": true }, "reported": { "mCherry": { "call": "partial", "identityExact": "696/711", "coverageExact": "711/711", "score": 1347.0, "alignedFeatureBases": 711, "offsets": [ { "strand": "+", "start": 1, "end": 711, "call": "partial" } ] }, "mStrawberry": { "call": "partial", "identityExact": "696/711", "coverageExact": "711/711", "score": 1347.0, "alignedFeatureBases": 711, "offsets": [ { "strand": "+", "start": 1, "end": 711, "call": "partial" } ] } } }, { "a": "mCherry", "b": "mTangerine", "bucket": "identity", "identity": "639/655", "covShort": "109/113", "covLong": "218/237", "lengthRatio": "226/237", "shorter": "mTangerine", "longer": "mCherry", "marking": "identity", "justification": null, "markingSource": "generated: the identity route", "display": { "decidedBy": "the marking and the two calls' spans on the person's sequence, per locus", "rule": "pipeline/plasmid-map/fixtures/specificity-display.json and docs/technical/app-plasmid.md", "bucketDecidesNothing": true }, "reported": { "mCherry": { "call": "partial", "identityExact": "639/655", "coverageExact": "654/711", "score": 1226.0, "alignedFeatureBases": 654, "offsets": [ { "strand": "+", "start": 20, "end": 673, "call": "partial" } ] }, "mTangerine": { "call": "partial", "identityExact": "639/655", "coverageExact": "654/678", "score": 1226.0, "alignedFeatureBases": 654, "offsets": [ { "strand": "+", "start": 35, "end": 688, "call": "partial" } ] } } }, { "a": "mHoneydew", "b": "mApple", "bucket": "identity", "identity": "203/218", "covShort": "109/113", "covLong": "218/237", "lengthRatio": "226/237", "shorter": "mHoneydew", "longer": "mApple", "marking": "identity", "justification": null, "markingSource": "generated: the identity route", "display": { "decidedBy": "the marking and the two calls' spans on the person's sequence, per locus", "rule": "pipeline/plasmid-map/fixtures/specificity-display.json and docs/technical/app-plasmid.md", "bucketDecidesNothing": true }, "reported": { "mHoneydew": { "call": "partial", "identityExact": "609/654", "coverageExact": "654/678", "score": 1083.0, "alignedFeatureBases": 654, "offsets": [ { "strand": "+", "start": 35, "end": 688, "call": "partial" } ] }, "mApple": { "call": "partial", "identityExact": "609/654", "coverageExact": "654/711", "score": 1083.0, "alignedFeatureBases": 654, "offsets": [ { "strand": "+", "start": 20, "end": 673, "call": "partial" } ] } } }, { "a": "mHoneydew", "b": "mBlueberry2", "bucket": "identity", "identity": "617/655", "covShort": "109/113", "covLong": "218/237", "lengthRatio": "226/237", "shorter": "mHoneydew", "longer": "mBlueberry2", "marking": "identity", "justification": null, "markingSource": "generated: the identity route", "display": { "decidedBy": "the marking and the two calls' spans on the person's sequence, per locus", "rule": "pipeline/plasmid-map/fixtures/specificity-display.json and docs/technical/app-plasmid.md", "bucketDecidesNothing": true }, "reported": { "mHoneydew": { "call": "partial", "identityExact": "617/655", "coverageExact": "654/678", "score": 1116.0, "alignedFeatureBases": 654, "offsets": [ { "strand": "+", "start": 35, "end": 688, "call": "partial" } ] }, "mBlueberry2": { "call": "partial", "identityExact": "617/655", "coverageExact": "654/711", "score": 1116.0, "alignedFeatureBases": 654, "offsets": [ { "strand": "+", "start": 20, "end": 673, "call": "partial" } ] } } }, { "a": "mHoneydew", "b": "mOrange2", "bucket": "identity", "identity": "625/654", "covShort": "109/113", "covLong": "218/237", "lengthRatio": "226/237", "shorter": "mHoneydew", "longer": "mOrange2", "marking": "identity", "justification": null, "markingSource": "generated: the identity route", "display": { "decidedBy": "the