{ "about": { "generatedBy": "pipeline/plasmid-map/sequence-handoff.py", "recordedOn": "2026-10-11", "oracle": "Independent Python exact-match derivation; Biopython 1.88 location extraction; hashlib SHA-256", "inputPins": { "fixtures/pcr-product.json": "dd145d143e6f6542aee4d625492315db1d69e1aada4c3934ae2ea18f6b4a3759", "fixtures/primer-design.json": "ce1239c060a57c39399d12362e625221081484a761e367c48bf60cd69983c6ec", "exact_matches.py": "d6e68e76d2041367238c4274faafd9a188628c25447618f00cdbadbcd0c2da6d", "fixtures/primer-design-qualification-v2.json": "15bc9c8cb50e4568f42a10cdd3d52eb88121d59826c73dfc9a2a24abbef3dd21" }, "statement": "Predicted incorporated primers and recorded exact template sites are sequence annotations, not evidence of amplification or genome-wide specificity.", "pendingBeforePublication": [ "CSO review and commit before admission implementation; publish qualification source fixture in Sequence 0.6.0 first" ] }, "cases": [ { "id": "pcr-hand-unique", "input": { "v": 2, "app": "sequence-toolkit", "residues": "AGCTTGACCTTTAGCACTTGGATCC", "alphabet": "dna", "name": "Independent handoff fixture", "primerSets": [], "sequenceWorkspace": { "v": 1, "text": ">mapping alphabet=dna\nAGCTTGACCTTTAGCACTTGGATCC\n", "templateText": "", "state": { "alphabet": "dna" }, "sourceContext": "" }, "pcrProduct": { "v": 1, "methodVersion": "exact-pair-v1", "createdAt": "2026-10-11T00:00:00.000Z", "name": "Predicted fixture product", "names": { "template": "Oracle template", "forward": "Forward", "reverse": "Reverse" }, "input": { "template": "GATCAAAGCTTGACCTTTAGCACTTGGATCCCCA", "topology": "linear", "forward": { "annealing": "AGCTTGACCT", "tail": "" }, "reverse": { "annealing": "GGATCCAAGT", "tail": "" } }, "product": { "id": "+:7:16|-:31:22", "sequence": "AGCTTGACCTTTAGCACTTGGATCC", "length": 25, "templateLength": 34, "templateSpan": 25, "orientation": "+", "crossesOrigin": false, "forward": { "strand": "+", "start": 7, "end": 16, "length": 10 }, "reverse": { "strand": "-", "start": 31, "end": 22, "length": 10 } }, "predicted": true, "topology": "linear", "candidateCount": 1, "overlappingPairs": 0, "limitation": "Predicted from exact primer matches on the supplied template only. This is not genome-wide specificity screening or evidence of successful amplification. Template feature annotations were not transferred." } }, "expected": { "readable": true, "features": [ { "direction": "forward", "key": "primer_bind", "strand": "+", "location": "1..10", "parts": [ { "start": 1, "end": 10 } ], "extracted": "AGCTTGACCT", "annealing": "AGCTTGACCT", "tail": "", "meaning": "predicted-incorporated-primer" }, { "direction": "reverse", "key": "primer_bind", "strand": "-", "location": "complement(16..25)", "parts": [ { "start": 16, "end": 25 } ], "extracted": "GGATCCAAGT", "annealing": "GGATCCAAGT", "tail": "", "meaning": "predicted-incorporated-primer" } ], "placedSets": 0, "skippedSets": 0, "pcrFeatures": 2 }, "note": "Product features use supplied-forward orientation, regardless of template strand." }, { "id": "pcr-reverse-template", "input": { "v": 2, "app": "sequence-toolkit", "residues": "AGCTTGACCTTTAGCACTTGGATCC", "alphabet": "dna", "name": "Independent handoff fixture", "primerSets": [], "sequenceWorkspace": { "v": 1, "text": ">mapping alphabet=dna\nAGCTTGACCTTTAGCACTTGGATCC\n", "templateText": "", "state": { "alphabet": "dna" }, "sourceContext": "" }, "pcrProduct": { "v": 1, "methodVersion": "exact-pair-v1", "createdAt": "2026-10-11T00:00:00.000Z", "name": "Predicted fixture product", "names": { "template": "Oracle template", "forward": "Forward", "reverse": "Reverse" }, "input": { "template": "TGGGGATCCAAGTGCTAAAGGTCAAGCTTTGATC", "topology": "linear", "forward": { "annealing": "AGCTTGACCT", "tail": "" }, "reverse": { "annealing": "GGATCCAAGT", "tail": "" } }, "product": { "id": "-:28:19|+:4:13", "sequence": "AGCTTGACCTTTAGCACTTGGATCC", "length": 25, "templateLength": 34, "templateSpan": 25, "orientation": "-", "crossesOrigin": false, "forward": { "strand": "-", "start": 28, "end": 19, "length": 10 }, "reverse": { "strand": "+", "start": 4, "end": 13, "length": 10 } }, "predicted": true, "topology": "linear", "candidateCount": 1, "overlappingPairs": 0, "limitation": "Predicted from exact primer matches on the supplied template only. This is not genome-wide specificity screening or evidence of successful amplification. Template feature annotations were not transferred." } }, "expected": { "readable": true, "features": [ { "direction": "forward", "key": "primer_bind", "strand": "+", "location": "1..10", "parts": [ { "start": 1, "end": 10 } ], "extracted": "AGCTTGACCT", "annealing": "AGCTTGACCT", "tail": "", "meaning": "predicted-incorporated-primer" }, { "direction": "reverse", "key": "primer_bind", "strand": "-", "location": "complement(16..25)", "parts": [ { "start": 16, "end": 25 } ], "extracted": "GGATCCAAGT", "annealing": "GGATCCAAGT", "tail": "", "meaning": "predicted-incorporated-primer" } ], "placedSets": 0, "skippedSets": 0, "pcrFeatures": 2 }, "note": "Product features use supplied-forward orientation, regardless of template strand." }, { "id": "pcr-circular-origin", "input": { "v": 2, "app": "sequence-toolkit", "residues": "AGCTTGACCTTTAGCACTTGGATCC", "alphabet": "dna", "name": "Independent handoff fixture", "primerSets": [], "sequenceWorkspace": { "v": 1, "text": ">mapping alphabet=dna\nAGCTTGACCTTTAGCACTTGGATCC\n", "templateText": "", "state": { "alphabet": "dna" }, "sourceContext": "" }, "pcrProduct": { "v": 1, "methodVersion": "exact-pair-v1", "createdAt": "2026-10-11T00:00:00.000Z", "name": "Predicted fixture product", "names": { "template": "Oracle template", "forward": "Forward", "reverse": "Reverse" }, "input": { "template": "CACTTGGATCCCCAGATCAAAGCTTGACCTTTAG", "topology": "circular", "forward": { "annealing": "AGCTTGACCT", "tail": "" }, "reverse": { "annealing": "GGATCCAAGT", "tail": "" } }, "product": { "id": "+:21:30|-:11:2", "sequence": "AGCTTGACCTTTAGCACTTGGATCC", "length": 25, "templateLength": 34, "templateSpan": 25, "orientation": "+", "crossesOrigin": true, "forward": { "strand": "+", "start": 21, "end": 30, "length": 10 }, "reverse": { "strand": "-", "start": 11, "end": 2, "length": 10 } }, "predicted": true, "topology": "linear", "candidateCount": 1, "overlappingPairs": 0, "limitation": "Predicted from exact primer matches on the supplied template only. This is not genome-wide specificity screening or evidence of successful amplification. Template feature annotations were not transferred." } }, "expected": { "readable": true, "features": [ { "direction": "forward", "key": "primer_bind", "strand": "+", "location": "1..10", "parts": [ { "start": 1, "end": 10 } ], "extracted": "AGCTTGACCT", "annealing": "AGCTTGACCT", "tail": "", "meaning": "predicted-incorporated-primer" }, { "direction": "reverse", "key": "primer_bind", "strand": "-", "location": "complement(16..25)", "parts": [ { "start": 16, "end": 25 } ], "extracted": "GGATCCAAGT", "annealing": "GGATCCAAGT", "tail": "", "meaning": "predicted-incorporated-primer" } ], "placedSets": 0, "skippedSets": 0, "pcrFeatures": 2 }, "note": "Product features use supplied-forward orientation, regardless of template strand." }, { "id": "pcr-site-across-origin", "input": { "v": 2, "app": "sequence-toolkit", "residues": "AGCTTGACCTTTAGCACTTGGATCC", "alphabet": "dna", "name": "Independent handoff fixture", "primerSets": [], "sequenceWorkspace": { "v": 1, "text": ">mapping alphabet=dna\nAGCTTGACCTTTAGCACTTGGATCC\n", "templateText": "", "state": { "alphabet": "dna" }, "sourceContext": "" }, "pcrProduct": { "v": 1, "methodVersion": "exact-pair-v1", "createdAt": "2026-10-11T00:00:00.000Z", "name": "Predicted fixture product", "names": { "template": "Oracle template", "forward": "Forward", "reverse": "Reverse" }, "input": { "template": "TGACCTTTAGCACTTGGATCCCCAGATCAAAGCT", "topology": "circular", "forward": { "annealing": "AGCTTGACCT", "tail": "" }, "reverse": { "annealing": "GGATCCAAGT", "tail": "" } }, "product": { "id": "+:31:6|-:21:12", "sequence": "AGCTTGACCTTTAGCACTTGGATCC", "length": 25, "templateLength": 34, "templateSpan": 25, "orientation": "+", "crossesOrigin": true, "forward": { "strand": "+", "start": 31, "end": 6, "length": 10 }, "reverse": { "strand": "-", "start": 21, "end": 12, "length": 10 } }, "predicted": true, "topology": "linear", "candidateCount": 1, "overlappingPairs": 0, "limitation": "Predicted from exact primer matches on the supplied template only. This is not genome-wide specificity screening or evidence of successful amplification. Template feature annotations were not transferred." } }, "expected": { "readable": true, "features": [ { "direction": "forward", "key": "primer_bind", "strand": "+", "location": "1..10", "parts": [ { "start": 1, "end": 10 } ], "extracted": "AGCTTGACCT", "annealing": "AGCTTGACCT", "tail": "", "meaning": "predicted-incorporated-primer" }, { "direction": "reverse", "key": "primer_bind", "strand": "-", "location": "complement(16..25)", "parts": [ { "start": 16, "end": 25 } ], "extracted": "GGATCCAAGT", "annealing": "GGATCCAAGT", "tail": "", "meaning": "predicted-incorporated-primer" } ], "placedSets": 0, "skippedSets": 0, "pcrFeatures": 2 }, "note": "Product features use supplied-forward orientation, regardless of template strand." }, { "id": "pcr-two-forward-sites", "input": { "v": 2, "app": "sequence-toolkit", "residues": "AGCTTGACCTGGACTTGGATCC", "alphabet": "dna", "name": "Independent handoff fixture", "primerSets": [], "sequenceWorkspace": { "v": 1, "text": ">mapping alphabet=dna\nAGCTTGACCTGGACTTGGATCC\n", "templateText": "", "state": { "alphabet": "dna" }, "sourceContext": "" }, "pcrProduct": { "v": 1, "methodVersion": "exact-pair-v1", "createdAt": "2026-10-11T00:00:00.000Z", "name": "Predicted fixture product", "names": { "template": "Oracle template", "forward": "Forward", "reverse": "Reverse" }, "input": { "template": "GATCAAAGCTTGACCTTTAGCAGCTTGACCTGGACTTGGATCCCCA", "topology": "linear", "forward": { "annealing": "AGCTTGACCT", "tail": "" }, "reverse": { "annealing": "GGATCCAAGT", "tail": "" } }, "product": { "id": "+:22:31|-:43:34", "sequence": "AGCTTGACCTGGACTTGGATCC", "length": 22, "templateLength": 46, "templateSpan": 22, "orientation": "+", "crossesOrigin": false, "forward": { "strand": "+", "start": 22, "end": 31, "length": 10 }, "reverse": { "strand": "-", "start": 43, "end": 34, "length": 10 } }, "predicted": true, "topology": "linear", "candidateCount": 2, "overlappingPairs": 0, "limitation": "Predicted from exact primer matches on the supplied template only. This is not genome-wide specificity screening or evidence of successful amplification. Template feature annotations were not transferred." } }, "expected": { "readable": true, "features": [ { "direction": "forward", "key": "primer_bind", "strand": "+", "location": "1..10", "parts": [ { "start": 1, "end": 10 } ], "extracted": "AGCTTGACCT", "annealing": "AGCTTGACCT", "tail": "", "meaning": "predicted-incorporated-primer" }, { "direction": "reverse", "key": "primer_bind", "strand": "-", "location": "complement(13..22)", "parts": [ { "start": 13, "end": 22 } ], "extracted": "GGATCCAAGT", "annealing": "GGATCCAAGT", "tail": "", "meaning": "predicted-incorporated-primer" } ], "placedSets": 0, "skippedSets": 0, "pcrFeatures": 2 }, "note": "Product features use supplied-forward orientation, regardless of template strand." }, { "id": "pcr-asymmetric-nonpalindromic-tails", "input": { "v": 2, "app": "sequence-toolkit", "residues": "ACGTAAGCTTGACCTTTAGCACTTGGATCCAGGATC", "alphabet": "dna", "name": "Independent handoff fixture", "primerSets": [], "sequenceWorkspace": { "v": 1, "text": ">mapping alphabet=dna\nACGTAAGCTTGACCTTTAGCACTTGGATCCAGGATC\n", "templateText": "", "state": { "alphabet": "dna" }, "sourceContext": "" }, "pcrProduct": { "v": 1, "methodVersion": "exact-pair-v1", "createdAt": "2026-10-11T00:00:00.000Z", "name": "Predicted fixture product", "names": { "template": "Oracle template", "forward": "Forward", "reverse": "Reverse" }, "input": { "template": "GATCAAAGCTTGACCTTTAGCACTTGGATCCCCA", "topology": "linear", "forward": { "annealing": "AGCTTGACCT", "tail": "ACGTA" }, "reverse": { "annealing": "GGATCCAAGT", "tail": "GATCCT" } }, "product": { "id": "+:7:16|-:31:22", "sequence": "ACGTAAGCTTGACCTTTAGCACTTGGATCCAGGATC", "length": 36, "templateLength": 34, "templateSpan": 25, "orientation": "+", "crossesOrigin": false, "forward": { "strand": "+", "start": 7, "end": 16, "length": 10 }, "reverse": { "strand": "-", "start": 31, "end": 22, "length": 10 } }, "predicted": true, "topology": "linear", "candidateCount": 1, "overlappingPairs": 0, "limitation": "Predicted from exact primer matches on the supplied template only. This is not genome-wide specificity screening or evidence of successful amplification. Template feature annotations were not transferred." } }, "expected": { "readable": true, "features": [ { "direction": "forward", "key": "primer_bind", "strand": "+", "location": "1..15", "parts": [ { "start": 1, "end": 15 } ], "extracted": "ACGTAAGCTTGACCT", "annealing": "AGCTTGACCT", "tail": "ACGTA", "meaning": "predicted-incorporated-primer" }, { "direction": "reverse", "key": "primer_bind", "strand": "-", "location": "complement(21..36)", "parts": [ { "start": 21, "end": 36 } ], "extracted": "GATCCTGGATCCAAGT", "annealing": "GGATCCAAGT", "tail": "GATCCT", "meaning": "predicted-incorporated-primer" } ], "placedSets": 0, "skippedSets": 0, "pcrFeatures": 2 }, "note": "" }, { "id": "pcr-edited-residues", "input": { "v": 2, "app": "sequence-toolkit", "residues": "CCGTAAGCTTGACCTTTAGCACTTGGATCCAGGATC", "alphabet": "dna", "name": "Independent handoff fixture", "primerSets": [], "sequenceWorkspace": { "v": 1, "text": ">edited alphabet=dna\nCCGTAAGCTTGACCTTTAGCACTTGGATCCAGGATC\n", "templateText": "", "state": { "alphabet": "dna" }, "sourceContext": "" }, "pcrProduct": { "v": 1, "methodVersion": "exact-pair-v1", "createdAt": "2026-10-11T00:00:00.000Z", "name": "Predicted fixture product", "names": { "template": "Oracle template", "forward": "Forward", "reverse": "Reverse" }, "input": { "template": "GATCAAAGCTTGACCTTTAGCACTTGGATCCCCA", "topology": "linear", "forward": { "annealing": "AGCTTGACCT", "tail": "ACGTA" }, "reverse": { "annealing": "GGATCCAAGT", "tail": "GATCCT" } }, "product": { "id": "+:7:16|-:31:22", "sequence": "ACGTAAGCTTGACCTTTAGCACTTGGATCCAGGATC", "length": 36, "templateLength": 34, "templateSpan": 25, "orientation": "+", "crossesOrigin": false, "forward": { "strand": "+", "start": 7, "end": 16, "length": 10 }, "reverse": { "strand": "-", "start": 31, "end": 22, "length": 10 } }, "predicted": true, "topology": "linear", "candidateCount": 1, "overlappingPairs": 0, "limitation": "Predicted from exact primer matches on the supplied template only. This is not genome-wide specificity screening or evidence of successful amplification. Template feature annotations were not transferred." } }, "expected": { "readable": false, "refusal": "pcr-provenance" }, "note": "" }, { "id": "pcr-wrong-topology", "input": { "v": 2, "app": "sequence-toolkit", "residues": "ACGTAAGCTTGACCTTTAGCACTTGGATCCAGGATC", "alphabet": "dna-circular", "name": "Independent handoff fixture", "primerSets": [], "sequenceWorkspace": { "v": 1, "text": ">edited alphabet=dna-circular\nACGTAAGCTTGACCTTTAGCACTTGGATCCAGGATC\n", "templateText": "", "state": { "alphabet": "dna-circular" }, "sourceContext": "" }, "pcrProduct": { "v": 