marking and the two calls' spans on the person's sequence, per locus", "rule": "pipeline/plasmid-map/fixtures/specificity-display.json and docs/technical/app-plasmid.md", "bucketDecidesNothing": true }, "reported": { "mHoneydew": { "call": "partial", "identityExact": "625/654", "coverageExact": "654/678", "score": 1163.0, "alignedFeatureBases": 654, "offsets": [ { "strand": "+", "start": 35, "end": 688, "call": "partial" } ] }, "mOrange2": { "call": "partial", "identityExact": "625/654", "coverageExact": "654/711", "score": 1163.0, "alignedFeatureBases": 654, "offsets": [ { "strand": "+", "start": 20, "end": 673, "call": "partial" } ] } } }, { "a": "mHoneydew", "b": "mRfp1", "bucket": "identity", "identity": "667/678", "covShort": "1/1", "covLong": "1/1", "lengthRatio": "1/1", "shorter": "mHoneydew", "longer": "mRfp1", "marking": "identity", "justification": null, "markingSource": "generated: the identity route", "display": { "decidedBy": "the marking and the two calls' spans on the person's sequence, per locus", "rule": "pipeline/plasmid-map/fixtures/specificity-display.json and docs/technical/app-plasmid.md", "bucketDecidesNothing": true }, "reported": { "mHoneydew": { "call": "partial", "identityExact": "667/678", "coverageExact": "678/678", "score": 1301.0, "alignedFeatureBases": 678, "offsets": [ { "strand": "+", "start": 1, "end": 678, "call": "partial" } ] }, "mRfp1": { "call": "partial", "identityExact": "667/678", "coverageExact": "678/678", "score": 1301.0, "alignedFeatureBases": 678, "offsets": [ { "strand": "+", "start": 1, "end": 678, "call": "partial" } ] } } }, { "a": "mOrange", "b": "mApple", "bucket": "identity", "identity": "682/711", "covShort": "1/1", "covLong": "1/1", "lengthRatio": "1/1", "shorter": "mOrange", "longer": "mApple", "marking": "identity", "justification": null, "markingSource": "generated: the identity route", "display": { "decidedBy": "the marking and the two calls' spans on the person's sequence, per locus", "rule": "pipeline/plasmid-map/fixtures/specificity-display.json and docs/technical/app-plasmid.md", "bucketDecidesNothing": true }, "reported": { "mOrange": { "call": "partial", "identityExact": "682/711", "coverageExact": "711/711", "score": 1277.0, "alignedFeatureBases": 711, "offsets": [ { "strand": "+", "start": 1, "end": 711, "call": "partial" } ] }, "mApple": { "call": "partial", "identityExact": "682/711", "coverageExact": "711/711", "score": 1277.0, "alignedFeatureBases": 711, "offsets": [ { "strand": "+", "start": 1, "end": 711, "call": "partial" } ] } } }, { "a": "mOrange", "b": "mBanana", "bucket": "identity", "identity": "227/237", "covShort": "1/1", "covLong": "1/1", "lengthRatio": "1/1", "shorter": "mOrange", "longer": "mBanana", "marking": "identity", "justification": null, "markingSource": "generated: the identity route", "display": { "decidedBy": "the marking and the two calls' spans on the person's sequence, per locus", "rule": "pipeline/plasmid-map/fixtures/specificity-display.json and docs/technical/app-plasmid.md", "bucketDecidesNothing": true }, "reported": { "mOrange": { "call": "partial", "identityExact": "681/711", "coverageExact": "711/711", "score": 1272.0, "alignedFeatureBases": 711, "offsets": [ { "strand": "+", "start": 1, "end": 711, "call": "partial" } ] }, "mBanana": { "call": "partial", "identityExact": "681/711", "coverageExact": "711/711", "score": 1272.0, "alignedFeatureBases": 711, "offsets": [ { "strand": "+", "start": 1, "end": 711, "call": "partial" } ] } } }, { "a": "mOrange", "b": "mBlueberry2", "bucket": "identity", "identity": "169/178", "covShort": "1/1", "covLong": "1/1", "lengthRatio": "1/1", "shorter": "mOrange", "longer": "mBlueberry2", "marking": "identity", "justification": null, "markingSource": "generated: the identity route", "display": { "decidedBy": "the marking and the two calls' spans on the person's sequence, per locus", "rule": "pipeline/plasmid-map/fixtures/specificity-display.json and docs/technical/app-plasmid.md", "bucketDecidesNothing": true }, "reported": { "mOrange": { "call": "partial", "identityExact": "676/712", "coverageExact": "711/711", "score": 1240.0, "alignedFeatureBases": 711, "offsets": [ { "strand": "+", "start": 1, "end": 711, "call": "partial" } ] }, "mBlueberry2": { "call": "partial", "identityExact": "676/712", "coverageExact": "711/711", "score": 1240.0, "alignedFeatureBases": 711, "offsets": [ { "strand": "+", "start": 1, "end": 711, "call": "partial" } ] } } }, { "a": "mOrange", "b": "mHoneydew", "bucket": "identity", "identity": "629/657", "covShort": "109/113", "covLong": "218/237", "lengthRatio": "226/237", "shorter": "mHoneydew", "longer": "mOrange", "marking": "identity", "justification": null, "markingSource": "generated: the identity route", "display": { "decidedBy": "the marking and the two calls' spans on the person's sequence, per locus", "rule": "pipeline/plasmid-map/fixtures/specificity-display.json and docs/technical/app-plasmid.md", "bucketDecidesNothing": true }, "reported": { "mOrange": { "call": "partial", "identityExact": "629/657", "coverageExact": "654/711", "score": 1174.0, "alignedFeatureBases": 654, "offsets": [ { "strand": "+", "start": 20, "end": 673, "call": "partial" } ] }, "mHoneydew": { "call": "partial", "identityExact": "629/657", "coverageExact": "654/678", "score": 1174.0, "alignedFeatureBases": 654, "offsets": [ { "strand": "+", "start": 35, "end": 688, "call": "partial" } ] } } }, { "a": "mOrange", "b": "mOrange2", "bucket": "identity", "identity": "707/711", "covShort": "1/1", "covLong": "1/1", "lengthRatio": "1/1", "shorter": "mOrange", "longer": "mOrange2", "marking": "identity", "justification": null, "markingSource": "generated: the identity route", "display": { "decidedBy": "the marking and the two calls' spans on the person's sequence, per locus", "rule": "pipeline/plasmid-map/fixtures/specificity-display.json and docs/technical/app-plasmid.md", "bucketDecidesNothing": true }, "reported": { "mOrange": { "call": "match", "identityExact": "707/711", "coverageExact": "711/711", "score": 1402.0, "alignedFeatureBases": 711, "offsets": [ { "strand": "+", "start": 1, "end": 711, "call": "match" } ] }, "mOrange2": { "call": "match", "identityExact": "707/711", "coverageExact": "711/711", "score": 1402.0, "alignedFeatureBases": 711, "offsets": [ { "strand": "+", "start": 1, "end": 711, "call": "match" } ] } } }, { "a": "mOrange", "b": "mRfp1", "bucket": "identity", "identity": "211/218", "covShort": "109/113", "covLong": "218/237", "lengthRatio": "226/237", "shorter": "mRfp1", "longer": "mOrange", "marking": "identity", "justification": null, "markingSource": "generated: the identity route", "display": { "decidedBy": "the marking and the two calls' spans on the person's sequence, per locus", "rule": "pipeline/plasmid-map/fixtures/specificity-display.json and docs/technical/app-plasmid.md", "bucketDecidesNothing": true }, "reported": { "mOrange": { "call": "partial", "identityExact": "633/654", "coverageExact": "654/711", "score": 1203.0, "alignedFeatureBases": 654, "offsets": [ { "strand": "+", "start": 20, "end": 673, "call": "partial" } ] }, "mRfp1": { "call": "partial", "identityExact": "633/654", "coverageExact": "654/678", "score": 1203.0, "alignedFeatureBases": 654, "offsets": [ { "strand": "+", "start": 35, "end": 