1, "methodVersion": "exact-pair-v1", "createdAt": "2026-10-11T00:00:00.000Z", "name": "Predicted fixture product", "names": { "template": "Oracle template", "forward": "Forward", "reverse": "Reverse" }, "input": { "template": "GATCAAAGCTTGACCTTTAGCACTTGGATCCCCA", "topology": "linear", "forward": { "annealing": "AGCTTGACCT", "tail": "ACGTA" }, "reverse": { "annealing": "GGATCCAAGT", "tail": "GATCCT" } }, "product": { "id": "+:7:16|-:31:22", "sequence": "ACGTAAGCTTGACCTTTAGCACTTGGATCCAGGATC", "length": 36, "templateLength": 34, "templateSpan": 25, "orientation": "+", "crossesOrigin": false, "forward": { "strand": "+", "start": 7, "end": 16, "length": 10 }, "reverse": { "strand": "-", "start": 31, "end": 22, "length": 10 } }, "predicted": true, "topology": "linear", "candidateCount": 1, "overlappingPairs": 0, "limitation": "Predicted from exact primer matches on the supplied template only. This is not genome-wide specificity screening or evidence of successful amplification. Template feature annotations were not transferred." } }, "expected": { "readable": false, "refusal": "pcr-provenance" }, "note": "" }, { "id": "pcr-wrong-length", "input": { "v": 2, "app": "sequence-toolkit", "residues": "ACGTAAGCTTGACCTTTAGCACTTGGATCCAGGATC", "alphabet": "dna", "name": "Independent handoff fixture", "primerSets": [], "sequenceWorkspace": { "v": 1, "text": ">mapping alphabet=dna\nACGTAAGCTTGACCTTTAGCACTTGGATCCAGGATC\n", "templateText": "", "state": { "alphabet": "dna" }, "sourceContext": "" }, "pcrProduct": { "v": 1, "methodVersion": "exact-pair-v1", "createdAt": "2026-10-11T00:00:00.000Z", "name": "Predicted fixture product", "names": { "template": "Oracle template", "forward": "Forward", "reverse": "Reverse" }, "input": { "template": "GATCAAAGCTTGACCTTTAGCACTTGGATCCCCA", "topology": "linear", "forward": { "annealing": "AGCTTGACCT", "tail": "ACGTA" }, "reverse": { "annealing": "GGATCCAAGT", "tail": "GATCCT" } }, "product": { "id": "+:7:16|-:31:22", "sequence": "ACGTAAGCTTGACCTTTAGCACTTGGATCCAGGATC", "length": 37, "templateLength": 34, "templateSpan": 25, "orientation": "+", "crossesOrigin": false, "forward": { "strand": "+", "start": 7, "end": 16, "length": 10 }, "reverse": { "strand": "-", "start": 31, "end": 22, "length": 10 } }, "predicted": true, "topology": "linear", "candidateCount": 1, "overlappingPairs": 0, "limitation": "Predicted from exact primer matches on the supplied template only. This is not genome-wide specificity screening or evidence of successful amplification. Template feature annotations were not transferred." } }, "expected": { "readable": false, "refusal": "pcr-provenance" }, "note": "" }, { "id": "pcr-unsupported-method", "input": { "v": 2, "app": "sequence-toolkit", "residues": "ACGTAAGCTTGACCTTTAGCACTTGGATCCAGGATC", "alphabet": "dna", "name": "Independent handoff fixture", "primerSets": [], "sequenceWorkspace": { "v": 1, "text": ">mapping alphabet=dna\nACGTAAGCTTGACCTTTAGCACTTGGATCCAGGATC\n", "templateText": "", "state": { "alphabet": "dna" }, "sourceContext": "" }, "pcrProduct": { "v": 1, "methodVersion": "exact-pair-v999", "createdAt": "2026-10-11T00:00:00.000Z", "name": "Predicted fixture product", "names": { "template": "Oracle template", "forward": "Forward", "reverse": "Reverse" }, "input": { "template": "GATCAAAGCTTGACCTTTAGCACTTGGATCCCCA", "topology": "linear", "forward": { "annealing": "AGCTTGACCT", "tail": "ACGTA" }, "reverse": { "annealing": "GGATCCAAGT", "tail": "GATCCT" } }, "product": { "id": "+:7:16|-:31:22", "sequence": "ACGTAAGCTTGACCTTTAGCACTTGGATCCAGGATC", "length": 36, "templateLength": 34, "templateSpan": 25, "orientation": "+", "crossesOrigin": false, "forward": { "strand": "+", "start": 7, "end": 16, "length": 10 }, "reverse": { "strand": "-", "start": 31, "end": 22, "length": 10 } }, "predicted": true, "topology": "linear", "candidateCount": 1, "overlappingPairs": 0, "limitation": "Predicted from exact primer matches on the supplied template only. This is not genome-wide specificity screening or evidence of successful amplification. Template feature annotations were not transferred." } }, "expected": { "readable": false, "refusal": "pcr-provenance" }, "note": "" }, { "id": "pcr-tampered-candidate", "input": { "v": 2, "app": "sequence-toolkit", "residues": "ACGTAAGCTTGACCTTTAGCACTTGGATCCAGGATC", "alphabet": "dna", "name": "Independent handoff fixture", "primerSets": [], "sequenceWorkspace": { "v": 1, "text": ">mapping alphabet=dna\nACGTAAGCTTGACCTTTAGCACTTGGATCCAGGATC\n", "templateText": "", "state": { "alphabet": "dna" }, "sourceContext": "" }, "pcrProduct": { "v": 1, "methodVersion": "exact-pair-v1", "createdAt": "2026-10-11T00:00:00.000Z", "name": "Predicted fixture product", "names": { "template": "Oracle template", "forward": "Forward", "reverse": "Reverse" }, "input": { "template": "GATCAAAGCTTGACCTTTAGCACTTGGATCCCCA", "topology": "linear", "forward": { "annealing": "AGCTTGACCT", "tail": "ACGTA" }, "reverse": { "annealing": "GGATCCAAGT", "tail": "GATCCT" } }, "product": { "id": "not-a-candidate", "sequence": "ACGTAAGCTTGACCTTTAGCACTTGGATCCAGGATC", "length": 36, "templateLength": 34, "templateSpan": 25, "orientation": "+", "crossesOrigin": false, "forward": { "strand": "+", "start": 7, "end": 16, "length": 10 }, "reverse": { "strand": "-", "start": 31, "end": 22, "length": 10 } }, "predicted": true, "topology": "linear", "candidateCount": 1, "overlappingPairs": 0, "limitation": "Predicted from exact primer matches on the supplied template only. This is not genome-wide specificity screening or evidence of successful amplification. Template feature annotations were not transferred." } }, "expected": { "readable": false, "refusal": "pcr-provenance" }, "note": "" }, { "id": "sets-matching-linear", "input": { "v": 2, "app": "sequence-toolkit", "residues": "GATCAAAGCTTGACCTTTAGCACTTGGATCCCCA", "alphabet": "dna", "name": "Independent handoff fixture", "primerSets": [ { "v": 1, "id": "pair-1", "label": "Recorded mapping pair", "createdAt": "2026-10-11T00:00:00.000Z", "notes": "Independent coordinate fixture", "forward": { "annealing": "AGCTTGAC", "tail": "" }, "reverse": { "annealing": "GGATCCAA", "tail": "" }, "conditions": { "oligo_nM": 250, "na_mM": 50, "mg_mM": 0, "dntp_mM": 0, "model": "primer-excess", "saltCorrection": "owczarzy-2004" }, "design": { "method": "bounded-flanks-v1", "target": { "start": 9, "end": 16 }, "settings": { "target": { "start": 9, "end": 16 }, "excluded": [], "forwardTail": "", "reverseTail": "", "conditions": { "oligo_nM": 250, "na_mM": 50, "mg_mM": 0, "dntp_mM": 0, "model": "primer-excess", "saltCorrection": "owczarzy-2004" }, "flank": 0, "minLength": 8, "maxLength": 8, "targetLength": 8, "minTm": 0, "maxTm": 100, "targetTm": 40, "maxDeltaTm": 30, "minGc": 0, "maxGc": 100, "minProduct": 24, "maxProduct": 34 }, "capped": false, "counts": { "windows": 2, "boundary": 0, "excluded": 0, "gc": 0, "tm": 0, "validForward": 1, "validReverse": 1, "productSize": 0, "deltaTm": 0, "eligiblePairs": 1, "exactChecked": 1, "exactRefused": 0 }, "ranking": { "tmDeviation": 58.83275800549802, "lengthDeviation": 0.0, "deltaTm": 3.315848320899363, "total": 62.148606326397385 }, "structures": [ { "kind": "forward hairpin", "evaluated": false, "dG37": null, "detail": "Not evaluated in this mapping-only historical fixture." }, { "kind": "reverse hairpin", "evaluated": false, "dG37": null, "detail": "Not evaluated in this mapping-only historical fixture." }, { "kind": "forward self-dimer", "evaluated": false, "dG37": null, "detail": "Not evaluated in this mapping-only historical fixture." }, { "kind": "reverse self-dimer", "evaluated": false, "dG37": null, "detail": "Not evaluated in this mapping-only historical fixture." }, { "kind": "cross-dimer", "evaluated": false, "dG37": null, "detail": "Not evaluated in this mapping-only historical fixture." } ], "limitations": [ "Historical fixture for exact footprint mapping; no amplification evidence." ] }, "witness": { "templateHash": "2c1cd4c2d47f7adf4babec903955a5d96bd51e66424db6714075ea54795c531e", "templateLength": 34, "topology": "linear", "coordinates": "1-based-inclusive-5prime-to-3prime", "forward": { "start": 7, "end": 14, "strand": "+", "length": 8 }, "reverse": { "start": 31, "end": 24, "strand": "-", "length": 8 }, "productId": "+:7:14|-:31:24", "method": "exact-pair-v1" } } ], "sequenceWorkspace": { "v": 1, "text": ">mapping alphabet=dna\nGATCAAAGCTTGACCTTTAGCACTTGGATCCCCA\n", "templateText": "", "state": { "alphabet": "dna" }, "sourceContext": "" } }, "expected": { "readable": true, "features": [ { "direction": "forward", "key": "primer_bind", "strand": "+", "location": "7..14", "parts": [ { "start": 7, "end": 14 } ], "extracted": "AGCTTGAC", "annealing": "AGCTTGAC", "tail": "", "meaning": "recorded-exact-template-site" }, { "direction": "reverse", "key": "primer_bind", "strand": "-", "location": "complement(24..31)", "parts": [ { "start": 24, "end": 31 } ], "extracted": "GGATCCAA", "annealing": "GGATCCAA", "tail": "", "meaning": "recorded-exact-template-site" } ], "placedSets": 1, "skippedSets": 0, "pcrFeatures": 0 }, "note": "" }, { "id": "sets-forward-origin-wrap", "input": { "v": 2, "app": "sequence-toolkit", "residues": "GATCAAAGCTTGACCTTTAGCACTTGGATCCCCA", "alphabet": "dna-circular", "name": "Independent handoff fixture", "primerSets": [ { "v": 1, "id": "pair-1", "label": "Recorded mapping pair", "createdAt": "2026-10-11T00:00:00.000Z", "notes": "Independent coordinate fixture", "forward": { "annealing": "CCCAGATC", "tail": "" }, "reverse": { "annealing": "AGTGCTAA", "tail": "" }, "conditions": { "oligo_nM": 250, "na_mM": 50, "mg_mM": 0, "dntp_mM": 0, "model": "primer-excess", "saltCorrection": "owczarzy-2004" }, "design": { "method": "bounded-flanks-v1", "target": { "start": 9, "end": 16 }, "settings": { "target": { "start": 9, "end": 16 }, "excluded": [], "forwardTail": "", "reverseTail": "", "conditions": { "oligo_nM": 250, "na_mM": 50, "mg_mM": 0, "dntp_mM": 0, "model": "primer-excess", "saltCorrection": "owczarzy-2004" }, "flank": 0, "minLength": 8, "maxLength": 8, "targetLength": 8, "minTm": 0, "maxTm": 100, "targetTm": 40, "maxDeltaTm": 30, "minGc": 0, "maxGc": 100, "minProduct": 24, "maxProduct": 34 }, "capped": false, "counts": { "windows": 2, "boundary": 0, "excluded": 0, "gc": 0, "tm": 0, "validForward": 1, "validReverse": 1, "productSize": 0, "deltaTm": 0, "eligiblePairs": 1, "exactChecked": 1, "exactRefused": 0 }, "ranking": { "tmDeviation": 58.83275800549802, "lengthDeviation": 0.0, "deltaTm": 3.315848320899363, "total": 62.148606326397385 }, "structures": [ { "kind": "forward hairpin", "evaluated": false, "dG37": null, "detail": "Not evaluated in this mapping-only historical fixture." }, { "kind": "reverse hairpin", "evaluated": false, "dG37": null, "detail": "Not evaluated in this mapping-only historical fixture." }, { "kind": "forward self-dimer", "evaluated": false, "dG37": null, "detail": "Not evaluated in this mapping-only historical fixture." }, { "kind": "reverse self-dimer", "evaluated": false, "dG37": null, "detail": "Not evaluated in this mapping-only historical fixture." }, { "kind": "cross-dimer", "evaluated": false, "dG37": null, "detail": "Not evaluated in this mapping-only historical fixture." } ], "limitations": [ "Historical fixture for exact footprint mapping; no amplification evidence." ] }, "witness": { "templateHash": "2c1cd4c2d47f7adf4babec903955a5d96bd51e66424db6714075ea54795c531e", "templateLength": 34, "topology": "circular", "coordinates": "1-based-inclusive-5prime-to-3prime", "forward": { "start": 31, "end": 4, "strand": "+", "length": 8 }, "reverse": { "start": 24, "end": 17, "strand": "-", "length": 8 }, "productId": "+:31:4|-:24:17", "method": "exact-pair-v1" } } ], "sequenceWorkspace": { "v": 1, "text": ">mapping alphabet=dna-circular\nGATCAAAGCTTGACCTTTAGCACTTGGATCCCCA\n", "templateText": "", "state": { "alphabet": "dna-circular" }, "sourceContext": "" } }, "expected": { "readable": true, "features": [ { "direction": "forward", "key": "primer_bind", "strand": "+", "location": "join(31..34,1..4)", "parts": [ { "start": 31, "end": 34 }, { "start": 1, "end": 4 } ], "extracted": "CCCAGATC", "annealing": "CCCAGATC", "tail": "", "meaning": "recorded-exact-template-site" }, { "direction": "reverse", "key": "primer_bind", "strand": "-", "location": "complement(17..24)", "parts": [ { "start": 17, "end": 24 } ], "extracted": "AGTGCTAA", "annealing": "AGTGCTAA", "tail": "", "meaning": "recorded-exact-template-site" } ], "placedSets": 1, "skippedSets": 0, "pcrFeatures": 0 }, "note": "" }, { "id": "sets-reverse-origin-wrap", "input": { "v": 2, "app": "sequence-toolkit", "residues": "GATCAAAGCTTGACCTTTAGCACTTGGATCCCCA", "alphabet": "dna-circular", "name": "Independent handoff fixture", "primerSets": [ { "v": 1, "id": "pair-1", "label": "Recorded mapping pair", "createdAt": "2026-10-11T00:00:00.000Z", "notes": "Independent coordinate fixture", "forward": { "annealing": "TTGACCTT", "tail": "" }, "reverse": { "annealing": "GATCTGGG", "tail": "" }, "conditions": { "oligo_nM": 250, "na_mM": 50, "mg_mM": 0, "dntp_mM": 0, "model": "primer-excess", "saltCorrection": "owczarzy-2004" }, "design": { "method": "bounded-flanks-v1", "target": { "start": 9, "end": 16 }, "settings": { "target": { "start": 9, "end": 16 }, "excluded": [], "forwardTail": "", "reverseTail": "", "conditions": { "oligo_nM": 250, "na_mM": 50, "mg_mM": 0, "dntp_mM": 0, "model": "primer-excess", "saltCorrection": "owczarzy-2004" }, "flank": 0, "minLength": 8, "maxLength": 8, "targetLength": 8, "minTm": 0, "maxTm": 100, "targetTm": 40, "maxDeltaTm": 30, "minGc": 0, "maxGc": 100, "minProduct": 24, "maxProduct": 34 }, "capped": false, "counts": { "windows": 2, "boundary": 0, "excluded": 0, "gc": 0, "tm": 0, "validForward": 1, "validReverse": 1, "productSize": 0, "deltaTm": 0, "eligiblePairs": 1, "exactChecked": 1, "exactRefused": 0 }, "ranking": { "tmDeviation": 58.83275800549802, "lengthDeviation": 0.0, "deltaTm": 3.315848320899363, "total": 62.148606326397385 }, "structures": [ { "kind": "forward hairpin", "evaluated": false, "dG37": null, "detail": "Not evaluated in this mapping-only historical fixture." }, { "kind": "reverse hairpin", "evaluated": false, "dG37": null, "detail": "Not evaluated in this mapping-only historical fixture." }, { "kind": "forward self-dimer", "evaluated": false, "dG37": null, "detail": "Not evaluated in this mapping-only historical fixture." }, { "kind": "reverse self-dimer", "evaluated": false, "dG37": null, "detail": "Not evaluated in this mapping-only historical fixture." }, { "kind": "cross-dimer", "evaluated": false, "dG37": null, "detail": "Not evaluated in this mapping-only historical fixture." } ], "limitations": [ "Historical fixture for exact footprint mapping; no amplification evidence." ] }, "witness": { "templateHash": "2c1cd4c2d47f7adf4babec903955a5d96bd51e66424db6714075ea54795c531e", "templateLength": 34, "topology": "circular", "coordinates": "1-based-inclusive-5prime-to-3prime", "forward": { "start": 10, "end": 17, "strand": "+", "length": 8 }, "reverse": { "start": 4, "end": 31, "strand": "-", "length": 8 }, "productId": "+:10:17|-:4:31", "method": "exact-pair-v1" } } ], "sequenceWorkspace": { "v": 1, "text": ">mapping alphabet=dna-circular\nGATCAAAGCTTGACCTTTAGCACTTGGATCCCCA\n", "templateText": "", "state": { "alphabet": "dna-circular" }, "sourceContext": "" } }, "expected": { "readable": true, "features": [ { "direction": "forward", "key": "primer_bind", "strand": "+", "location": "10..17", "parts": [ { "start": 10, "end": 17 } ], "extracted": "TTGACCTT", "annealing": "TTGACCTT", "tail": "", "meaning": "recorded-exact-template-site" }, { "direction": "reverse", "key": "primer_bind", "strand": "-", "location": "complement(join(31..34,1..4))", "parts": [ { "start": 31, "end": 34 }, { "start": 1, "end": 4 } ], "extracted": "GATCTGGG", "annealing": "GATCTGGG", "tail": "", "meaning": "recorded-exact-template-site" } ], "placedSets": 1, "skippedSets": 0, "pcrFeatures": 0 }, "note": "" }, { "id": "sets-tails-excluded-from-footprints", "input": { "v": 2, "app": "sequence-toolkit", "residues": "GATCAAAGCTTGACCTTTAGCACTTGGATCCCCA", "alphabet": "dna", "name": "Independent handoff fixture", "primerSets": [ { "v": 1, "id": "pair-1", "label": "Recorded mapping pair", "createdAt": "2026-10-11T00:00:00.000Z", "notes": "Independent coordinate fixture", "forward": { "annealing": "AGCTTGAC", "tail": "ACGTA" }, "reverse": { "annealing": "GGATCCAA", "tail": "GATCCT" }, "conditions": { "oligo_nM": 250, "na_mM": 50, "mg_mM": 0, "dntp_mM": 0, "model": "primer-excess", "saltCorrection": "owczarzy-2004" }, "design": { "method": "bounded-flanks-v1", "target": { "start": 9, "end": 16 }, "settings": { "target": { "start": 9, "end": 16 }, "excluded": [], "forwardTail": "ACGTA", "reverseTail": "GATCCT", "conditions": { "oligo_nM": 250, "na_mM": 50, "mg_mM": 0, "dntp_mM": 0, "model": "primer-excess", "saltCorrection": "owczarzy-2004" }, "flank": 0, "minLength": 8, "maxLength": 8, "targetLength": 8, "minTm": 0, "maxTm": 100, "targetTm": 40, "maxDeltaTm": 30, "minGc": 0, "maxGc": 100, "minProduct": 24, "maxProduct": 45 }, "capped": false, "counts": { "windows": 2, "boundary": 0, "excluded": 0, "gc": 0, "tm": 0, "validForward": 1, "validReverse": 1, "productSize": 0, "deltaTm": 0, "eligiblePairs": 1, "exactChecked": 1, "exactRefused": 0 }, "ranking": { "tmDeviation": 58.83275800549802, "lengthDeviation": 0.0, "deltaTm": 3.315848320899363, "total": 62.148606326397385 }, "structures": [ { "kind": "forward hairpin", "evaluated": false, "dG37": null, "detail": "Not evaluated in this mapping-only historical fixture." }, { "kind": "reverse hairpin", "evaluated": false, "dG37": null, "detail": "Not evaluated in this mapping-only historical fixture." }, { "kind": "forward self-dimer", "evaluated": false, "dG37": null, "detail": "Not evaluated in this mapping-only historical fixture." }, { "kind": "reverse self-dimer", "evaluated": false, "dG37": null, "detail": "Not evaluated in this mapping-only historical fixture." }, { "kind": "cross-dimer", "evaluated": false, "dG37": null, "detail": "Not evaluated in this mapping-only historical fixture." } ], "limitations": [ "Historical fixture for exact footprint mapping; no amplification evidence." ] }, "witness": { "templateHash": "2c1cd4c2d47f7adf4babec903955a5d96bd51e66424db6714075ea54795c531e", "templateLength": 34, "topology": "linear", "coordinates": "1-based-inclusive-5prime-to-3prime", "forward": { "start": 7, "end": 14, "strand": "+", "length": 8 }, "reverse": { "start": 31, "end": 24, "strand": "-", "length": 8 }, "productId": "+:7:14|-:31:24", "method": "exact-pair-v1" } } ], "sequenceWorkspace": { "v": 1, "text": ">mapping alphabet=dna\nGATCAAAGCTTGACCTTTAGCACTTGGATCCCCA\n", "templateText": "", "state": { "alphabet": "dna" }, "sourceContext": "" } }, "expected": { "readable": true, "features": [ { "direction": "forward", "key": "primer_bind", "strand": "+", "location": "7..14", "parts": [ { "start": 7, "end": 14 } ], "extracted": "AGCTTGAC", "annealing": "AGCTTGAC", "tail": "ACGTA", "meaning": "recorded-exact-template-site" }, { "direction": "reverse", "key": "primer_bind", "strand": "-", "location": "complement(24..31)", "parts": [ { "start": 24, "end": 31 } ], "extracted": "GGATCCAA", "annealing": "GGATCCAA", "tail": "GATCCT", "meaning": "recorded-exact-template-site" } ], "placedSets": 1, "skippedSets": 0, "pcrFeatures": 0 }, "note": "" }, { "id": "sets-hash-mismatch", "input": { "v": 2, "app": "sequence-toolkit", "residues": "GATCAAAGCTTGACCTTTAGCACTTGGATCCCCA", "alphabet": "dna", "name": "Independent handoff fixture", "primerSets": [ { "v": 1, "id": "pair-1", "label": "Recorded mapping pair", "createdAt": "2026-10-11T00:00:00.000Z", "notes": "Independent coordinate fixture", "forward": { "annealing": "AGCTTGAC", "tail": "" }, "reverse": { "annealing": "GGATCCAA", "tail": "" }, "conditions": { "oligo_nM": 250, "na_mM": 50, "mg_mM": 0, "dntp_mM": 0, "model": "primer-excess", "saltCorrection": "owczarzy-2004" }, "design": { "method": "bounded-flanks-v1", "target": { "start": 9, "end": 16 }, "settings": { "target": { "start": 9, "end": 16 }, "excluded": [], "forwardTail": "", "reverseTail": "", "conditions": { "oligo_nM": 250, "na_mM": 50, "mg_mM": 0, "dntp_mM": 0, "model": "primer-excess", "saltCorrection": "owczarzy-2004" }, "flank": 0, "minLength": 8, "maxLength": 8, "targetLength": 8, "minTm": 0, "maxTm": 100, "targetTm": 40, "maxDeltaTm": 30, "minGc": 0, "maxGc": 100, "minProduct": 24, "maxProduct": 34 }, "capped": false, "counts": { "windows": 2, "boundary": 0, "excluded": 0, "gc": 0, "tm": 0, "validForward": 1, "validReverse": 1, "productSize": 0, "deltaTm": 0, "eligiblePairs": 1, "exactChecked": 1, "exactRefused": 0 }, "ranking": { "tmDeviation": 58.83275800549802, "lengthDeviation": 0.0, "deltaTm": 3.315848320899363, "total": 62.148606326397385 }, "structures": [ { "kind": "forward hairpin", "evaluated": false, "dG37": null, "detail": "Not evaluated in this mapping-only historical fixture." }, { "kind": "reverse hairpin", "evaluated": false, "dG37": null, "detail": "Not evaluated in this mapping-only historical fixture." }, { "kind": "forward self-dimer", "evaluated": false, "dG37": null, "detail": "Not evaluated in this mapping-only historical fixture." }, { "kind": "reverse self-dimer", "evaluated": false, "dG37": null, "detail": "Not evaluated in this mapping-only historical fixture." }, { "kind": "cross-dimer", "evaluated": false, "dG37": null, "detail": "Not evaluated in this mapping-only historical fixture." } ], "limitations": [ "Historical fixture for exact footprint mapping; no amplification evidence." ] }, "witness": { "templateHash": "0000000000000000000000000000000000000000000000000000000000000000", "templateLength": 34, "topology": "linear", "coordinates": "1-based-inclusive-5prime-to-3prime", "forward": { "start": 7, "end": 14, "strand": "+", "length": 8 }, "reverse": { "start": 31, "end": 24, "strand": "-", "length": 8 }, "productId": "+:7:14|-:31:24", "method": "exact-pair-v1" } } ], "sequenceWorkspace": { "v": 1, "text": ">mapping alphabet=dna\nGATCAAAGCTTGACCTTTAGCACTTGGATCCCCA\n", "templateText": "", "state": { "alphabet": "dna" }, "sourceContext": "" } }, "expected": { "readable": true, "features": [], "placedSets": 0, "skippedSets": 1, "pcrFeatures": 0 }, "note": "" }, { "id": "sets-topology-mismatch", "input": { "v": 2, "app": "sequence-toolkit", "residues": "GATCAAAGCTTGACCTTTAGCACTTGGATCCCCA", "alphabet": "dna", "name": "Independent handoff fixture", "primerSets": [ { "v": 1, "id": "pair-1", "label": "Recorded mapping pair", "createdAt": "2026-10-11T00:00:00.000Z", "notes": "Independent coordinate fixture", "forward": { "annealing": "AGCTTGAC", "tail": "" }, "reverse": { "annealing": "GGATCCAA", "tail": "" }, "conditions": { "oligo_nM": 250, "na_mM": 50, "mg_mM": 0, "dntp_mM": 0, "model": "primer-excess", "saltCorrection": "owczarzy-2004" }, "design": { "method": "bounded-flanks-v1", "target": { "start": 9, "end": 16 }, "settings": { "target": { "start": 9, "end": 16 }, "excluded": [], "forwardTail": "", "reverseTail": "", "conditions": { "oligo_nM": 250, "na_mM": 50, "mg_mM": 0, "dntp_mM": 0, "model": "primer-excess", "saltCorrection": "owczarzy-2004" }, "flank": 0, "minLength": 8, "maxLength": 8, "targetLength": 8, "minTm": 0, "maxTm": 100, "targetTm": 40, "maxDeltaTm": 30, "minGc": 0, "maxGc": 100, "minProduct": 24, "maxProduct": 34 }, "capped": false, "counts": { "windows": 2, "boundary": 0, "excluded": 0, "gc": 0, "tm": 0, "validForward": 1, "validReverse": 1, "productSize": 0, "deltaTm": 0, "eligiblePairs": 1, "exactChecked": 1, "exactRefused": 0 }, "ranking": { "tmDeviation": 58.83275800549802, "lengthDeviation": 0.0, "deltaTm": 3.315848320899363, "total": 62.148606326397385 }, "structures": [ { "kind": "forward hairpin", "evaluated": false, "dG37": null, "detail": "Not evaluated in this mapping-only historical fixture." }, { "kind": "reverse hairpin", "evaluated": false, "dG37": null, "detail": "Not evaluated in this mapping-only historical fixture." }, { "kind": "forward self-dimer", "evaluated": false, "dG37": null, "detail": "Not evaluated in this mapping-only historical fixture." }, { "kind": "reverse self-dimer", "evaluated": false, "dG37": null, "detail": "Not evaluated in this mapping-only historical fixture." }, { "kind": "cross-dimer", "evaluated": false, "dG37": null, "detail": "Not evaluated in this mapping-only historical fixture." } ], "limitations": [ "Historical fixture for exact footprint mapping; no amplification evidence." ] }, "witness": { "templateHash": "2c1cd4c2d47f7adf4babec903955a5d96bd51e66424db6714075ea54795c531e", "templateLength": 34, "topology": "circular", "coordinates": "1-based-inclusive-5prime-to-3prime", "forward": { "start": 7, "end": 14, "strand": "+", "length": 8 }, "reverse": { "start": 31, "end": 24, "strand": "-", "length": 8 }, "productId": "+:7:14|-:31:24", "method": "exact-pair-v1" } } ], "sequenceWorkspace": { "v": 1, "text": ">mapping alphabet=dna\nGATCAAAGCTTGACCTTTAGCACTTGGATCCCCA\n", "templateText": "", "state": { "alphabet": "dna" }, "sourceContext": "" } }, "expected": { "readable": true, "features": [], "placedSets": 0, "skippedSets": 1, "pcrFeatures": 0 }, "note": "" }, { "id": "sets-length-mismatch", "input": { "v": 2, "app": "sequence-toolkit", "residues": "GATCAAAGCTTGACCTTTAGCACTTGGATCCCCA", "alphabet": "dna", "name": "Independent handoff fixture", "primerSets": [ { "v": 1, "id": "pair-1", "label": "Recorded mapping pair", "createdAt": "2026-10-11T00:00:00.000Z", "notes": "Independent coordinate fixture", "forward": { "annealing": "AGCTTGAC", "tail": "" }, "reverse": { "annealing": "GGATCCAA", "tail": "" }, "conditions": { "oligo_nM": 250, "na_mM": 50, "mg_mM": 0, "dntp_mM": 0, "model": "primer-excess", "saltCorrection": "owczarzy-2004" }, "design": { "method": "bounded-flanks-v1", "target": { "start": 9, "end": 16 }, "settings": { "target": { "start": 9, "end": 16 }, "excluded": [], "forwardTail": "", "reverseTail": "", "conditions": { "oligo_nM": 250, "na_mM": 50, "mg_mM": 0, "dntp_mM": 0, "model": "primer-excess", "saltCorrection": "owczarzy-2004" }, "flank": 0, "minLength": 8, "maxLength": 8, "targetLength": 8, "minTm": 0, "maxTm": 100, "targetTm": 40, "maxDeltaTm": 30, "minGc": 0, "maxGc": 100, "minProduct": 24, "maxProduct": 34 }, "capped": false, "counts": { "windows": 2, "boundary": 0, "excluded": 0, "gc": 0, "tm": 0, "validForward": 1, "validReverse": 1, "productSize": 0, "deltaTm": 0, "eligiblePairs": 1, "exactChecked": 1, "exactRefused": 0 }, "ranking": { "tmDeviation": 58.83275800549802, "lengthDeviation": 0.0, "deltaTm": 3.315848320899363, "total": 62.148606326397385 }, "structures": [ { "kind": "forward hairpin", "evaluated": false, "dG37": null, "detail": "Not evaluated in this mapping-only historical fixture." }, { "kind": "reverse hairpin", "evaluated": false, "dG37": null, "detail": "Not evaluated in this mapping-only historical fixture." }, { "kind": "forward self-dimer", "evaluated": false, "dG37": null, "detail": "Not evaluated in this mapping-only historical fixture." }, { "kind": "reverse self-dimer", "evaluated": false, "dG37": null, "detail": "Not evaluated in this mapping-only historical fixture." }, { "kind": "cross-dimer", "evaluated": false, "dG37": null, "detail": "Not evaluated in this mapping-only historical fixture." } ], "limitations": [ "Historical fixture for exact footprint mapping; no amplification evidence." ] }, "witness": { "templateHash": "2c1cd4c2d47f7adf4babec903955a5d96bd51e66424db6714075ea54795c531e", "templateLength": 35, "topology": "linear", "coordinates": "1-based-inclusive-5prime-to-3prime", "forward": { "start": 7, "end": 14, "strand": "+", "length": 8 }, "reverse": { "start": 31, "end": 24, "strand": "-", "length": 8 }, "productId": "+:7:14|-:31:24", "method": "exact-pair-v1" } } ], "sequenceWorkspace": { "v": 1, "text": ">mapping alphabet=dna\nGATCAAAGCTTGACCTTTAGCACTTGGATCCCCA\n", "templateText": "", "state": { "alphabet": "dna" }, "sourceContext": "" } }, "expected": { "readable": true, "features": [], "placedSets": 0, "skippedSets": 1, "pcrFeatures": 0 }, "note": "" }, { "id": "sets-distinct-identities-same-coordinates", "input": { "v": 2, "app": "sequence-toolkit", "residues": "GATCAAAGCTTGACCTTTAGCACTTGGATCCCCA", "alphabet": "dna", "name": "Independent handoff fixture", "primerSets": [ { "v": 1, "id": "pair-1", "label": "Recorded mapping pair", "createdAt": "2026-10-11T00:00:00.000Z", "notes": "Independent coordinate fixture", "forward": { "annealing": "AGCTTGAC", "tail": "" }, "reverse": { "annealing": "GGATCCAA", "tail": "" }, "conditions": { "oligo_nM": 250, "na_mM": 50, "mg_mM": 0, "dntp_mM": 0, "model": "primer-excess", "saltCorrection": "owczarzy-2004" }, "design": { "method": "bounded-flanks-v1", "target": { "start": 9, "end": 16 }, "settings": { "target": { "start": 9, "end": 16 }, "excluded": [], "forwardTail": "", "reverseTail": "", "conditions": { "oligo_nM": 250, "na_mM": 50, "mg_mM": 0, "dntp_mM": 0, "model": "primer-excess", "saltCorrection": "owczarzy-2004" }, "flank": 0, "minLength": 8, "maxLength": 8, "targetLength": 8, "minTm": 0, "maxTm": 100, "targetTm": 40, "maxDeltaTm": 30, "minGc": 0, "maxGc": 100, "minProduct": 24, "maxProduct": 34 }, "capped": false, "counts": { "windows": 2, "boundary": 0, "excluded": 0, "gc": 0, "tm": 0, "validForward": 1, "validReverse": 1, "productSize": 0, "deltaTm": 0, "eligiblePairs": 1, "exactChecked": 1, "exactRefused": 0 }, "ranking": { "tmDeviation": 58.83275800549802, "lengthDeviation": 0.0, "deltaTm": 3.315848320899363, "total": 62.148606326397385 }, "structures": [ { "kind": "forward hairpin", "evaluated": false, "dG37": null, "detail": "Not evaluated in this mapping-only historical fixture." }, { "kind": "reverse hairpin", "evaluated": false, "dG37": null, "detail": "Not evaluated in this mapping-only historical fixture." }, { "kind": "forward self-dimer", "evaluated": false, "dG37": null, "detail": "Not evaluated in this mapping-only historical fixture." }, { "kind": "reverse self-dimer", "evaluated": false, "dG37": null, "detail": "Not evaluated in this mapping-only historical fixture." }, { "kind": "cross-dimer", "evaluated": false, "dG37": null, "detail": "Not evaluated in this mapping-only historical fixture." } ], "limitations": [ "Historical fixture for exact footprint mapping; no amplification evidence." ] }, "witness": { "templateHash": "2c1cd4c2d47f7adf4babec903955a5d96bd51e66424db6714075ea54795c531e", "templateLength": 34, "topology": "linear", "coordinates": "1-based-inclusive-5prime-to-3prime", "forward": { "start": 7, "end": 14, "strand": "+", "length": 8 }, "reverse": { "start": 31, "end": 24, "strand": "-", "length": 8 }, "productId": "+:7:14|-:31:24", "method": "exact-pair-v1" } }, { "v": 1, "id": "pair-2", "label": "Recorded mapping pair", "createdAt": "2026-10-11T00:00:00.000Z", "notes": "Independent coordinate fixture", "forward": { "annealing": "AGCTTGAC", "tail": "" }, "reverse": { "annealing": "GGATCCAA", "tail": "" }, "conditions": { "oligo_nM": 250, "na_mM": 50, "mg_mM": 0, "dntp_mM": 0, "model": "primer-excess", "saltCorrection": "owczarzy-2004" }, "design": { "method": "bounded-flanks-v1", "target": { "start": 9, "end": 16 }, "settings": { "target": { "start": 9, "end": 16 }, "excluded": [], "forwardTail": "", "reverseTail": "", "conditions": { "oligo_nM": 250, "na_mM": 50, "mg_mM": 0, "dntp_mM": 0, "model": "primer-excess", "saltCorrection": "owczarzy-2004" }, "flank": 0, "minLength": 8, "maxLength": 8, "targetLength": 8, "minTm": 0, "maxTm": 100, "targetTm": 40, "maxDeltaTm": 30, "minGc": 0, "maxGc": 100, "minProduct": 24, "maxProduct": 34 }, "capped": false, "counts": { "windows": 2, "boundary": 0, "excluded": 0, "gc": 0, "tm": 0, "validForward": 1, "validReverse": 1, "productSize": 0, "deltaTm": 0, "eligiblePairs": 1, "exactChecked": 1, "exactRefused": 0 }, "ranking": { "tmDeviation": 58.83275800549802, "lengthDeviation": 0.0, "deltaTm": 3.315848320899363, "total": 62.148606326397385 }, "structures": [ { "kind": "forward hairpin", "evaluated": false, "dG37": null, "detail": "Not evaluated in this mapping-only historical fixture." }, { "kind": "reverse hairpin", "evaluated": false, "dG37": null, "detail": "Not evaluated in this mapping-only historical fixture." }, { "kind": "forward self-dimer", "evaluated": false, "dG37": null, "detail": "Not evaluated in this mapping-only historical fixture." }, { "kind": "reverse self-dimer", "evaluated": false, "dG37": null, "detail": "Not evaluated in this mapping-only historical fixture." }, { "kind": "cross-dimer", "evaluated": false, "dG37": null, "detail": "Not evaluated in this mapping-only historical fixture." } ], "limitations": [ "Historical fixture for exact footprint mapping; no amplification evidence." ] }, "witness": { "templateHash": "2c1cd4c2d47f7adf4babec903955a5d96bd51e66424db6714075ea54795c531e", "templateLength": 34, "topology": "linear", "coordinates": "1-based-inclusive-5prime-to-3prime", "forward": { "start": 7, "end": 14, "strand": "+", "length": 8 }, "reverse": { "start": 31, "end": 24, "strand": "-", "length": 8 }, "productId": "+:7:14|-:31:24", "method": "exact-pair-v1" }, "source": { "ref": "mine:construct/parent", "versionId": "version-1", "versionLabel": "Original", "contentHash": "1111111111111111111111111111111111111111111111111111111111111111", "entryId": "original-pair" }, "importedFrom": { "entryId": "imported-pair", "fileName": "pair.json", "fileHash": "2222222222222222222222222222222222222222222222222222222222222222" } } ], "sequenceWorkspace": { "v": 1, "text": ">mapping alphabet=dna\nGATCAAAGCTTGACCTTTAGCACTTGGATCCCCA\n", "templateText": "", "state": { "alphabet": "dna" }, "sourceContext": "" } }, "expected": { "readable": true, "features": [ { "direction": "forward", "key": "primer_bind", "strand": "+", "location": "7..14", "parts": [ { "start": 7, "end": 14 } ], "extracted": "AGCTTGAC", "annealing": "AGCTTGAC", "tail": "", "meaning": "recorded-exact-template-site" }, { "direction": "reverse", "key": "primer_bind", "strand": "-", "location": "complement(24..31)", "parts": [ { "start": 24, "end": 31 } ], "extracted": "GGATCCAA", "annealing": "GGATCCAA", "tail": "", "meaning": "recorded-exact-template-site" }, { "direction": "forward", "key": "primer_bind", "strand": "+", "location": "7..14", "parts": [ { "start": 7, "end": 14 } ], "extracted": "AGCTTGAC", "annealing": "AGCTTGAC", "tail": "", "meaning": "recorded-exact-template-site" }, { "direction": "reverse", "key": "primer_bind", "strand": "-", "location": "complement(24..31)", "parts": [ { "start": 24, "end": 31 } ], "extracted": "GGATCCAA", "annealing": "GGATCCAA", "tail": "", "meaning": "recorded-exact-template-site" } ], "placedSets": 2, "skippedSets": 0, "pcrFeatures": 0 }, "note": "" }, { "id": "sets-multiple-valid", "input": { "v": 2, "app": "sequence-toolkit", "residues": "GATCAAAGCTTGACCTTTAGCACTTGGATCCCCA", "alphabet": "dna", "name": "Independent handoff fixture", "primerSets": [ { "v": 1, "id": "pair-1", "label": "Recorded mapping pair", "createdAt": "2026-10-11T00:00:00.000Z", "notes": "Independent coordinate fixture", "forward": { "annealing": "AGCTTGAC", "tail": "" }, "reverse": { "annealing": "GGATCCAA", "tail": "" }, "conditions": { "oligo_nM": 250, "na_mM": 50, "mg_mM": 0, "dntp_mM": 0, "model": "primer-excess", "saltCorrection": "owczarzy-2004" }, "design": { "method": "bounded-flanks-v1", "target": { "start": 9, "end": 16 }, "settings": { "target": { "start": 9, "end": 16 }, "excluded": [], "forwardTail": "", "reverseTail": "", "conditions": { "oligo_nM": 250, "na_mM": 50, "mg_mM": 0, "dntp_mM": 0, "model": "primer-excess", "saltCorrection": "owczarzy-2004" }, "flank": 0, "minLength": 8, "maxLength": 8, "targetLength": 8, "minTm": 0, "maxTm": 100, "targetTm": 40, "maxDeltaTm": 30, "minGc": 0, "maxGc": 100, "minProduct": 24, "maxProduct": 34 }, "capped": false, "counts": { "windows": 2, "boundary": 0, "excluded": 0, "gc": 0, "tm": 0, "validForward": 1, "validReverse": 1, "productSize": 0, "deltaTm": 0, "eligiblePairs": 1, "exactChecked": 1, "exactRefused": 0 }, "ranking": { "tmDeviation": 58.83275800549802, "lengthDeviation": 0.0, "deltaTm": 3.315848320899363, "total": 62.148606326397385 }, "structures": [ { "kind": "forward hairpin", "evaluated": false, "dG37": null, "detail": "Not evaluated in this mapping-only historical fixture." }, { "kind": "reverse hairpin", "evaluated": false, "dG37": null, "detail": "Not evaluated in this mapping-only historical fixture." }, { "kind": "forward self-dimer", "evaluated": false, "dG37": null, "detail": "Not evaluated in this mapping-only historical fixture." }, { "kind": "reverse self-dimer", "evaluated": false, "dG37": null, "detail": "Not evaluated in this mapping-only historical fixture." }, { "kind": "cross-dimer", "evaluated": false, "dG37": null, "detail": "Not evaluated in this mapping-only historical fixture." } ], "limitations": [ "Historical fixture for exact footprint mapping; no amplification evidence." ] }, "witness": { "templateHash": "2c1cd4c2d47f7adf4babec903955a5d96bd51e66424db6714075ea54795c531e", "templateLength": 34, "topology": "linear", "coordinates": "1-based-inclusive-5prime-to-3prime", "forward": { "start": 7, "end": 14, "strand": "+", "length": 8 }, "reverse": { "start": 31, "end": 24, "strand": "-", "length": 8 }, "productId": "+:7:14|-:31:24", "method": "exact-pair-v1" } }, { "v": 1, "id": "pair-3", "label": "Recorded mapping pair", "createdAt": "2026-10-11T00:00:00.000Z", "notes": "Independent coordinate fixture", "forward": { "annealing": "GCTTGACC", "tail": "" }, "reverse": { "annealing": "GGGATCCA", "tail": "" }, "conditions": { "oligo_nM": 250, "na_mM": 50, "mg_mM": 0, "dntp_mM": 0, "model": "primer-excess", "saltCorrection": "owczarzy-2004" }, "design": { "method": "bounded-flanks-v1", "target": { "start": 9, "end": 16 }, "settings": { "target": { "start": 9, "end": 16 }, "excluded": [], "forwardTail": "", "reverseTail": "", "conditions": { "oligo_nM": 250, "na_mM": 50, "mg_mM": 0, "dntp_mM": 0, "model": "primer-excess", "saltCorrection": "owczarzy-2004" }, "flank": 0, "minLength": 8, "maxLength": 8, "targetLength": 8, "minTm": 0, "maxTm": 100, "targetTm": 40, "maxDeltaTm": 30, "minGc": 0, "maxGc": 100, "minProduct": 24, "maxProduct": 34 }, "capped": false, "counts": { "windows": 2, "boundary": 0, "excluded": 0, "gc": 0, "tm": 0, "validForward": 1, "validReverse": 1, "productSize": 0, "deltaTm": 0, "eligiblePairs": 1, "exactChecked": 1, "exactRefused": 0 }, "ranking": { "tmDeviation": 58.83275800549802, "lengthDeviation": 0.0, "deltaTm": 3.315848320899363, "total": 62.148606326397385 }, "structures": [ { "kind": "forward hairpin", "evaluated": false, "dG37": null, "detail": "Not evaluated in this mapping-only historical fixture." }, { "kind": "reverse hairpin", "evaluated": false, "dG37": null, "detail": "Not evaluated in this mapping-only historical fixture." }, { "kind": "forward self-dimer", "evaluated": false, "dG37": null, "detail": "Not evaluated in this mapping-only historical fixture." }, { "kind": "reverse self-dimer", "evaluated": false, "dG37": null, "detail": "Not evaluated in this mapping-only historical fixture." }, { "kind": "cross-dimer", "evaluated": false, "dG37": null, "detail": "Not evaluated in this mapping-only historical fixture." } ], "limitations": [ "Historical fixture for exact footprint mapping; no amplification evidence." ] }, "witness": { "templateHash": "2c1cd4c2d47f7adf4babec903955a5d96bd51e66424db6714075ea54795c531e", "templateLength": 34, "topology": "linear", "coordinates": "1-based-inclusive-5prime-to-3prime", "forward": { "start": 8, "end": 15, "strand": "+", "length": 8 }, "reverse": { "start": 32, "end": 25, "strand": "-", "length": 8 }, "productId": "+:8:15|-:32:25", "method": "exact-pair-v1" } } ], "sequenceWorkspace": { "v": 1, "text": ">mapping alphabet=dna\nGATCAAAGCTTGACCTTTAGCACTTGGATCCCCA\n", "templateText": "", "state": { "alphabet": "dna" }, "sourceContext": "" } }, "expected": { "readable": true, "features": [ { "direction": "forward", "key": "primer_bind", "strand": "+", "location": "7..14", "parts": [ { "start": 7, "end": 14 } ], "extracted": "AGCTTGAC", "annealing": "AGCTTGAC", "tail": "", "meaning": "recorded-exact-template-site" }, { "direction": "reverse", "key": "primer_bind", "strand": "-", "location": "complement(24..31)", "parts": [ { "start": 24, "end": 31 } ], "extracted": "GGATCCAA", "annealing": "GGATCCAA", "tail": "", "meaning": "recorded-exact-template-site" }, { "direction": "forward", "key": "primer_bind", "strand": "+", "location": "8..15", "parts": [ { "start": 8, "end": 15 } ], "extracted": "GCTTGACC", "annealing": "GCTTGACC", "tail": "", "meaning": "recorded-exact-template-site" }, { "direction": "reverse", "key": "primer_bind", "strand": "-", "location": "complement(25..32)", "parts": [ { "start": 25, "end": 32 } ], "extracted": "GGGATCCA", "annealing": "GGGATCCA", "tail": "", "meaning": "recorded-exact-template-site" } ], "placedSets": 2, "skippedSets": 0, "pcrFeatures": 0 }, "note": "" }, { "id": "sets-matching-hash-wrong-footprint", "input": { "v": 2, "app": "sequence-toolkit", "residues": "GATCAAAGCTTGACCTTTAGCACTTGGATCCCCA", "alphabet": "dna", "name": "Independent handoff fixture", "primerSets": [ { "v": 1, "id": "pair-1", "label": "Recorded mapping pair", "createdAt": "2026-10-11T00:00:00.000Z", "notes": "Independent coordinate fixture", "forward": { "annealing": "AAAAAAAA", "tail": "" }, "reverse": { "annealing": "GGATCCAA", "tail": "" }, "conditions": { "oligo_nM": 250, "na_mM": 50, "mg_mM": 0, "dntp_mM": 0, "model": "primer-excess", "saltCorrection": "owczarzy-2004" }, "design": { "method": "bounded-flanks-v1", "target": { "start": 9, "end": 16 }, "settings": { "target": { "start": 9, "end": 16 }, "excluded": [], "forwardTail": "", "reverseTail": "", "conditions": { "oligo_nM": 250, "na_mM": 50, "mg_mM": 0, "dntp_mM": 0, "model": "primer-excess", "saltCorrection": "owczarzy-2004" }, "flank": 0, "minLength": 8, "maxLength": 8, "targetLength": 8, "minTm": 0, "maxTm": 100, "targetTm": 40, "maxDeltaTm": 30, "minGc": 0, "maxGc": 100, "minProduct": 24, "maxProduct": 34 }, "capped": false, "counts": { "windows": 2, "boundary": 0, "excluded": 0, "gc": 0, "tm": 0, "validForward": 1, "validReverse": 1, "productSize": 0, "deltaTm": 0, "eligiblePairs": 1, "exactChecked": 1, "exactRefused": 0 }, "ranking": { "tmDeviation": 58.83275800549802, "lengthDeviation": 0.0, "deltaTm": 3.315848320899363, "total": 62.148606326397385 }, "structures": [ { "kind": "forward hairpin", "evaluated": false, "dG37": null, "detail": "Not evaluated in this mapping-only historical fixture." }, { "kind": "reverse hairpin", "evaluated": false, "dG37": null, "detail": "Not evaluated in this mapping-only historical fixture." }, { "kind": "forward self-dimer", "evaluated": false, "dG37": null, "detail": "Not evaluated in this mapping-only historical fixture." }, { "kind": "reverse self-dimer", "evaluated": false, "dG37": null, "detail": "Not evaluated in this mapping-only historical fixture." }, { "kind": "cross-dimer", "evaluated": false, "dG37": null, "detail": "Not evaluated in this mapping-only historical fixture." } ], "limitations": [ "Historical fixture for exact footprint mapping; no amplification evidence." ] }, "witness": { "templateHash": "2c1cd4c2d47f7adf4babec903955a5d96bd51e66424db6714075ea54795c531e", "templateLength": 34, "topology": "linear", "coordinates": "1-based-inclusive-5prime-to-3prime", "forward": { "start": 7, "end": 14, "strand": "+", "length": 8 }, "reverse": { "start": 31, "end": 24, "strand": "-", "length": 8 }, "productId": "+:7:14|-:31:24", "method": "exact-pair-v1" } } ], "sequenceWorkspace": { "v": 1, "text": ">mapping alphabet=dna\nGATCAAAGCTTGACCTTTAGCACTTGGATCCCCA\n", "templateText": "", "state": { "alphabet": "dna" }, "sourceContext": "" } }, "expected": { "readable": false, "refusal": "contradictory-witness" }, "note": "" }, { "id": "sets-inconsistent-length", "input": { "v": 2, "app": "sequence-toolkit", "residues": "GATCAAAGCTTGACCTTTAGCACTTGGATCCCCA", "alphabet": "dna", "name": "Independent handoff fixture", "primerSets": [ { "v": 1, "id": "pair-1", "label": "Recorded mapping pair", "createdAt": "2026-10-11T00:00:00.000Z", "notes": "Independent coordinate fixture", "forward": { "annealing": "AGCTTGAC", "tail": "" }, "reverse": { "annealing": "GGATCCAA", "tail": "" }, "conditions": { "oligo_nM": 250, "na_mM": 50, "mg_mM": 0, "dntp_mM": 0, "model": "primer-excess", "saltCorrection": "owczarzy-2004" }, "design": { "method": "bounded-flanks-v1", "target": { "start": 9, "end": 16 }, "settings": { "target": { "start": 9, "end": 16 }, "excluded": [], "forwardTail": "", "reverseTail": "", "conditions": { "oligo_nM": 250, "na_mM": 50, "mg_mM": 0, "dntp_mM": 0, "model": "primer-excess", "saltCorrection": "owczarzy-2004" }, "flank": 0, "minLength": 8, "maxLength": 8, "targetLength": 8, "minTm": 0, "maxTm": 100, "targetTm": 40, "maxDeltaTm": 30, "minGc": 0, "maxGc": 100, "minProduct": 24, "maxProduct": 34 }, "capped": false, "counts": { "windows": 2, "boundary": 0, "excluded": 0, "gc": 0, "tm": 0, "validForward": 1, "validReverse": 1, "productSize": 0, "deltaTm": 0, "eligiblePairs": 1, "exactChecked": 1, "exactRefused": 0 }, "ranking": { "tmDeviation": 58.83275800549802, "lengthDeviation": 0.0, "deltaTm": 3.315848320899363, "total": 62.148606326397385 }, "structures": [ { "kind": "forward hairpin", "evaluated": false, "dG37": null, "detail": "Not evaluated in this mapping-only historical fixture." }, { "kind": "reverse hairpin", "evaluated": false, "dG37": null, "detail": "Not evaluated in this mapping-only historical fixture." }, { "kind": "forward self-dimer", "evaluated": false, "dG37": null, "detail": "Not evaluated in this mapping-only historical fixture." }, { "kind": "reverse self-dimer", "evaluated": false, "dG37": null, "detail": "Not evaluated in this mapping-only historical fixture." }, { "kind": "cross-dimer", "evaluated": false, "dG37": null, "detail": "Not evaluated in this mapping-only historical fixture." } ], "limitations": [ "Historical fixture for