688, "call": "partial" } ] } } }, { "a": "mOrange", "b": "mStrawberry", "bucket": "identity", "identity": "232/237", "covShort": "1/1", "covLong": "1/1", "lengthRatio": "1/1", "shorter": "mOrange", "longer": "mStrawberry", "marking": "identity", "justification": null, "markingSource": "generated: the identity route", "display": { "decidedBy": "the marking and the two calls' spans on the person's sequence, per locus", "rule": "pipeline/plasmid-map/fixtures/specificity-display.json and docs/technical/app-plasmid.md", "bucketDecidesNothing": true }, "reported": { "mOrange": { "call": "partial", "identityExact": "696/711", "coverageExact": "711/711", "score": 1347.0, "alignedFeatureBases": 711, "offsets": [ { "strand": "+", "start": 1, "end": 711, "call": "partial" } ] }, "mStrawberry": { "call": "partial", "identityExact": "696/711", "coverageExact": "711/711", "score": 1347.0, "alignedFeatureBases": 711, "offsets": [ { "strand": "+", "start": 1, "end": 711, "call": "partial" } ] } } }, { "a": "mOrange", "b": "mTangerine", "bucket": "identity", "identity": "316/327", "covShort": "109/113", "covLong": "218/237", "lengthRatio": "226/237", "shorter": "mTangerine", "longer": "mOrange", "marking": "identity", "justification": null, "markingSource": "generated: the identity route", "display": { "decidedBy": "the marking and the two calls' spans on the person's sequence, per locus", "rule": "pipeline/plasmid-map/fixtures/specificity-display.json and docs/technical/app-plasmid.md", "bucketDecidesNothing": true }, "reported": { "mOrange": { "call": "partial", "identityExact": "632/654", "coverageExact": "654/711", "score": 1198.0, "alignedFeatureBases": 654, "offsets": [ { "strand": "+", "start": 20, "end": 673, "call": "partial" } ] }, "mTangerine": { "call": "partial", "identityExact": "632/654", "coverageExact": "654/678", "score": 1198.0, "alignedFeatureBases": 654, "offsets": [ { "strand": "+", "start": 35, "end": 688, "call": "partial" } ] } } }, { "a": "mOrange2", "b": "mBlueberry2", "bucket": "identity", "identity": "337/356", "covShort": "1/1", "covLong": "1/1", "lengthRatio": "1/1", "shorter": "mOrange2", "longer": "mBlueberry2", "marking": "identity", "justification": null, "markingSource": "generated: the identity route", "display": { "decidedBy": "the marking and the two calls' spans on the person's sequence, per locus", "rule": "pipeline/plasmid-map/fixtures/specificity-display.json and docs/technical/app-plasmid.md", "bucketDecidesNothing": true }, "reported": { "mOrange2": { "call": "partial", "identityExact": "674/712", "coverageExact": "711/711", "score": 1230.0, "alignedFeatureBases": 711, "offsets": [ { "strand": "+", "start": 1, "end": 711, "call": "partial" } ] }, "mBlueberry2": { "call": "partial", "identityExact": "674/712", "coverageExact": "711/711", "score": 1230.0, "alignedFeatureBases": 711, "offsets": [ { "strand": "+", "start": 1, "end": 711, "call": "partial" } ] } } }, { "a": "mOrange2", "b": "mRfp1", "bucket": "identity", "identity": "631/654", "covShort": "109/113", "covLong": "218/237", "lengthRatio": "226/237", "shorter": "mRfp1", "longer": "mOrange2", "marking": "identity", "justification": null, "markingSource": "generated: the identity route", "display": { "decidedBy": "the marking and the two calls' spans on the person's sequence, per locus", "rule": "pipeline/plasmid-map/fixtures/specificity-display.json and docs/technical/app-plasmid.md", "bucketDecidesNothing": true }, "reported": { "mOrange2": { "call": "partial", "identityExact": "631/654", "coverageExact": "654/711", "score": 1193.0, "alignedFeatureBases": 654, "offsets": [ { "strand": "+", "start": 20, "end": 673, "call": "partial" } ] }, "mRfp1": { "call": "partial", "identityExact": "631/654", "coverageExact": "654/678", "score": 1193.0, "alignedFeatureBases": 654, "offsets": [ { "strand": "+", "start": 35, "end": 688, "call": "partial" } ] } } }, { "a": "mStrawberry", "b": "mApple", "bucket": "identity", "identity": "671/711", "covShort": "1/1", "covLong": "1/1", "lengthRatio": "1/1", "shorter": "mStrawberry", "longer": "mApple", "marking": "identity", "justification": null, "markingSource": "generated: the identity route", "display": { "decidedBy": "the marking and the two calls' spans on the person's sequence, per locus", "rule": "pipeline/plasmid-map/fixtures/specificity-display.json and docs/technical/app-plasmid.md", "bucketDecidesNothing": true }, "reported": { "mStrawberry": { "call": "partial", "identityExact": "671/711", "coverageExact": "711/711", "score": 1222.0, "alignedFeatureBases": 711, "offsets": [ { "strand": "+", "start": 1, "end": 711, "call": "partial" } ] }, "mApple": { "call": "partial", "identityExact": "671/711", "coverageExact": "711/711", "score": 1222.0, "alignedFeatureBases": 711, "offsets": [ { "strand": "+", "start": 1, "end": 711, "call": "partial" } ] } } }, { "a": "mStrawberry", "b": "mBanana", "bucket": "identity", "identity": "679/711", "covShort": "1/1", "covLong": "1/1", "lengthRatio": "1/1", "shorter": "mStrawberry", "longer": "mBanana", "marking": "identity", "justification": null, "markingSource": "generated: the identity route", "display": { "decidedBy": "the marking and the two calls' spans on the person's sequence, per locus", "rule": "pipeline/plasmid-map/fixtures/specificity-display.json and docs/technical/app-plasmid.md", "bucketDecidesNothing": true }, "reported": { "mStrawberry": { "call": "partial", "identityExact": "679/711", "coverageExact": "711/711", "score": 1262.0, "alignedFeatureBases": 711, "offsets": [ { "strand": "+", "start": 1, "end": 711, "call": "partial" } ] }, "mBanana": { "call": "partial", "identityExact": "679/711", "coverageExact": "711/711", "score": 1262.0, "alignedFeatureBases": 711, "offsets": [ { "strand": "+", "start": 1, "end": 711, "call": "partial" } ] } } }, { "a": "mStrawberry", "b": "mBlueberry2", "bucket": "identity", "identity": "677/712", "covShort": "1/1", "covLong": "1/1", "lengthRatio": "1/1", "shorter": "mStrawberry", "longer": "mBlueberry2", "marking": "identity", "justification": null, "markingSource": "generated: the identity route", "display": { "decidedBy": "the marking and the two calls' spans on the person's sequence, per locus", "rule": "pipeline/plasmid-map/fixtures/specificity-display.json and docs/technical/app-plasmid.md", "bucketDecidesNothing": true }, "reported": { "mStrawberry": { "call": "partial", "identityExact": "677/712", "coverageExact": "711/711", "score": 1245.0, "alignedFeatureBases": 711, "offsets": [ { "strand": "+", "start": 1, "end": 711, "call": "partial" } ] }, "mBlueberry2": { "call": "partial", "identityExact": "677/712", "coverageExact": "711/711", "score": 1245.0, "alignedFeatureBases": 711, "offsets": [ { "strand": "+", "start": 1, "end": 711, "call": "partial" } ] } } }, { "a": "mStrawberry", "b": "mHoneydew", "bucket": "identity", "identity": "70/73", "covShort": "109/113", "covLong": "218/237", "lengthRatio": "226/237", "shorter": "mHoneydew", "longer": "mStrawberry", "marking": "identity", "justification": null, "markingSource": "generated: the identity route", "display": { "decidedBy": "the marking and the two calls' spans on the person's sequence, per locus", "rule": "pipeline/plasmid-map/fixtures/specificity-display.json and docs/technical/app-plasmid.md", "bucketDecidesNothing": true }, "reported": { "mStrawberry": { "call": "partial", "identityExact": "630/657", "coverageExact": "654/711", "score": 1179.0, "alignedFeatureBases": 