exact footprint mapping; no amplification evidence." ] }, "witness": { "templateHash": "2c1cd4c2d47f7adf4babec903955a5d96bd51e66424db6714075ea54795c531e", "templateLength": 34, "topology": "linear", "coordinates": "1-based-inclusive-5prime-to-3prime", "forward": { "start": 7, "end": 14, "strand": "+", "length": 9 }, "reverse": { "start": 31, "end": 24, "strand": "-", "length": 8 }, "productId": "+:7:14|-:31:24", "method": "exact-pair-v1" } } ], "sequenceWorkspace": { "v": 1, "text": ">mapping alphabet=dna\nGATCAAAGCTTGACCTTTAGCACTTGGATCCCCA\n", "templateText": "", "state": { "alphabet": "dna" }, "sourceContext": "" } }, "expected": { "readable": false, "refusal": "malformed-primer-sets" }, "note": "" }, { "id": "sets-inconsistent-endpoint", "input": { "v": 2, "app": "sequence-toolkit", "residues": "GATCAAAGCTTGACCTTTAGCACTTGGATCCCCA", "alphabet": "dna", "name": "Independent handoff fixture", "primerSets": [ { "v": 1, "id": "pair-1", "label": "Recorded mapping pair", "createdAt": "2026-10-11T00:00:00.000Z", "notes": "Independent coordinate fixture", "forward": { "annealing": "AGCTTGAC", "tail": "" }, "reverse": { "annealing": "GGATCCAA", "tail": "" }, "conditions": { "oligo_nM": 250, "na_mM": 50, "mg_mM": 0, "dntp_mM": 0, "model": "primer-excess", "saltCorrection": "owczarzy-2004" }, "design": { "method": "bounded-flanks-v1", "target": { "start": 9, "end": 16 }, "settings": { "target": { "start": 9, "end": 16 }, "excluded": [], "forwardTail": "", "reverseTail": "", "conditions": { "oligo_nM": 250, "na_mM": 50, "mg_mM": 0, "dntp_mM": 0, "model": "primer-excess", "saltCorrection": "owczarzy-2004" }, "flank": 0, "minLength": 8, "maxLength": 8, "targetLength": 8, "minTm": 0, "maxTm": 100, "targetTm": 40, "maxDeltaTm": 30, "minGc": 0, "maxGc": 100, "minProduct": 24, "maxProduct": 34 }, "capped": false, "counts": { "windows": 2, "boundary": 0, "excluded": 0, "gc": 0, "tm": 0, "validForward": 1, "validReverse": 1, "productSize": 0, "deltaTm": 0, "eligiblePairs": 1, "exactChecked": 1, "exactRefused": 0 }, "ranking": { "tmDeviation": 58.83275800549802, "lengthDeviation": 0.0, "deltaTm": 3.315848320899363, "total": 62.148606326397385 }, "structures": [ { "kind": "forward hairpin", "evaluated": false, "dG37": null, "detail": "Not evaluated in this mapping-only historical fixture." }, { "kind": "reverse hairpin", "evaluated": false, "dG37": null, "detail": "Not evaluated in this mapping-only historical fixture." }, { "kind": "forward self-dimer", "evaluated": false, "dG37": null, "detail": "Not evaluated in this mapping-only historical fixture." }, { "kind": "reverse self-dimer", "evaluated": false, "dG37": null, "detail": "Not evaluated in this mapping-only historical fixture." }, { "kind": "cross-dimer", "evaluated": false, "dG37": null, "detail": "Not evaluated in this mapping-only historical fixture." } ], "limitations": [ "Historical fixture for exact footprint mapping; no amplification evidence." ] }, "witness": { "templateHash": "2c1cd4c2d47f7adf4babec903955a5d96bd51e66424db6714075ea54795c531e", "templateLength": 34, "topology": "linear", "coordinates": "1-based-inclusive-5prime-to-3prime", "forward": { "start": 7, "end": 15, "strand": "+", "length": 8 }, "reverse": { "start": 31, "end": 24, "strand": "-", "length": 8 }, "productId": "+:7:14|-:31:24", "method": "exact-pair-v1" } } ], "sequenceWorkspace": { "v": 1, "text": ">mapping alphabet=dna\nGATCAAAGCTTGACCTTTAGCACTTGGATCCCCA\n", "templateText": "", "state": { "alphabet": "dna" }, "sourceContext": "" } }, "expected": { "readable": false, "refusal": "malformed-primer-sets" }, "note": "" }, { "id": "sets-coordinate-out-of-range", "input": { "v": 2, "app": "sequence-toolkit", "residues": "GATCAAAGCTTGACCTTTAGCACTTGGATCCCCA", "alphabet": "dna", "name": "Independent handoff fixture", "primerSets": [ { "v": 1, "id": "pair-1", "label": "Recorded mapping pair", "createdAt": "2026-10-11T00:00:00.000Z", "notes": "Independent coordinate fixture", "forward": { "annealing": "AGCTTGAC", "tail": "" }, "reverse": { "annealing": "GGATCCAA", "tail": "" }, "conditions": { "oligo_nM": 250, "na_mM": 50, "mg_mM": 0, "dntp_mM": 0, "model": "primer-excess", "saltCorrection": "owczarzy-2004" }, "design": { "method": "bounded-flanks-v1", "target": { "start": 9, "end": 16 }, "settings": { "target": { "start": 9, "end": 16 }, "excluded": [], "forwardTail": "", "reverseTail": "", "conditions": { "oligo_nM": 250, "na_mM": 50, "mg_mM": 0, "dntp_mM": 0, "model": "primer-excess", "saltCorrection": "owczarzy-2004" }, "flank": 0, "minLength": 8, "maxLength": 8, "targetLength": 8, "minTm": 0, "maxTm": 100, "targetTm": 40, "maxDeltaTm": 30, "minGc": 0, "maxGc": 100, "minProduct": 24, "maxProduct": 34 }, "capped": false, "counts": { "windows": 2, "boundary": 0, "excluded": 0, "gc": 0, "tm": 0, "validForward": 1, "validReverse": 1, "productSize": 0, "deltaTm": 0, "eligiblePairs": 1, "exactChecked": 1, "exactRefused": 0 }, "ranking": { "tmDeviation": 58.83275800549802, "lengthDeviation": 0.0, "deltaTm": 3.315848320899363, "total": 62.148606326397385 }, "structures": [ { "kind": "forward hairpin", "evaluated": false, "dG37": null, "detail": "Not evaluated in this mapping-only historical fixture." }, { "kind": "reverse hairpin", "evaluated": false, "dG37": null, "detail": "Not evaluated in this mapping-only historical fixture." }, { "kind": "forward self-dimer", "evaluated": false, "dG37": null, "detail": "Not evaluated in this mapping-only historical fixture." }, { "kind": "reverse self-dimer", "evaluated": false, "dG37": null, "detail": "Not evaluated in this mapping-only historical fixture." }, { "kind": "cross-dimer", "evaluated": false, "dG37": null, "detail": "Not evaluated in this mapping-only historical fixture." } ], "limitations": [ "Historical fixture for exact footprint mapping; no amplification evidence." ] }, "witness": { "templateHash": "2c1cd4c2d47f7adf4babec903955a5d96bd51e66424db6714075ea54795c531e", "templateLength": 34, "topology": "linear", "coordinates": "1-based-inclusive-5prime-to-3prime", "forward": { "start": 0, "end": 14, "strand": "+", "length": 8 }, "reverse": { "start": 31, "end": 24, "strand": "-", "length": 8 }, "productId": "+:7:14|-:31:24", "method": "exact-pair-v1" } } ], "sequenceWorkspace": { "v": 1, "text": ">mapping alphabet=dna\nGATCAAAGCTTGACCTTTAGCACTTGGATCCCCA\n", "templateText": "", "state": { "alphabet": "dna" }, "sourceContext": "" } }, "expected": { "readable": false, "refusal": "malformed-primer-sets" }, "note": "" }, { "id": "sets-linear-wrap", "input": { "v": 2, "app": "sequence-toolkit", "residues": "GATCAAAGCTTGACCTTTAGCACTTGGATCCCCA", "alphabet": "dna", "name": "Independent handoff fixture", "primerSets": [ { "v": 1, "id": "pair-1", "label": "Recorded mapping pair", "createdAt": "2026-10-11T00:00:00.000Z", "notes": "Independent coordinate fixture", "forward": { "annealing": "CCCAGATC", "tail": "" }, "reverse": { "annealing": "AGTGCTAA", "tail": "" }, "conditions": { "oligo_nM": 250, "na_mM": 50, "mg_mM": 0, "dntp_mM": 0, "model": "primer-excess", "saltCorrection": "owczarzy-2004" }, "design": { "method": "bounded-flanks-v1", "target": { "start": 9, "end": 16 }, "settings": { "target": { "start": 9, "end": 16 }, "excluded": [], "forwardTail": "", "reverseTail": "", "conditions": { "oligo_nM": 250, "na_mM": 50, "mg_mM": 0, "dntp_mM": 0, "model": "primer-excess", "saltCorrection": "owczarzy-2004" }, "flank": 0, "minLength": 8, "maxLength": 8, "targetLength": 8, "minTm": 0, "maxTm": 100, "targetTm": 40, "maxDeltaTm": 30, "minGc": 0, "maxGc": 100, "minProduct": 24, "maxProduct": 34 }, "capped": false, "counts": { "windows": 2, "boundary": 0, "excluded": 0, "gc": 0, "tm": 0, "validForward": 1, "validReverse": 1, "productSize": 0, "deltaTm": 0, "eligiblePairs": 1, "exactChecked": 1, "exactRefused": 0 }, "ranking": { "tmDeviation": 58.83275800549802, "lengthDeviation": 0.0, "deltaTm": 3.315848320899363, "total": 62.148606326397385 }, "structures": [ { "kind": "forward hairpin", "evaluated": false, "dG37": null, "detail": "Not evaluated in this mapping-only historical fixture." }, { "kind": "reverse hairpin", "evaluated": false, "dG37": null, "detail": "Not evaluated in this mapping-only historical fixture." }, { "kind": "forward self-dimer", "evaluated": false, "dG37": null, "detail": "Not evaluated in this mapping-only historical fixture." }, { "kind": "reverse self-dimer", "evaluated": false, "dG37": null, "detail": "Not evaluated in this mapping-only historical fixture." }, { "kind": "cross-dimer", "evaluated": false, "dG37": null, "detail": "Not evaluated in this mapping-only historical fixture." } ], "limitations": [ "Historical fixture for exact footprint mapping; no amplification evidence." ] }, "witness": { "templateHash": "2c1cd4c2d47f7adf4babec903955a5d96bd51e66424db6714075ea54795c531e", "templateLength": 34, "topology": "linear", "coordinates": "1-based-inclusive-5prime-to-3prime", "forward": { "start": 31, "end": 4, "strand": "+", "length": 8 }, "reverse": { "start": 24, "end": 17, "strand": "-", "length": 8 }, "productId": "+:31:4|-:24:17", "method": "exact-pair-v1" } } ], "sequenceWorkspace": { "v": 1, "text": ">mapping alphabet=dna\nGATCAAAGCTTGACCTTTAGCACTTGGATCCCCA\n", "templateText": "", "state": { "alphabet": "dna" }, "sourceContext": "" } }, "expected": { "readable": false, "refusal": "malformed-primer-sets" }, "note": "" }, { "id": "sets-duplicate-id", "input": { "v": 2, "app": "sequence-toolkit", "residues": "GATCAAAGCTTGACCTTTAGCACTTGGATCCCCA", "alphabet": "dna", "name": "Independent handoff fixture", "primerSets": [ { "v": 1, "id": "pair-1", "label": "Recorded mapping pair", "createdAt": "2026-10-11T00:00:00.000Z", "notes": "Independent coordinate fixture", "forward": { "annealing": "AGCTTGAC", "tail": "" }, "reverse": { "annealing": "GGATCCAA", "tail": "" }, "conditions": { "oligo_nM": 250, "na_mM": 50, "mg_mM": 0, "dntp_mM": 0, "model": "primer-excess", "saltCorrection": "owczarzy-2004" }, "design": { "method": "bounded-flanks-v1", "target": { "start": 9, "end": 16 }, "settings": { "target": { "start": 9, "end": 16 }, "excluded": [], "forwardTail": "", "reverseTail": "", "conditions": { "oligo_nM": 250, "na_mM": 50, "mg_mM": 0, "dntp_mM": 0, "model": "primer-excess", "saltCorrection": "owczarzy-2004" }, "flank": 0, "minLength": 8, "maxLength": 8, "targetLength": 8, "minTm": 0, "maxTm": 100, "targetTm": 40, "maxDeltaTm": 30, "minGc": 0, "maxGc": 100, "minProduct": 24, "maxProduct": 34 }, "capped": false, "counts": { "windows": 2, "boundary": 0, "excluded": 0, "gc": 0, "tm": 0, "validForward": 1, "validReverse": 1, "productSize": 0, "deltaTm": 0, "eligiblePairs": 1, "exactChecked": 1, "exactRefused": 0 }, "ranking": { "tmDeviation": 58.83275800549802, "lengthDeviation": 0.0, "deltaTm": 3.315848320899363, "total": 62.148606326397385 }, "structures": [ { "kind": "forward hairpin", "evaluated": false, "dG37": null, "detail": "Not evaluated in this mapping-only historical fixture." }, { "kind": "reverse hairpin", "evaluated": false, "dG37": null, "detail": "Not evaluated in this mapping-only historical fixture." }, { "kind": "forward self-dimer", "evaluated": false, "dG37": null, "detail": "Not evaluated in this mapping-only historical fixture." }, { "kind": "reverse self-dimer", "evaluated": false, "dG37": null, "detail": "Not evaluated in this mapping-only historical fixture." }, { "kind": "cross-dimer", "evaluated": false, "dG37": null, "detail": "Not evaluated in this mapping-only historical fixture." } ], "limitations": [ "Historical fixture for exact footprint mapping; no amplification evidence." ] }, "witness": { "templateHash": "2c1cd4c2d47f7adf4babec903955a5d96bd51e66424db6714075ea54795c531e", "templateLength": 34, "topology": "linear", "coordinates": "1-based-inclusive-5prime-to-3prime", "forward": { "start": 7, "end": 14, "strand": "+", "length": 8 }, "reverse": { "start": 31, "end": 24, "strand": "-", "length": 8 }, "productId": "+:7:14|-:31:24", "method": "exact-pair-v1" } }, { "v": 1, "id": "pair-1", "label": "Recorded mapping pair", "createdAt": "2026-10-11T00:00:00.000Z", "notes": "Independent coordinate fixture", "forward": { "annealing": "AGCTTGAC", "tail": "" }, "reverse": { "annealing": "GGATCCAA", "tail": "" }, "conditions": { "oligo_nM": 250, "na_mM": 50, "mg_mM": 0, "dntp_mM": 0, "model": "primer-excess", "saltCorrection": "owczarzy-2004" }, "design": { "method": "bounded-flanks-v1", "target": { "start": 9, "end": 16 }, "settings": { "target": { "start": 9, "end": 16 }, "excluded": [], "forwardTail": "", "reverseTail": "", "conditions": { "oligo_nM": 250, "na_mM": 50, "mg_mM": 0, "dntp_mM": 0, "model": "primer-excess", "saltCorrection": "owczarzy-2004" }, "flank": 0, "minLength": 8, "maxLength": 8, "targetLength": 8, "minTm": 0, "maxTm": 100, "targetTm": 40, "maxDeltaTm": 30, "minGc": 0, "maxGc": 100, "minProduct": 24, "maxProduct": 34 }, "capped": false, "counts": { "windows": 2, "boundary": 0, "excluded": 0, "gc": 0, "tm": 0, "validForward": 1, "validReverse": 1, "productSize": 0, "deltaTm": 0, "eligiblePairs": 1, "exactChecked": 1, "exactRefused": 0 }, "ranking": { "tmDeviation": 58.83275800549802, "lengthDeviation": 0.0, "deltaTm": 3.315848320899363, "total": 62.148606326397385 }, "structures": [ { "kind": "forward hairpin", "evaluated": false, "dG37": null, "detail": "Not evaluated in this mapping-only historical fixture." }, { "kind": "reverse hairpin", "evaluated": false, "dG37": null, "detail": "Not evaluated in this mapping-only historical fixture." }, { "kind": "forward self-dimer", "evaluated": false, "dG37": null, "detail": "Not evaluated in this mapping-only historical fixture." }, { "kind": "reverse self-dimer", "evaluated": false, "dG37": null, "detail": "Not evaluated in this mapping-only historical fixture." }, { "kind": "cross-dimer", "evaluated": false, "dG37": null, "detail": "Not evaluated in this mapping-only historical fixture." } ], "limitations": [ "Historical fixture for exact footprint mapping; no amplification evidence." ] }, "witness": { "templateHash": "2c1cd4c2d47f7adf4babec903955a5d96bd51e66424db6714075ea54795c531e", "templateLength": 34, "topology": "linear", "coordinates": "1-based-inclusive-5prime-to-3prime", "forward": { "start": 7, "end": 14, "strand": "+", "length": 8 }, "reverse": { "start": 31, "end": 24, "strand": "-", "length": 8 }, "productId": "+:7:14|-:31:24", "method": "exact-pair-v1" } } ], "sequenceWorkspace": { "v": 1, "text": ">mapping alphabet=dna\nGATCAAAGCTTGACCTTTAGCACTTGGATCCCCA\n", "templateText": "", "state": { "alphabet": "dna" }, "sourceContext": "" } }, "expected": { "readable": false, "refusal": "malformed-primer-sets" }, "note": "" }, { "id": "sets-malformed-collection", "input": { "v": 2, "app": "sequence-toolkit", "residues": "GATCAAAGCTTGACCTTTAGCACTTGGATCCCCA", "alphabet": "dna", "name": "Independent handoff fixture", "primerSets": { "entries": [ { "v": 1, "id": "pair-1", "label": "Recorded mapping pair", "createdAt": "2026-10-11T00:00:00.000Z", "notes": "Independent coordinate fixture", "forward": { "annealing": "AGCTTGAC", "tail": "" }, "reverse": { "annealing": "GGATCCAA", "tail": "" }, "conditions": { "oligo_nM": 250, "na_mM": 50, "mg_mM": 0, "dntp_mM": 0, "model": "primer-excess", "saltCorrection": "owczarzy-2004" }, "design": { "method": "bounded-flanks-v1", "target": { "start": 9, "end": 16 }, "settings": { "target": { "start": 9, "end": 16 }, "excluded": [], "forwardTail": "", "reverseTail": "", "conditions": { "oligo_nM": 250, "na_mM": 50, "mg_mM": 0, "dntp_mM": 0, "model": "primer-excess", "saltCorrection": "owczarzy-2004" }, "flank": 0, "minLength": 8, "maxLength": 8, "targetLength": 8, "minTm": 0, "maxTm": 100, "targetTm": 40, "maxDeltaTm": 30, "minGc": 0, "maxGc": 100, "minProduct": 24, "maxProduct": 34 }, "capped": false, "counts": { "windows": 2, "boundary": 0, "excluded": 0, "gc": 0, "tm": 0, "validForward": 1, "validReverse": 1, "productSize": 0, "deltaTm": 0, "eligiblePairs": 1, "exactChecked": 1, "exactRefused": 0 }, "ranking": { "tmDeviation": 58.83275800549802, "lengthDeviation": 0.0, "deltaTm": 3.315848320899363, "total": 62.148606326397385 }, "structures": [ { "kind": "forward hairpin", "evaluated": false, "dG37": null, "detail": "Not evaluated in this mapping-only historical fixture." }, { "kind": "reverse hairpin", "evaluated": false, "dG37": null, "detail": "Not evaluated in this mapping-only historical fixture." }, { "kind": "forward self-dimer", "evaluated": false, "dG37": null, "detail": "Not evaluated in this mapping-only historical fixture." }, { "kind": "reverse self-dimer", "evaluated": false, "dG37": null, "detail": "Not evaluated in this mapping-only historical fixture." }, { "kind": "cross-dimer", "evaluated": false, "dG37": null, "detail": "Not evaluated in this mapping-only historical fixture." } ], "limitations": [ "Historical fixture for exact footprint mapping; no amplification evidence." ] }, "witness": { "templateHash": "2c1cd4c2d47f7adf4babec903955a5d96bd51e66424db6714075ea54795c531e", "templateLength": 34, "topology": "linear", "coordinates": "1-based-inclusive-5prime-to-3prime", "forward": { "start": 7, "end": 14, "strand": "+", "length": 8 }, "reverse": { "start": 31, "end": 24, "strand": "-", "length": 8 }, "productId": "+:7:14|-:31:24", "method": "exact-pair-v1" } } ] }, "sequenceWorkspace": { "v": 1, "text": ">mapping alphabet=dna\nGATCAAAGCTTGACCTTTAGCACTTGGATCCCCA\n", "templateText": "", "state": { "alphabet": "dna" }, "sourceContext": "" } }, "expected": { "readable": false, "refusal": "malformed-primer-sets" }, "note": "" }, { "id": "sets-unrelated-retained-with-pcr", "input": { "v": 2, "app": "sequence-toolkit", "residues": "ACGTAAGCTTGACCTTTAGCACTTGGATCCAGGATC", "alphabet": "dna", "name": "Independent handoff fixture", "primerSets": [ { "v": 1, "id": "pair-1", "label": "Recorded mapping pair", "createdAt": "2026-10-11T00:00:00.000Z", "notes": "Independent coordinate fixture", "forward": { "annealing": "AGCTTGAC", "tail": "" }, "reverse": { "annealing": "GGATCCAA", "tail": "" }, "conditions": { "oligo_nM": 250, "na_mM": 50, "mg_mM": 0, "dntp_mM": 0, "model": "primer-excess", "saltCorrection": "owczarzy-2004" }, "design": { "method": "bounded-flanks-v1", "target": { "start": 9, "end": 16 }, "settings": { "target": { "start": 9, "end": 16 }, "excluded": [], "forwardTail": "", "reverseTail": "", "conditions": { "oligo_nM": 250, "na_mM": 50, "mg_mM": 0, "dntp_mM": 0, "model": "primer-excess", "saltCorrection": "owczarzy-2004" }, "flank": 0, "minLength": 8, "maxLength": 8, "targetLength": 8, "minTm": 0, "maxTm": 100, "targetTm": 40, "maxDeltaTm": 30, "minGc": 0, "maxGc": 100, "minProduct": 24, "maxProduct": 34 }, "capped": false, "counts": { "windows": 2, "boundary": 0, "excluded": 0, "gc": 0, "tm": 0, "validForward": 1, "validReverse": 1, "productSize": 0, "deltaTm": 0, "eligiblePairs": 1, "exactChecked": 1, "exactRefused": 0 }, "ranking": { "tmDeviation": 58.83275800549802, "lengthDeviation": 0.0, "deltaTm": 3.315848320899363, "total": 62.148606326397385 }, "structures": [ { "kind": "forward hairpin", "evaluated": false, "dG37": null, "detail": "Not evaluated in this mapping-only historical fixture." }, { "kind": "reverse hairpin", "evaluated": false, "dG37": null, "detail": "Not evaluated in this mapping-only historical fixture." }, { "kind": "forward self-dimer", "evaluated": false, "dG37": null, "detail": "Not evaluated in this mapping-only historical fixture." }, { "kind": "reverse self-dimer", "evaluated": false, "dG37": null, "detail": "Not evaluated in this mapping-only historical fixture." }, { "kind": "cross-dimer", "evaluated": false, "dG37": null, "detail": "Not evaluated in this mapping-only historical fixture." } ], "limitations": [ "Historical fixture for exact footprint mapping; no amplification evidence." ] }, "witness": { "templateHash": "2c1cd4c2d47f7adf4babec903955a5d96bd51e66424db6714075ea54795c531e", "templateLength": 34, "topology": "linear", "coordinates": "1-based-inclusive-5prime-to-3prime", "forward": { "start": 7, "end": 14, "strand": "+", "length": 8 }, "reverse": { "start": 31, "end": 24, "strand": "-", "length": 8 }, "productId": "+:7:14|-:31:24", "method": "exact-pair-v1" } } ], "sequenceWorkspace": { "v": 1, "text": ">mapping alphabet=dna\nACGTAAGCTTGACCTTTAGCACTTGGATCCAGGATC\n", "templateText": "", "state": { "alphabet": "dna" }, "sourceContext": "" }, "pcrProduct": { "v": 1, "methodVersion": "exact-pair-v1", "createdAt": "2026-10-11T00:00:00.000Z", "name": "Predicted fixture product", "names": { "template": "Oracle template", "forward": "Forward", "reverse": "Reverse" }, "input": { "template": "GATCAAAGCTTGACCTTTAGCACTTGGATCCCCA", "topology": "linear", "forward": { "annealing": "AGCTTGACCT", "tail": "ACGTA" }, "reverse": { "annealing": "GGATCCAAGT", "tail": "GATCCT" } }, "product": { "id": "+:7:16|-:31:22", "sequence": "ACGTAAGCTTGACCTTTAGCACTTGGATCCAGGATC", "length": 36, "templateLength": 34, "templateSpan": 25, "orientation": "+", "crossesOrigin": false, "forward": { "strand": "+", "start": 7, "end": 16, "length": 10 }, "reverse": { "strand": "-", "start": 31, "end": 22, "length": 10 } }, "predicted": true, "topology": "linear", "candidateCount": 1, "overlappingPairs": 0, "limitation": "Predicted from exact primer matches on the supplied template only. This is not genome-wide specificity screening or evidence of successful amplification. Template feature annotations were not transferred." } }, "expected": { "readable": true, "features": [ { "direction": "forward", "key": "primer_bind", "strand": "+", "location": "1..15", "parts": [ { "start": 1, "end": 15 } ], "extracted": "ACGTAAGCTTGACCT", "annealing": "AGCTTGACCT", "tail": "ACGTA", "meaning": "predicted-incorporated-primer" }, { "direction": "reverse", "key": "primer_bind", "strand": "-", "location": "complement(21..36)", "parts": [ { "start": 21, "end": 36 } ], "extracted": "GATCCTGGATCCAAGT", "annealing": "GGATCCAAGT", "tail": "GATCCT", "meaning": "predicted-incorporated-primer" } ], "placedSets": 0, "skippedSets": 1, "pcrFeatures": 2 }, "note": "" }, { "id": "sets-preserve-existing-record-feature", "input": { "v": 2, "app": "sequence-toolkit", "residues": "GATCAAAGCTTGACCTTTAGCACTTGGATCCCCA", "alphabet": "dna", "name": "Independent handoff fixture", "primerSets": [ { "v": 1, "id": "pair-1", "label": "Recorded mapping pair", "createdAt": "2026-10-11T00:00:00.000Z", "notes": "Independent coordinate fixture", "forward": { "annealing": "AGCTTGAC", "tail": "" }, "reverse": { "annealing": "GGATCCAA", "tail": "" }, "conditions": { "oligo_nM": 250, "na_mM": 50, "mg_mM": 0, "dntp_mM": 0, "model": "primer-excess", "saltCorrection": "owczarzy-2004" }, "design": { "method": "bounded-flanks-v1", "target": { "start": 9, "end": 16 }, "settings": { "target": { "start": 9, "end": 16 }, "excluded": [], "forwardTail": "", "reverseTail": "", "conditions": { "oligo_nM": 250, "na_mM": 50, "mg_mM": 0, "dntp_mM": 0, "model": "primer-excess", "saltCorrection": "owczarzy-2004" }, "flank": 0, "minLength": 8, "maxLength": 8, "targetLength": 8, "minTm": 0, "maxTm": 100, "targetTm": 40, "maxDeltaTm": 30, "minGc": 0, "maxGc": 100, "minProduct": 24, "maxProduct": 34 }, "capped": false, "counts": { "windows": 2, "boundary": 0, "excluded": 0, "gc": 0, "tm": 0, "validForward": 1, "validReverse": 1, "productSize": 0, "deltaTm": 0, "eligiblePairs": 1, "exactChecked": 1, "exactRefused": 0 }, "ranking": { "tmDeviation": 58.83275800549802, "lengthDeviation": 0.0, "deltaTm": 3.315848320899363, "total": 62.148606326397385 }, "structures": [ { "kind": "forward hairpin", "evaluated": false, "dG37": null, "detail": "Not evaluated in this mapping-only historical fixture." }, { "kind": "reverse hairpin", "evaluated": false, "dG37": null, "detail": "Not evaluated in this mapping-only historical fixture." }, { "kind": "forward self-dimer", "evaluated": false, "dG37": null, "detail": "Not evaluated in this mapping-only historical fixture." }, { "kind": "reverse self-dimer", "evaluated": false, "dG37": null, "detail": "Not evaluated in this mapping-only historical fixture." }, { "kind": "cross-dimer", "evaluated": false, "dG37": null, "detail": "Not evaluated in this mapping-only historical fixture." } ], "limitations": [ "Historical fixture for exact footprint mapping; no amplification evidence." ] }, "witness": { "templateHash": "2c1cd4c2d47f7adf4babec903955a5d96bd51e66424db6714075ea54795c531e", "templateLength": 34, "topology": "linear", "coordinates": "1-based-inclusive-5prime-to-3prime", "forward": { "start": 7, "end": 14, "strand": "+", "length": 8 }, "reverse": { "start": 31, "end": 24, "strand": "-", "length": 8 }, "productId": "+:7:14|-:31:24", "method": "exact-pair-v1" } } ], "sequenceWorkspace": { "v": 1, "text": "LOCUS mapping 34 bp DNA linear UNK 01-JAN-1980\nDEFINITION Independent imported annotation fixture.\nACCESSION mapping\nVERSION mapping\nKEYWORDS .\nSOURCE .\n ORGANISM .\n .\nFEATURES Location/Qualifiers\n misc_feature 2..6\n /label=\"Original feature\"\n /note=\"Keep submitter annotation unchanged\"\nORIGIN\n 1 gatcaaagct tgacctttag cacttggatc ccca\n//\n", "templateText": "", "state": { "alphabet": "dna" }, "sourceContext": "" } }, "expected": { "readable": true, "features": [ { "direction": "forward", "key": "primer_bind", "strand": "+", "location": "7..14", "parts": [ { "start": 7, "end": 14 } ], "extracted": "AGCTTGAC", "annealing": "AGCTTGAC", "tail": "", "meaning": "recorded-exact-template-site" }, { "direction": "reverse", "key": "primer_bind", "strand": "-", "location": "complement(24..31)", "parts": [ { "start": 24, "end": 31 } ], "extracted": "GGATCCAA", "annealing": "GGATCCAA", "tail": "", "meaning": "recorded-exact-template-site" } ], "placedSets": 1, "skippedSets": 0, "pcrFeatures": 0, "preservedFeatures": [ { "key": "misc_feature", "location": "2..6", "qualifiers": { "label": [ "Original feature" ], "note": [ "Keep submitter annotation unchanged" ] } } ] }, "note": "" }, { "id": "pcr-existing-incorporated-features-no-duplicates", "input": { "v": 2, "app": "sequence-toolkit", "residues": "ACGTAAGCTTGACCTTTAGCACTTGGATCCAGGATC", "alphabet": "dna", "name": "Independent handoff fixture", "primerSets": [], "sequenceWorkspace": { "v": 1, "text": "LOCUS mapping 36 bp DNA linear UNK 01-JAN-1980\nDEFINITION Independent imported annotation fixture.\nACCESSION mapping\nVERSION mapping\nKEYWORDS .\nSOURCE .\n ORGANISM .\n .\nFEATURES Location/Qualifiers\n primer_bind 1..15\n /label=\"Forward\"\n /note=\"Predicted incorporated primer; exact annealing\n sequence 5-prime to 3-prime AGCTTGACCT; 5-prime tail\n ACGTA.\"\n primer_bind complement(21..36)\n /label=\"Reverse\"\n /note=\"Predicted incorporated primer; exact annealing\n sequence 5-prime to 3-prime GGATCCAAGT; 5-prime tail\n GATCCT.\"\nORIGIN\n 1 acgtaagctt gacctttagc acttggatcc aggatc\n//\n", "templateText": "", "state": { "alphabet": "dna" }, "sourceContext": "" }, "pcrProduct": { "v": 1, "methodVersion": "exact-pair-v1", "createdAt": "2026-10-11T00:00:00.000Z", "name": "Predicted fixture product", "names": { "template": "Oracle template", "forward": "Forward", "reverse": "Reverse" }, "input": { "template": "GATCAAAGCTTGACCTTTAGCACTTGGATCCCCA", "topology": "linear", "forward": { "annealing": "AGCTTGACCT", "tail": "ACGTA" }, "reverse": { "annealing": "GGATCCAAGT", "tail": "GATCCT" } }, "product": { "id": "+:7:16|-:31:22", "sequence": "ACGTAAGCTTGACCTTTAGCACTTGGATCCAGGATC", "length": 36, "templateLength": 34, "templateSpan": 25, "orientation": "+", "crossesOrigin": false, "forward": { "strand": "+", "start": 7, "end": 16, "length": 10 }, "reverse": { "strand": "-", "start": 31, "end": 22, "length": 10 } }, "predicted": true, "topology": "linear", "candidateCount": 1, "overlappingPairs": 0, "limitation": "Predicted from exact primer matches on the supplied template only. This is not genome-wide specificity screening or evidence of successful amplification. Template feature annotations were not transferred." } }, "expected": { "readable": true, "features": [ { "direction": "forward", "key": "primer_bind", "strand": "+", "location": "1..15", "parts": [ { "start": 1, "end": 15 } ], "extracted": "ACGTAAGCTTGACCT", "annealing": "AGCTTGACCT", "tail": "ACGTA", "meaning": "predicted-incorporated-primer" }, { "direction": "reverse", "key": "primer_bind", "strand": "-", "location": "complement(21..36)", "parts": [ { "start": 21, "end": 36 } ], "extracted": "GATCCTGGATCCAAGT", "annealing": "GGATCCAAGT", "tail": "GATCCT", "meaning": "predicted-incorporated-primer" } ], "placedSets": 0, "skippedSets": 0, "pcrFeatures": 2, "addedFeatures": 0, "totalPrimerFeatures": 2 }, "note": "" }, { "id": "qualification-record-v2-valid", "input": { "v": 2, "app": "sequence-toolkit", "residues": "GACACCATCGAATGGCGCAAAACCTTTCGCGGTATGGCATGATAGCGCCCGGAAGAGAGTCAATTCAGGGTGGTGAATGTGAAACCAGTAACGTTATACGATGTCGCAGAGTATGCCGGTGTCTCTTATCAGACCGTTTCCCGCGTGGTGAACCAGGCCAGCCACGTTTCTGCGAAAACGCGGGAAAAAGTGGAAGCGGCGATGGCGGAGCTGAATTACATTCCCAACCGCGTGGCACAACAACTGGCGGGCAAACAGTCGTTGCTGATTGGCGTTGCCACCTCCAGTCTGGCCCTGCACGCGCCGTCGCAAATTGTCGCGGCGATTAAATCTCGCGCCGATCAACTGGGTGCCAGCGTGGTGGTGTCGATGGTAGAACGAAGCGGCGTCGAAGCCTGTAAAGCGGCGGTGCACAATCTTCTCGCGCAACGCGTCAGTGGGCTGATCATTAACTATCCGCTGGATGACCAGGATGCCATTGCTGTGGAAGCTGCCTGCACTAATGTTCCGGCGTTATTTCTTGATGTCTCTGACCAGACACCCATCAACAGTATTATTTTCTCCCATGAAGACGGTACGCGACTGGGCGTGGAGCATCTG", "alphabet": "dna", "name": "Independent handoff fixture", "primerSets": [ { "v": 1, "id": "oracle-primer-set", "label": "Independent record contract example", "createdAt": "2026-10-11T00:00:00.000Z", "notes": "", "forward": { "annealing": "CCAGCCACGTTTCTGCGAAA", "tail": "" }, "reverse": { "annealing": "TGCGCGAGAAGATTGTGCAC", "tail": "" }, "conditions": { "oligo_nM": 250, "na_mM": 50, "mg_mM": 0, "dntp_mM": 0, "model": "primer-excess", "saltCorrection": "owczarzy-2004" }, "witness": { "templateHash": "fd182829946e68ba90d7c14906883ef31f663537dade5f617f804b8ce46dc316", "templateLength": 600, "topology": "linear", "coordinates": "1-based-inclusive-5prime-to-3prime", "forward": { "strand": "+", "start": 158, "end": 177, "length": 20 }, "reverse": { "strand": "-", "start": 428, "end": 409, "length": 20 }, "productId": "+:158:177|-:428:409", "method": "exact-pair-v1" }, "design": { "method": "bounded-flanks-v2", "target": { "start": 201, "end": 400 }, "capped": true, "ranking": { "tmDeviation": 0.06462320381317, "lengthDeviation": 0.0, "deltaTm": 0.03260351198753142, "total": 0.09722671580070141 }, "counts": { "windows": 918, "boundary": 0, "excluded": 0, "gc": 40, "tm": 234, "validForward": 353, "validReverse": 291, "productSize": 0, "deltaTm": 0, "eligiblePairs": 576, "exactChecked": 5, "exactRefused": 0 }, "settings": { "target": { "start": 201, "end": 400 }, "excluded": [], "forwardTail": "", "reverseTail": "", "conditions": { "oligo_nM": 250, "na_mM": 50, "mg_mM": 