654, "offsets": [ { "strand": "+", "start": 20, "end": 673, "call": "partial" } ] }, "mHoneydew": { "call": "partial", "identityExact": "630/657", "coverageExact": "654/678", "score": 1179.0, "alignedFeatureBases": 654, "offsets": [ { "strand": "+", "start": 35, "end": 688, "call": "partial" } ] } } }, { "a": "mStrawberry", "b": "mOrange2", "bucket": "identity", "identity": "77/79", "covShort": "1/1", "covLong": "1/1", "lengthRatio": "1/1", "shorter": "mStrawberry", "longer": "mOrange2", "marking": "identity", "justification": null, "markingSource": "generated: the identity route", "display": { "decidedBy": "the marking and the two calls' spans on the person's sequence, per locus", "rule": "pipeline/plasmid-map/fixtures/specificity-display.json and docs/technical/app-plasmid.md", "bucketDecidesNothing": true }, "reported": { "mStrawberry": { "call": "partial", "identityExact": "693/711", "coverageExact": "711/711", "score": 1332.0, "alignedFeatureBases": 711, "offsets": [ { "strand": "+", "start": 1, "end": 711, "call": "partial" } ] }, "mOrange2": { "call": "partial", "identityExact": "693/711", "coverageExact": "711/711", "score": 1332.0, "alignedFeatureBases": 711, "offsets": [ { "strand": "+", "start": 1, "end": 711, "call": "partial" } ] } } }, { "a": "mStrawberry", "b": "mRfp1", "bucket": "identity", "identity": "317/327", "covShort": "109/113", "covLong": "218/237", "lengthRatio": "226/237", "shorter": "mRfp1", "longer": "mStrawberry", "marking": "identity", "justification": null, "markingSource": "generated: the identity route", "display": { "decidedBy": "the marking and the two calls' spans on the person's sequence, per locus", "rule": "pipeline/plasmid-map/fixtures/specificity-display.json and docs/technical/app-plasmid.md", "bucketDecidesNothing": true }, "reported": { "mStrawberry": { "call": "partial", "identityExact": "634/654", "coverageExact": "654/711", "score": 1208.0, "alignedFeatureBases": 654, "offsets": [ { "strand": "+", "start": 20, "end": 673, "call": "partial" } ] }, "mRfp1": { "call": "partial", "identityExact": "634/654", "coverageExact": "654/678", "score": 1208.0, "alignedFeatureBases": 654, "offsets": [ { "strand": "+", "start": 35, "end": 688, "call": "partial" } ] } } }, { "a": "mStrawberry", "b": "mTangerine", "bucket": "identity", "identity": "635/654", "covShort": "109/113", "covLong": "218/237", "lengthRatio": "226/237", "shorter": "mTangerine", "longer": "mStrawberry", "marking": "identity", "justification": null, "markingSource": "generated: the identity route", "display": { "decidedBy": "the marking and the two calls' spans on the person's sequence, per locus", "rule": "pipeline/plasmid-map/fixtures/specificity-display.json and docs/technical/app-plasmid.md", "bucketDecidesNothing": true }, "reported": { "mStrawberry": { "call": "partial", "identityExact": "635/654", "coverageExact": "654/711", "score": 1213.0, "alignedFeatureBases": 654, "offsets": [ { "strand": "+", "start": 20, "end": 673, "call": "partial" } ] }, "mTangerine": { "call": "partial", "identityExact": "635/654", "coverageExact": "654/678", "score": 1213.0, "alignedFeatureBases": 654, "offsets": [ { "strand": "+", "start": 35, "end": 688, "call": "partial" } ] } } }, { "a": "mTangerine", "b": "mApple", "bucket": "identity", "identity": "613/655", "covShort": "109/113", "covLong": "218/237", "lengthRatio": "226/237", "shorter": "mTangerine", "longer": "mApple", "marking": "identity", "justification": null, "markingSource": "generated: the identity route", "display": { "decidedBy": "the marking and the two calls' spans on the person's sequence, per locus", "rule": "pipeline/plasmid-map/fixtures/specificity-display.json and docs/technical/app-plasmid.md", "bucketDecidesNothing": true }, "reported": { "mTangerine": { "call": "partial", "identityExact": "613/655", "coverageExact": "654/678", "score": 1096.0, "alignedFeatureBases": 654, "offsets": [ { "strand": "+", "start": 35, "end": 688, "call": "partial" } ] }, "mApple": { "call": "partial", "identityExact": "613/655", "coverageExact": "654/711", "score": 1096.0, "alignedFeatureBases": 654, "offsets": [ { "strand": "+", "start": 20, "end": 673, "call": "partial" } ] } } }, { "a": "mTangerine", "b": "mBlueberry2", "bucket": "identity", "identity": "155/164", "covShort": "109/113", "covLong": "218/237", "lengthRatio": "226/237", "shorter": "mTangerine", "longer": "mBlueberry2", "marking": "identity", "justification": null, "markingSource": "generated: the identity route", "display": { "decidedBy": "the marking and the two calls' spans on the person's sequence, per locus", "rule": "pipeline/plasmid-map/fixtures/specificity-display.json and docs/technical/app-plasmid.md", "bucketDecidesNothing": true }, "reported": { "mTangerine": { "call": "partial", "identityExact": "620/656", "coverageExact": "654/678", "score": 1124.0, "alignedFeatureBases": 654, "offsets": [ { "strand": "+", "start": 35, "end": 688, "call": "partial" } ] }, "mBlueberry2": { "call": "partial", "identityExact": "620/656", "coverageExact": "654/711", "score": 1124.0, "alignedFeatureBases": 654, "offsets": [ { "strand": "+", "start": 20, "end": 673, "call": "partial" } ] } } }, { "a": "mTangerine", "b": "mHoneydew", "bucket": "identity", "identity": "95/97", "covShort": "1/1", "covLong": "1/1", "lengthRatio": "1/1", "shorter": "mTangerine", "longer": "mHoneydew", "marking": "identity", "justification": null, "markingSource": "generated: the identity route", "display": { "decidedBy": "the marking and the two calls' spans on the person's sequence, per locus", "rule": "pipeline/plasmid-map/fixtures/specificity-display.json and docs/technical/app-plasmid.md", "bucketDecidesNothing": true }, "reported": { "mTangerine": { "call": "partial", "identityExact": "665/679", "coverageExact": "678/678", "score": 1284.0, "alignedFeatureBases": 678, "offsets": [ { "strand": "+", "start": 1, "end": 678, "call": "partial" } ] }, "mHoneydew": { "call": "partial", "identityExact": "665/679", "coverageExact": "678/678", "score": 1284.0, "alignedFeatureBases": 678, "offsets": [ { "strand": "+", "start": 1, "end": 678, "call": "partial" } ] } } }, { "a": "mTangerine", "b": "mOrange2", "bucket": "identity", "identity": "105/109", "covShort": "109/113", "covLong": "218/237", "lengthRatio": "226/237", "shorter": "mTangerine", "longer": "mOrange2", "marking": "identity", "justification": null, "markingSource": "generated: the identity route", "display": { "decidedBy": "the marking and the two calls' spans on the person's sequence, per locus", "rule": "pipeline/plasmid-map/fixtures/specificity-display.json and docs/technical/app-plasmid.md", "bucketDecidesNothing": true }, "reported": { "mTangerine": { "call": "partial", "identityExact": "630/654", "coverageExact": "654/678", "score": 1188.0, "alignedFeatureBases": 654, "offsets": [ { "strand": "+", "start": 35, "end": 688, "call": "partial" } ] }, "mOrange2": { "call": "partial", "identityExact": "630/654", "coverageExact": "654/711", "score": 1188.0, "alignedFeatureBases": 654, "offsets": [ { "strand": "+", "start": 20, "end": 673, "call": "partial" } ] } } }, { "a": "mTangerine", "b": "mRfp1", "bucket": "identity", "identity": "112/113", "covShort": "1/1", "covLong": "1/1", "lengthRatio": "1/1", "shorter": "mTangerine", "longer": "mRfp1", "marking": "identity", "justification": null, "markingSource": "generated: the identity