0, "dntp_mM": 0, "model": "primer-excess", "saltCorrection": "owczarzy-2004" }, "flank": 50, "minLength": 18, "maxLength": 26, "targetLength": 20, "minTm": 55, "maxTm": 68, "targetTm": 59.95, "maxDeltaTm": 3, "minGc": 30, "maxGc": 70, "minProduct": 180, "maxProduct": 420 }, "structures": [ { "kind": "forward hairpin", "evaluated": false, "dG37": null, "detail": "Not evaluated in this hand-authored reader-contract example." }, { "kind": "reverse hairpin", "evaluated": false, "dG37": null, "detail": "Not evaluated in this hand-authored reader-contract example." }, { "kind": "forward self-dimer", "evaluated": false, "dG37": null, "detail": "Not evaluated in this hand-authored reader-contract example." }, { "kind": "reverse self-dimer", "evaluated": false, "dG37": null, "detail": "Not evaluated in this hand-authored reader-contract example." }, { "kind": "cross-dimer", "evaluated": false, "dG37": null, "detail": "Not evaluated in this hand-authored reader-contract example." } ], "limitations": [ "Reader-contract fixture: no secondary structure calculation is represented." ], "temperatures": { "forward": { "value": 59.99861335790035, "method": "oligo-tm-nearest-neighbour", "version": "1.0.0", "saltCorrection": "owczarzy-2004", "conditions": { "oligo_nM": 250, "na_mM": 50, "k_mM": 0, "tris_mM": 0, "mg_mM": 0, "dntp_mM": 0, "model": "primer-excess", "saltCorrection": "owczarzy-2004" }, "limit": "Monovalent correction: Owczarzy 2004, fitted at 69 mM to 1.02 M Na\u207a. It is also used from 20 to 69 mM, an extrapolation whose error has not been established here: Owczarzy 2008 places typical PCR buffers (20 to 100 mM monovalent) where this equation applies.", "outside": [] }, "reverse": { "value": 59.96600984591282, "method": "oligo-tm-nearest-neighbour", "version": "1.0.0", "saltCorrection": "owczarzy-2004", "conditions": { "oligo_nM": 250, "na_mM": 50, "k_mM": 0, "tris_mM": 0, "mg_mM": 0, "dntp_mM": 0, "model": "primer-excess", "saltCorrection": "owczarzy-2004" }, "limit": "Monovalent correction: Owczarzy 2004, fitted at 69 mM to 1.02 M Na\u207a. It is also used from 20 to 69 mM, an extrapolation whose error has not been established here: Owczarzy 2008 places typical PCR buffers (20 to 100 mM monovalent) where this equation applies.", "outside": [] } } } } ], "sequenceWorkspace": { "v": 1, "text": ">mapping alphabet=dna\nGACACCATCGAATGGCGCAAAACCTTTCGCGGTATGGCATGATAGCGCCCGGAAGAGAGTCAATTCAGGGTGGTGAATGTGAAACCAGTAACGTTATACGATGTCGCAGAGTATGCCGGTGTCTCTTATCAGACCGTTTCCCGCGTGGTGAACCAGGCCAGCCACGTTTCTGCGAAAACGCGGGAAAAAGTGGAAGCGGCGATGGCGGAGCTGAATTACATTCCCAACCGCGTGGCACAACAACTGGCGGGCAAACAGTCGTTGCTGATTGGCGTTGCCACCTCCAGTCTGGCCCTGCACGCGCCGTCGCAAATTGTCGCGGCGATTAAATCTCGCGCCGATCAACTGGGTGCCAGCGTGGTGGTGTCGATGGTAGAACGAAGCGGCGTCGAAGCCTGTAAAGCGGCGGTGCACAATCTTCTCGCGCAACGCGTCAGTGGGCTGATCATTAACTATCCGCTGGATGACCAGGATGCCATTGCTGTGGAAGCTGCCTGCACTAATGTTCCGGCGTTATTTCTTGATGTCTCTGACCAGACACCCATCAACAGTATTATTTTCTCCCATGAAGACGGTACGCGACTGGGCGTGGAGCATCTG\n", "templateText": "", "state": { "alphabet": "dna" }, "sourceContext": "" } }, "expected": { "readable": true, "features": [ { "direction": "forward", "key": "primer_bind", "strand": "+", "location": "158..177", "parts": [ { "start": 158, "end": 177 } ], "extracted": "CCAGCCACGTTTCTGCGAAA", "annealing": "CCAGCCACGTTTCTGCGAAA", "tail": "", "meaning": "recorded-exact-template-site" }, { "direction": "reverse", "key": "primer_bind", "strand": "-", "location": "complement(409..428)", "parts": [ { "start": 409, "end": 428 } ], "extracted": "TGCGCGAGAAGATTGTGCAC", "annealing": "TGCGCGAGAAGATTGTGCAC", "tail": "", "meaning": "recorded-exact-template-site" } ], "placedSets": 1, "skippedSets": 0, "pcrFeatures": 0 }, "note": "Sparse settings and explicit normalized retained conditions are semantically consistent; retained data must survive unchanged." }, { "id": "qualification-record-v2-explicit-defaults", "input": { "v": 2, "app": "sequence-toolkit", "residues": "GACACCATCGAATGGCGCAAAACCTTTCGCGGTATGGCATGATAGCGCCCGGAAGAGAGTCAATTCAGGGTGGTGAATGTGAAACCAGTAACGTTATACGATGTCGCAGAGTATGCCGGTGTCTCTTATCAGACCGTTTCCCGCGTGGTGAACCAGGCCAGCCACGTTTCTGCGAAAACGCGGGAAAAAGTGGAAGCGGCGATGGCGGAGCTGAATTACATTCCCAACCGCGTGGCACAACAACTGGCGGGCAAACAGTCGTTGCTGATTGGCGTTGCCACCTCCAGTCTGGCCCTGCACGCGCCGTCGCAAATTGTCGCGGCGATTAAATCTCGCGCCGATCAACTGGGTGCCAGCGTGGTGGTGTCGATGGTAGAACGAAGCGGCGTCGAAGCCTGTAAAGCGGCGGTGCACAATCTTCTCGCGCAACGCGTCAGTGGGCTGATCATTAACTATCCGCTGGATGACCAGGATGCCATTGCTGTGGAAGCTGCCTGCACTAATGTTCCGGCGTTATTTCTTGATGTCTCTGACCAGACACCCATCAACAGTATTATTTTCTCCCATGAAGACGGTACGCGACTGGGCGTGGAGCATCTG", "alphabet": "dna", "name": "Independent handoff fixture", "primerSets": [ { "v": 1, "id": "oracle-primer-set", "label": "Independent record contract example", "createdAt": "2026-10-11T00:00:00.000Z", "notes": "", "forward": { "annealing": "CCAGCCACGTTTCTGCGAAA", "tail": "" }, "reverse": { "annealing": "TGCGCGAGAAGATTGTGCAC", "tail": "" }, "conditions": { "oligo_nM": 250, "na_mM": 50, "k_mM": 0, "tris_mM": 0, "mg_mM": 0, "dntp_mM": 0, "model": "primer-excess", "saltCorrection": "owczarzy-2004" }, "witness": { "templateHash": "fd182829946e68ba90d7c14906883ef31f663537dade5f617f804b8ce46dc316", "templateLength": 600, "topology": "linear", "coordinates": "1-based-inclusive-5prime-to-3prime", "forward": { "strand": "+", "start": 158, "end": 177, "length": 20 }, "reverse": { "strand": "-", "start": 428, "end": 409, "length": 20 }, "productId": "+:158:177|-:428:409", "method": "exact-pair-v1" }, "design": { "method": "bounded-flanks-v2", "target": { "start": 201, "end": 400 }, "capped": true, "ranking": { "tmDeviation": 0.06462320381317, "lengthDeviation": 0.0, "deltaTm": 0.03260351198753142, "total": 0.09722671580070141 }, "counts": { "windows": 918, "boundary": 0, "excluded": 0, "gc": 40, "tm": 234, "validForward": 353, "validReverse": 291, "productSize": 0, "deltaTm": 0, "eligiblePairs": 576, "exactChecked": 5, "exactRefused": 0 }, "settings": { "target": { "start": 201, "end": 400 }, "excluded": [], "forwardTail": "", "reverseTail": "", "conditions": { "oligo_nM": 250, "na_mM": 50, "k_mM": 0, "tris_mM": 0, "mg_mM": 0, "dntp_mM": 0, "model": "primer-excess", "saltCorrection": "owczarzy-2004" }, "flank": 50, "minLength": 18, "maxLength": 26, "targetLength": 20, "minTm": 55, "maxTm": 68, "targetTm": 59.95, "maxDeltaTm": 3, "minGc": 30, "maxGc": 70, "minProduct": 180, "maxProduct": 420 }, "structures": [ { "kind": "forward hairpin", "evaluated": false, "dG37": null, "detail": "Not evaluated in this hand-authored reader-contract example." }, { "kind": "reverse hairpin", "evaluated": false, "dG37": null, "detail": "Not evaluated in this hand-authored reader-contract example." }, { "kind": "forward self-dimer", "evaluated": false, "dG37": null, "detail": "Not evaluated in this hand-authored reader-contract example." }, { "kind": "reverse self-dimer", "evaluated": false, "dG37": null, "detail": "Not evaluated in this hand-authored reader-contract example." }, { "kind": "cross-dimer", "evaluated": false, "dG37": null, "detail": "Not evaluated in this hand-authored reader-contract example." } ], "limitations": [ "Reader-contract fixture: no secondary structure calculation is represented." ], "temperatures": { "forward": { "value": 59.99861335790035, "method": "oligo-tm-nearest-neighbour", "version": "1.0.0", "saltCorrection": "owczarzy-2004", "conditions": { "oligo_nM": 250, "na_mM": 50, "k_mM": 0, "tris_mM": 0, "mg_mM": 0, "dntp_mM": 0, "model": "primer-excess", "saltCorrection": "owczarzy-2004" }, "limit": "Monovalent correction: Owczarzy 2004, fitted at 69 mM to 1.02 M Na\u207a. It is also used from 20 to 69 mM, an extrapolation whose error has not been established here: Owczarzy 2008 places typical PCR buffers (20 to 100 mM monovalent) where this equation applies.", "outside": [] }, "reverse": { "value": 59.96600984591282, "method": "oligo-tm-nearest-neighbour", "version": "1.0.0", "saltCorrection": "owczarzy-2004", "conditions": { "oligo_nM": 250, "na_mM": 50, "k_mM": 0, "tris_mM": 0, "mg_mM": 0, "dntp_mM": 0, "model": "primer-excess", "saltCorrection": "owczarzy-2004" }, "limit": "Monovalent correction: Owczarzy 2004, fitted at 69 mM to 1.02 M Na\u207a. It is also used from 20 to 69 mM, an extrapolation whose error has not been established here: Owczarzy 2008 places typical PCR buffers (20 to 100 mM monovalent) where this equation applies.", "outside": [] } } } } ], "sequenceWorkspace": { "v": 1, "text": ">mapping alphabet=dna\nGACACCATCGAATGGCGCAAAACCTTTCGCGGTATGGCATGATAGCGCCCGGAAGAGAGTCAATTCAGGGTGGTGAATGTGAAACCAGTAACGTTATACGATGTCGCAGAGTATGCCGGTGTCTCTTATCAGACCGTTTCCCGCGTGGTGAACCAGGCCAGCCACGTTTCTGCGAAAACGCGGGAAAAAGTGGAAGCGGCGATGGCGGAGCTGAATTACATTCCCAACCGCGTGGCACAACAACTGGCGGGCAAACAGTCGTTGCTGATTGGCGTTGCCACCTCCAGTCTGGCCCTGCACGCGCCGTCGCAAATTGTCGCGGCGATTAAATCTCGCGCCGATCAACTGGGTGCCAGCGTGGTGGTGTCGATGGTAGAACGAAGCGGCGTCGAAGCCTGTAAAGCGGCGGTGCACAATCTTCTCGCGCAACGCGTCAGTGGGCTGATCATTAACTATCCGCTGGATGACCAGGATGCCATTGCTGTGGAAGCTGCCTGCACTAATGTTCCGGCGTTATTTCTTGATGTCTCTGACCAGACACCCATCAACAGTATTATTTTCTCCCATGAAGACGGTACGCGACTGGGCGTGGAGCATCTG\n", "templateText": "", "state": { "alphabet": "dna" }, "sourceContext": "" } }, "expected": { "readable": true, "features": [ { "direction": "forward", "key": "primer_bind", "strand": "+", "location": "158..177", "parts": [ { "start": 158, "end": 177 } ], "extracted": "CCAGCCACGTTTCTGCGAAA", "annealing": "CCAGCCACGTTTCTGCGAAA", "tail": "", "meaning": "recorded-exact-template-site" }, { "direction": "reverse", "key": "primer_bind", "strand": "-", "location": "complement(409..428)", "parts": [ { "start": 409, "end": 428 } ], "extracted": "TGCGCGAGAAGATTGTGCAC", "annealing": "TGCGCGAGAAGATTGTGCAC", "tail": "", "meaning": "recorded-exact-template-site" } ], "placedSets": 1, "skippedSets": 0, "pcrFeatures": 0 }, "note": "Explicit zero K/Tris and defaults in settings are equivalent to normalized retained conditions." }, { "id": "qualification-record-v2-wrong-forward-na", "input": { "v": 2, "app": "sequence-toolkit", "residues": "GACACCATCGAATGGCGCAAAACCTTTCGCGGTATGGCATGATAGCGCCCGGAAGAGAGTCAATTCAGGGTGGTGAATGTGAAACCAGTAACGTTATACGATGTCGCAGAGTATGCCGGTGTCTCTTATCAGACCGTTTCCCGCGTGGTGAACCAGGCCAGCCACGTTTCTGCGAAAACGCGGGAAAAAGTGGAAGCGGCGATGGCGGAGCTGAATTACATTCCCAACCGCGTGGCACAACAACTGGCGGGCAAACAGTCGTTGCTGATTGGCGTTGCCACCTCCAGTCTGGCCCTGCACGCGCCGTCGCAAATTGTCGCGGCGATTAAATCTCGCGCCGATCAACTGGGTGCCAGCGTGGTGGTGTCGATGGTAGAACGAAGCGGCGTCGAAGCCTGTAAAGCGGCGGTGCACAATCTTCTCGCGCAACGCGTCAGTGGGCTGATCATTAACTATCCGCTGGATGACCAGGATGCCATTGCTGTGGAAGCTGCCTGCACTAATGTTCCGGCGTTATTTCTTGATGTCTCTGACCAGACACCCATCAACAGTATTATTTTCTCCCATGAAGACGGTACGCGACTGGGCGTGGAGCATCTG", "alphabet": "dna", "name": "Independent handoff fixture", "primerSets": [ { "v": 1, "id": "oracle-primer-set", "label": "Independent record contract example", "createdAt": "2026-10-11T00:00:00.000Z", "notes": "", "forward": { "annealing": "CCAGCCACGTTTCTGCGAAA", "tail": "" }, "reverse": { "annealing": "TGCGCGAGAAGATTGTGCAC", "tail": "" }, "conditions": { "oligo_nM": 250, "na_mM": 50, "mg_mM": 0, "dntp_mM": 0, "model": "primer-excess", "saltCorrection": "owczarzy-2004" }, "witness": { "templateHash": "fd182829946e68ba90d7c14906883ef31f663537dade5f617f804b8ce46dc316", "templateLength": 600, "topology": "linear", "coordinates": "1-based-inclusive-5prime-to-3prime", "forward": { "strand": "+", "start": 158, "end": 177, "length": 20 }, "reverse": { "strand": "-", "start": 428, "end": 409, "length": 20 }, "productId": "+:158:177|-:428:409", "method": "exact-pair-v1" }, "design": { "method": "bounded-flanks-v2", "target": { "start": 201, "end": 400 }, "capped": true, "ranking": { "tmDeviation": 0.06462320381317, "lengthDeviation": 0.0, "deltaTm": 0.03260351198753142, "total": 0.09722671580070141 }, "counts": { "windows": 918, "boundary": 0, "excluded": 0, "gc": 40, "tm": 234, "validForward": 353, "validReverse": 291, "productSize": 0, "deltaTm": 0, "eligiblePairs": 576, "exactChecked": 5, "exactRefused": 0 }, "settings": { "target": { "start": 201, "end": 400 }, "excluded": [], "forwardTail": "", "reverseTail": "", "conditions": { "oligo_nM": 250, "na_mM": 50, "mg_mM": 0, "dntp_mM": 0, "model": "primer-excess", "saltCorrection": "owczarzy-2004" }, "flank": 50, "minLength": 18, "maxLength": 26, "targetLength": 20, "minTm": 55, "maxTm": 68, "targetTm": 59.95, "maxDeltaTm": 3, "minGc": 30, "maxGc": 70, "minProduct": 180, "maxProduct": 420 }, "structures": [ { "kind": "forward hairpin", "evaluated": false, "dG37": null, "detail": "Not evaluated in this hand-authored reader-contract example." }, { "kind": "reverse hairpin", "evaluated": false, "dG37": null, "detail": "Not evaluated in this hand-authored reader-contract example." }, { "kind": "forward self-dimer", "evaluated": false, "dG37": null, "detail": "Not evaluated in this hand-authored reader-contract example." }, { "kind": "reverse self-dimer", "evaluated": false, "dG37": null, "detail": "Not evaluated in this hand-authored reader-contract example." }, { "kind": "cross-dimer", "evaluated": false, "dG37": null, "detail": "Not evaluated in this hand-authored reader-contract example." } ], "limitations": [ "Reader-contract fixture: no secondary structure calculation is represented." ], "temperatures": { "forward": { "value": 59.99861335790035, "method": "oligo-tm-nearest-neighbour", "version": "1.0.0", "saltCorrection": "owczarzy-2004", "conditions": { "oligo_nM": 250, "na_mM": 10, "k_mM": 0, "tris_mM": 0, "mg_mM": 0, "dntp_mM": 0, "model": "primer-excess", "saltCorrection": "owczarzy-2004" }, "limit": "Monovalent correction: Owczarzy 2004, fitted at 69 mM to 1.02 M Na\u207a. It is also used from 20 to 69 mM, an extrapolation whose error has not been established here: Owczarzy 2008 places typical PCR buffers (20 to 100 mM monovalent) where this equation applies.", "outside": [] }, "reverse": { "value": 59.96600984591282, "method": "oligo-tm-nearest-neighbour", "version": "1.0.0", "saltCorrection": "owczarzy-2004", "conditions": { "oligo_nM": 250, "na_mM": 50, "k_mM": 0, "tris_mM": 0, "mg_mM": 0, "dntp_mM": 0, "model": "primer-excess", "saltCorrection": "owczarzy-2004" }, "limit": "Monovalent correction: Owczarzy 2004, fitted at 69 mM to 1.02 M Na\u207a. It is also used from 20 to 69 mM, an extrapolation whose error has not been established here: Owczarzy 2008 places typical PCR buffers (20 to 100 mM monovalent) where this equation applies.", "outside": [] } } } } ], "sequenceWorkspace": { "v": 1, "text": ">mapping alphabet=dna\nGACACCATCGAATGGCGCAAAACCTTTCGCGGTATGGCATGATAGCGCCCGGAAGAGAGTCAATTCAGGGTGGTGAATGTGAAACCAGTAACGTTATACGATGTCGCAGAGTATGCCGGTGTCTCTTATCAGACCGTTTCCCGCGTGGTGAACCAGGCCAGCCACGTTTCTGCGAAAACGCGGGAAAAAGTGGAAGCGGCGATGGCGGAGCTGAATTACATTCCCAACCGCGTGGCACAACAACTGGCGGGCAAACAGTCGTTGCTGATTGGCGTTGCCACCTCCAGTCTGGCCCTGCACGCGCCGTCGCAAATTGTCGCGGCGATTAAATCTCGCGCCGATCAACTGGGTGCCAGCGTGGTGGTGTCGATGGTAGAACGAAGCGGCGTCGAAGCCTGTAAAGCGGCGGTGCACAATCTTCTCGCGCAACGCGTCAGTGGGCTGATCATTAACTATCCGCTGGATGACCAGGATGCCATTGCTGTGGAAGCTGCCTGCACTAATGTTCCGGCGTTATTTCTTGATGTCTCTGACCAGACACCCATCAACAGTATTATTTTCTCCCATGAAGACGGTACGCGACTGGGCGTGGAGCATCTG\n", "templateText": "", "state": { "alphabet": "dna" }, "sourceContext": "" } }, "expected": { "readable": false, "refusal": "malformed-primer-sets" }, "note": "Forward retained Tm conditions contradict saved conditions." }, { "id": "qualification-record-v2-wrong-reverse-na", "input": { "v": 