route", "display": { "decidedBy": "the marking and the two calls' spans on the person's sequence, per locus", "rule": "pipeline/plasmid-map/fixtures/specificity-display.json and docs/technical/app-plasmid.md", "bucketDecidesNothing": true }, "reported": { "mTangerine": { "call": "match", "identityExact": "672/678", "coverageExact": "678/678", "score": 1326.0, "alignedFeatureBases": 678, "offsets": [ { "strand": "+", "start": 1, "end": 678, "call": "match" } ] }, "mRfp1": { "call": "match", "identityExact": "672/678", "coverageExact": "678/678", "score": 1326.0, "alignedFeatureBases": 678, "offsets": [ { "strand": "+", "start": 1, "end": 678, "call": "match" } ] } } }, { "a": "hiv1Ltr5", "b": "hiv1Ltr3", "bucket": "partial overlap", "identity": "198/199", "covShort": "199/235", "covLong": "0/1", "lengthRatio": "235/634", "shorter": "hiv1Ltr3", "longer": "hiv1Ltr5", "sharedSpan": "R and U5: 199 bases, hiv1Ltr5 436..634", "marking": "shared-subsequence", "justification": "AY468486.1 annotates both LTRs of its own vector; the 3' LTR carries the deletion of the distal U3 promoter its note describes. The bases they share are the R and U5 regions present once at each physical LTR, not a smaller part annotated inside a larger one, so neither is ever drawn inside the other and the also-within match is reported over the shared span alone. The shared span is measured, not a phrase: 199 bases, hiv1Ltr5 436..634, which is the 3' end of the 5' LTR where R and U5 lie. Of hiv1Ltr3's 235 bases, 199 align and 36 do not, so the 3' LTR keeps residual sequence beyond the shared core and the span is the core as annotated rather than the whole of either entry (the CSO, 17 October 2026).", "markingSource": "library-pairs.csv", "display": { "decidedBy": "the marking and the two calls' spans on the person's sequence, per locus", "rule": "pipeline/plasmid-map/fixtures/specificity-display.json and docs/technical/app-plasmid.md", "bucketDecidesNothing": true }, "reported": { "hiv1Ltr3": { "call": "partial", "identityExact": "198/199", "coverageExact": "199/235", "score": 393.0, "alignedFeatureBases": 199, "offsets": [ { "strand": "+", "start": 436, "end": 634, "call": "partial" } ] } } }, { "a": "trc", "b": "lacPromoter", "bucket": "partial overlap", "identity": "65/72", "covShort": "36/61", "covLong": "0/1", "lengthRatio": "61/123", "shorter": "lacPromoter", "longer": "trc", "marking": "unsettled", "justification": "Partial overlap by measurement, so both calls are shown with their own spans and this marking is not consulted for the display; it is recorded because a published pair carries a value. The measured overlap is 72 of lacPromoter's 122 bases at 65/72 identical, aligned at 176..246 of the trc region. Both are promoter regions their submitters named as such, and nothing in either record states that one was built from the other's parent, so the hybrid origin of such promoters is NOT asserted here. A primary citation with page and date read would make this shared-subsequence with the span stated, and would still change no display (the CSO, 2026-10-17-cso-the-five-causes-and-the-absence-narrowing.md section 3). Not settled by the records; checked 17 October 2026.", "markingSource": "library-pairs.csv", "display": { "decidedBy": "the marking and the two calls' spans on the person's sequence, per locus", "rule": "pipeline/plasmid-map/fixtures/specificity-display.json and docs/technical/app-plasmid.md", "bucketDecidesNothing": true }, "reported": { "lacPromoter": { "call": "partial", "identityExact": "65/72", "coverageExact": "72/122", "score": 107.0, "alignedFeatureBases": 72, "offsets": [ { "strand": "+", "start": 176, "end": 246, "call": "partial" } ] } } } ] }