2, "app": "sequence-toolkit", "residues": "GACACCATCGAATGGCGCAAAACCTTTCGCGGTATGGCATGATAGCGCCCGGAAGAGAGTCAATTCAGGGTGGTGAATGTGAAACCAGTAACGTTATACGATGTCGCAGAGTATGCCGGTGTCTCTTATCAGACCGTTTCCCGCGTGGTGAACCAGGCCAGCCACGTTTCTGCGAAAACGCGGGAAAAAGTGGAAGCGGCGATGGCGGAGCTGAATTACATTCCCAACCGCGTGGCACAACAACTGGCGGGCAAACAGTCGTTGCTGATTGGCGTTGCCACCTCCAGTCTGGCCCTGCACGCGCCGTCGCAAATTGTCGCGGCGATTAAATCTCGCGCCGATCAACTGGGTGCCAGCGTGGTGGTGTCGATGGTAGAACGAAGCGGCGTCGAAGCCTGTAAAGCGGCGGTGCACAATCTTCTCGCGCAACGCGTCAGTGGGCTGATCATTAACTATCCGCTGGATGACCAGGATGCCATTGCTGTGGAAGCTGCCTGCACTAATGTTCCGGCGTTATTTCTTGATGTCTCTGACCAGACACCCATCAACAGTATTATTTTCTCCCATGAAGACGGTACGCGACTGGGCGTGGAGCATCTG", "alphabet": "dna", "name": "Independent handoff fixture", "primerSets": [ { "v": 1, "id": "oracle-primer-set", "label": "Independent record contract example", "createdAt": "2026-10-11T00:00:00.000Z", "notes": "", "forward": { "annealing": "CCAGCCACGTTTCTGCGAAA", "tail": "" }, "reverse": { "annealing": "TGCGCGAGAAGATTGTGCAC", "tail": "" }, "conditions": { "oligo_nM": 250, "na_mM": 50, "mg_mM": 0, "dntp_mM": 0, "model": "primer-excess", "saltCorrection": "owczarzy-2004" }, "witness": { "templateHash": "fd182829946e68ba90d7c14906883ef31f663537dade5f617f804b8ce46dc316", "templateLength": 600, "topology": "linear", "coordinates": "1-based-inclusive-5prime-to-3prime", "forward": { "strand": "+", "start": 158, "end": 177, "length": 20 }, "reverse": { "strand": "-", "start": 428, "end": 409, "length": 20 }, "productId": "+:158:177|-:428:409", "method": "exact-pair-v1" }, "design": { "method": "bounded-flanks-v2", "target": { "start": 201, "end": 400 }, "capped": true, "ranking": { "tmDeviation": 0.06462320381317, "lengthDeviation": 0.0, "deltaTm": 0.03260351198753142, "total": 0.09722671580070141 }, "counts": { "windows": 918, "boundary": 0, "excluded": 0, "gc": 40, "tm": 234, "validForward": 353, "validReverse": 291, "productSize": 0, "deltaTm": 0, "eligiblePairs": 576, "exactChecked": 5, "exactRefused": 0 }, "settings": { "target": { "start": 201, "end": 400 }, "excluded": [], "forwardTail": "", "reverseTail": "", "conditions": { "oligo_nM": 250, "na_mM": 50, "mg_mM": 0, "dntp_mM": 0, "model": "primer-excess", "saltCorrection": "owczarzy-2004" }, "flank": 50, "minLength": 18, "maxLength": 26, "targetLength": 20, "minTm": 55, "maxTm": 68, "targetTm": 59.95, "maxDeltaTm": 3, "minGc": 30, "maxGc": 70, "minProduct": 180, "maxProduct": 420 }, "structures": [ { "kind": "forward hairpin", "evaluated": false, "dG37": null, "detail": "Not evaluated in this hand-authored reader-contract example." }, { "kind": "reverse hairpin", "evaluated": false, "dG37": null, "detail": "Not evaluated in this hand-authored reader-contract example." }, { "kind": "forward self-dimer", "evaluated": false, "dG37": null, "detail": "Not evaluated in this hand-authored reader-contract example." }, { "kind": "reverse self-dimer", "evaluated": false, "dG37": null, "detail": "Not evaluated in this hand-authored reader-contract example." }, { "kind": "cross-dimer", "evaluated": false, "dG37": null, "detail": "Not evaluated in this hand-authored reader-contract example." } ], "limitations": [ "Reader-contract fixture: no secondary structure calculation is represented." ], "temperatures": { "forward": { "value": 59.99861335790035, "method": "oligo-tm-nearest-neighbour", "version": "1.0.0", "saltCorrection": "owczarzy-2004", "conditions": { "oligo_nM": 250, "na_mM": 50, "k_mM": 0, "tris_mM": 0, "mg_mM": 0, "dntp_mM": 0, "model": "primer-excess", "saltCorrection": "owczarzy-2004" }, "limit": "Monovalent correction: Owczarzy 2004, fitted at 69 mM to 1.02 M Na\u207a. It is also used from 20 to 69 mM, an extrapolation whose error has not been established here: Owczarzy 2008 places typical PCR buffers (20 to 100 mM monovalent) where this equation applies.", "outside": [] }, "reverse": { "value": 59.96600984591282, "method": "oligo-tm-nearest-neighbour", "version": "1.0.0", "saltCorrection": "owczarzy-2004", "conditions": { "oligo_nM": 250, "na_mM": 10, "k_mM": 0, "tris_mM": 0, "mg_mM": 0, "dntp_mM": 0, "model": "primer-excess", "saltCorrection": "owczarzy-2004" }, "limit": "Monovalent correction: Owczarzy 2004, fitted at 69 mM to 1.02 M Na\u207a. It is also used from 20 to 69 mM, an extrapolation whose error has not been established here: Owczarzy 2008 places typical PCR buffers (20 to 100 mM monovalent) where this equation applies.", "outside": [] } } } } ], "sequenceWorkspace": { "v": 1, "text": ">mapping alphabet=dna\nGACACCATCGAATGGCGCAAAACCTTTCGCGGTATGGCATGATAGCGCCCGGAAGAGAGTCAATTCAGGGTGGTGAATGTGAAACCAGTAACGTTATACGATGTCGCAGAGTATGCCGGTGTCTCTTATCAGACCGTTTCCCGCGTGGTGAACCAGGCCAGCCACGTTTCTGCGAAAACGCGGGAAAAAGTGGAAGCGGCGATGGCGGAGCTGAATTACATTCCCAACCGCGTGGCACAACAACTGGCGGGCAAACAGTCGTTGCTGATTGGCGTTGCCACCTCCAGTCTGGCCCTGCACGCGCCGTCGCAAATTGTCGCGGCGATTAAATCTCGCGCCGATCAACTGGGTGCCAGCGTGGTGGTGTCGATGGTAGAACGAAGCGGCGTCGAAGCCTGTAAAGCGGCGGTGCACAATCTTCTCGCGCAACGCGTCAGTGGGCTGATCATTAACTATCCGCTGGATGACCAGGATGCCATTGCTGTGGAAGCTGCCTGCACTAATGTTCCGGCGTTATTTCTTGATGTCTCTGACCAGACACCCATCAACAGTATTATTTTCTCCCATGAAGACGGTACGCGACTGGGCGTGGAGCATCTG\n", "templateText": "", "state": { "alphabet": "dna" }, "sourceContext": "" } }, "expected": { "readable": false, "refusal": "malformed-primer-sets" }, "note": "Reverse retained Tm conditions contradict saved conditions." }, { "id": "qualification-record-v2-balanced-settings-na", "input": { "v": 2, "app": "sequence-toolkit", "residues": "GACACCATCGAATGGCGCAAAACCTTTCGCGGTATGGCATGATAGCGCCCGGAAGAGAGTCAATTCAGGGTGGTGAATGTGAAACCAGTAACGTTATACGATGTCGCAGAGTATGCCGGTGTCTCTTATCAGACCGTTTCCCGCGTGGTGAACCAGGCCAGCCACGTTTCTGCGAAAACGCGGGAAAAAGTGGAAGCGGCGATGGCGGAGCTGAATTACATTCCCAACCGCGTGGCACAACAACTGGCGGGCAAACAGTCGTTGCTGATTGGCGTTGCCACCTCCAGTCTGGCCCTGCACGCGCCGTCGCAAATTGTCGCGGCGATTAAATCTCGCGCCGATCAACTGGGTGCCAGCGTGGTGGTGTCGATGGTAGAACGAAGCGGCGTCGAAGCCTGTAAAGCGGCGGTGCACAATCTTCTCGCGCAACGCGTCAGTGGGCTGATCATTAACTATCCGCTGGATGACCAGGATGCCATTGCTGTGGAAGCTGCCTGCACTAATGTTCCGGCGTTATTTCTTGATGTCTCTGACCAGACACCCATCAACAGTATTATTTTCTCCCATGAAGACGGTACGCGACTGGGCGTGGAGCATCTG", "alphabet": "dna", "name": "Independent handoff fixture", "primerSets": [ { "v": 1, "id": "oracle-primer-set", "label": "Independent record contract example", "createdAt": "2026-10-11T00:00:00.000Z", "notes": "", "forward": { "annealing": "CCAGCCACGTTTCTGCGAAA", "tail": "" }, "reverse": { "annealing": "TGCGCGAGAAGATTGTGCAC", "tail": "" }, "conditions": { "oligo_nM": 250, "na_mM": 10, "mg_mM": 0, "dntp_mM": 0, "model": "primer-excess", "saltCorrection": "owczarzy-2004" }, "witness": { "templateHash": "fd182829946e68ba90d7c14906883ef31f663537dade5f617f804b8ce46dc316", "templateLength": 600, "topology": "linear", "coordinates": "1-based-inclusive-5prime-to-3prime", "forward": { "strand": "+", "start": 158, "end": 177, "length": 20 }, "reverse": { "strand": "-", "start": 428, "end": 409, "length": 20 }, "productId": "+:158:177|-:428:409", "method": "exact-pair-v1" }, "design": { "method": "bounded-flanks-v2", "target": { "start": 201, "end": 400 }, "capped": true, "ranking": { "tmDeviation": 0.06462320381317, "lengthDeviation": 0.0, "deltaTm": 0.03260351198753142, "total": 0.09722671580070141 }, "counts": { "windows": 918, "boundary": 0, "excluded": 0, "gc": 40, "tm": 234, "validForward": 353, "validReverse": 291, "productSize": 0, "deltaTm": 0, "eligiblePairs": 576, "exactChecked": 5, "exactRefused": 0 }, "settings": { "target": { "start": 201, "end": 400 }, "excluded": [], "forwardTail": "", "reverseTail": "", "conditions": { "oligo_nM": 250, "na_mM": 10, "mg_mM": 0, "dntp_mM": 0, "model": "primer-excess", "saltCorrection": "owczarzy-2004" }, "flank": 50, "minLength": 18, "maxLength": 26, "targetLength": 20, "minTm": 55, "maxTm": 68, "targetTm": 59.95, "maxDeltaTm": 3, "minGc": 30, "maxGc": 70, "minProduct": 180, "maxProduct": 420 }, "structures": [ { "kind": "forward hairpin", "evaluated": false, "dG37": null, "detail": "Not evaluated in this hand-authored reader-contract example." }, { "kind": "reverse hairpin", "evaluated": false, "dG37": null, "detail": "Not evaluated in this hand-authored reader-contract example." }, { "kind": "forward self-dimer", "evaluated": false, "dG37": null, "detail": "Not evaluated in this hand-authored reader-contract example." }, { "kind": "reverse self-dimer", "evaluated": false, "dG37": null, "detail": "Not evaluated in this hand-authored reader-contract example." }, { "kind": "cross-dimer", "evaluated": false, "dG37": null, "detail": "Not evaluated in this hand-authored reader-contract example." } ], "limitations": [ "Reader-contract fixture: no secondary structure calculation is represented." ], "temperatures": { "forward": { "value": 59.99861335790035, "method": "oligo-tm-nearest-neighbour", "version": "1.0.0", "saltCorrection": "owczarzy-2004", "conditions": { "oligo_nM": 250, "na_mM": 50, "k_mM": 0, "tris_mM": 0, "mg_mM": 0, "dntp_mM": 0, "model": "primer-excess", "saltCorrection": "owczarzy-2004" }, "limit": "Monovalent correction: Owczarzy 2004, fitted at 69 mM to 1.02 M Na\u207a. It is also used from 20 to 69 mM, an extrapolation whose error has not been established here: Owczarzy 2008 places typical PCR buffers (20 to 100 mM monovalent) where this equation applies.", "outside": [] }, "reverse": { "value": 59.96600984591282, "method": "oligo-tm-nearest-neighbour", "version": "1.0.0", "saltCorrection": "owczarzy-2004", "conditions": { "oligo_nM": 250, "na_mM": 50, "k_mM": 0, "tris_mM": 0, "mg_mM": 0, "dntp_mM": 0, "model": "primer-excess", "saltCorrection": "owczarzy-2004" }, "limit": "Monovalent correction: Owczarzy 2004, fitted at 69 mM to 1.02 M Na\u207a. It is also used from 20 to 69 mM, an extrapolation whose error has not been established here: Owczarzy 2008 places typical PCR buffers (20 to 100 mM monovalent) where this equation applies.", "outside": [] } } } } ], "sequenceWorkspace": { "v": 1, "text": ">mapping alphabet=dna\nGACACCATCGAATGGCGCAAAACCTTTCGCGGTATGGCATGATAGCGCCCGGAAGAGAGTCAATTCAGGGTGGTGAATGTGAAACCAGTAACGTTATACGATGTCGCAGAGTATGCCGGTGTCTCTTATCAGACCGTTTCCCGCGTGGTGAACCAGGCCAGCCACGTTTCTGCGAAAACGCGGGAAAAAGTGGAAGCGGCGATGGCGGAGCTGAATTACATTCCCAACCGCGTGGCACAACAACTGGCGGGCAAACAGTCGTTGCTGATTGGCGTTGCCACCTCCAGTCTGGCCCTGCACGCGCCGTCGCAAATTGTCGCGGCGATTAAATCTCGCGCCGATCAACTGGGTGCCAGCGTGGTGGTGTCGATGGTAGAACGAAGCGGCGTCGAAGCCTGTAAAGCGGCGGTGCACAATCTTCTCGCGCAACGCGTCAGTGGGCTGATCATTAACTATCCGCTGGATGACCAGGATGCCATTGCTGTGGAAGCTGCCTGCACTAATGTTCCGGCGTTATTTCTTGATGTCTCTGACCAGACACCCATCAACAGTATTATTTTCTCCCATGAAGACGGTACGCGACTGGGCGTGGAGCATCTG\n", "templateText": "", "state": { "alphabet": "dna" }, "sourceContext": "" } }, "expected": { "readable": false, "refusal": "malformed-primer-sets" }, "note": "Entry and settings both changed to 10 mM, preserving their mutual equality, but both retained Tm records still say 50 mM." }, { "id": "qualification-record-v2-balanced-temperatures-na", "input": { "v": 2, "app": "sequence-toolkit", "residues": "GACACCATCGAATGGCGCAAAACCTTTCGCGGTATGGCATGATAGCGCCCGGAAGAGAGTCAATTCAGGGTGGTGAATGTGAAACCAGTAACGTTATACGATGTCGCAGAGTATGCCGGTGTCTCTTATCAGACCGTTTCCCGCGTGGTGAACCAGGCCAGCCACGTTTCTGCGAAAACGCGGGAAAAAGTGGAAGCGGCGATGGCGGAGCTGAATTACATTCCCAACCGCGTGGCACAACAACTGGCGGGCAAACAGTCGTTGCTGATTGGCGTTGCCACCTCCAGTCTGGCCCTGCACGCGCCGTCGCAAATTGTCGCGGCGATTAAATCTCGCGCCGATCAACTGGGTGCCAGCGTGGTGGTGTCGATGGTAGAACGAAGCGGCGTCGAAGCCTGTAAAGCGGCGGTGCACAATCTTCTCGCGCAACGCGTCAGTGGGCTGATCATTAACTATCCGCTGGATGACCAGGATGCCATTGCTGTGGAAGCTGCCTGCACTAATGTTCCGGCGTTATTTCTTGATGTCTCTGACCAGACACCCATCAACAGTATTATTTTCTCCCATGAAGACGGTACGCGACTGGGCGTGGAGCATCTG", "alphabet": "dna", "name": "Independent handoff fixture", "primerSets": [ { "v": 1, "id": "oracle-primer-set", "label": "Independent record contract example", "createdAt": "2026-10-11T00:00:00.000Z", "notes": "", "forward": { "annealing": "CCAGCCACGTTTCTGCGAAA", "tail": "" }, "reverse": { "annealing": "TGCGCGAGAAGATTGTGCAC", "tail": "" }, "conditions": { "oligo_nM": 250, "na_mM": 50, "mg_mM": 0, "dntp_mM": 0, "model": "primer-excess", "saltCorrection": "owczarzy-2004" }, "witness": { "templateHash": "fd182829946e68ba90d7c14906883ef31f663537dade5f617f804b8ce46dc316", "templateLength": 600, "topology": "linear", "coordinates": "1-based-inclusive-5prime-to-3prime", "forward": { "strand": "+", "start": 158, "end": 177, "length": 20 }, "reverse": { "strand": "-", "start": 428, "end": 409, "length": 20 }, "productId": "+:158:177|-:428:409", "method": "exact-pair-v1" }, "design": { "method": "bounded-flanks-v2", "target": { "start": 201, "end": 400 }, "capped": true, "ranking": { "tmDeviation": 0.06462320381317, "lengthDeviation": 0.0, "deltaTm": 0.03260351198753142, "total": 0.09722671580070141 }, "counts": { "windows": 918, "boundary": 0, "excluded": 0, "gc": 40, "tm": 234, "validForward": 353, "validReverse": 291, "productSize": 0, "deltaTm": 0, "eligiblePairs": 576, "exactChecked": 5, "exactRefused": 0 }, "settings": { "target": { "start": 201, "end": 400 }, "excluded": [], "forwardTail": "", "reverseTail": "", "conditions": { "oligo_nM": 250, "na_mM": 50, "mg_mM": 0, "dntp_mM": 0, "model": "primer-excess", "saltCorrection": "owczarzy-2004" }, "flank": 50, "minLength": 18, "maxLength": 26, "targetLength": 20, "minTm": 55, "maxTm": 68, "targetTm": 59.95, "maxDeltaTm": 3, "minGc": 30, "maxGc": 70, "minProduct": 180, "maxProduct": 420 }, "structures": [ { "kind": "forward hairpin", "evaluated": false, "dG37": null, "detail": "Not evaluated in this hand-authored reader-contract example." }, { "kind": "reverse hairpin", "evaluated": false, "dG37": null, "detail": "Not evaluated in this hand-authored reader-contract example." }, { "kind": "forward self-dimer", "evaluated": false, "dG37": null, "detail": "Not evaluated in this hand-authored reader-contract example." }, { "kind": "reverse self-dimer", "evaluated": false, "dG37": null, "detail": "Not evaluated in this hand-authored reader-contract example." }, { "kind": "cross-dimer", "evaluated": false, "dG37": null, "detail": "Not evaluated in this hand-authored reader-contract example." } ], "limitations": [ "Reader-contract fixture: no secondary structure calculation is represented." ], "temperatures": { "forward": { "value": 59.99861335790035, "method": "oligo-tm-nearest-neighbour", "version": "1.0.0", "saltCorrection": "owczarzy-2004", "conditions": { "oligo_nM": 250, "na_mM": 10, "k_mM": 0, "tris_mM": 0, "mg_mM": 0, "dntp_mM": 0, "model": "primer-excess", "saltCorrection": "owczarzy-2004" }, "limit": "Monovalent correction: Owczarzy 2004, fitted at 69 mM to 1.02 M Na\u207a. It is also used from 20 to 69 mM, an extrapolation whose error has not been established here: Owczarzy 2008 places typical PCR buffers (20 to 100 mM monovalent) where this equation applies.", "outside": [] }, "reverse": { "value": 59.96600984591282, "method": "oligo-tm-nearest-neighbour", "version": "1.0.0", "saltCorrection": "owczarzy-2004", "conditions": { "oligo_nM": 250, "na_mM": 10, "k_mM": 0, "tris_mM": 0, "mg_mM": 0, "dntp_mM": 0, "model": "primer-excess", "saltCorrection": "owczarzy-2004" }, "limit": "Monovalent correction: Owczarzy 2004, fitted at 69 mM to 1.02 M Na\u207a. It is also used from 20 to 69 mM, an extrapolation whose error has not been established here: Owczarzy 2008 places typical PCR buffers (20 to 100 mM monovalent) where this equation applies.", "outside": [] } } } } ], "sequenceWorkspace": { "v": 1, "text": ">mapping alphabet=dna\nGACACCATCGAATGGCGCAAAACCTTTCGCGGTATGGCATGATAGCGCCCGGAAGAGAGTCAATTCAGGGTGGTGAATGTGAAACCAGTAACGTTATACGATGTCGCAGAGTATGCCGGTGTCTCTTATCAGACCGTTTCCCGCGTGGTGAACCAGGCCAGCCACGTTTCTGCGAAAACGCGGGAAAAAGTGGAAGCGGCGATGGCGGAGCTGAATTACATTCCCAACCGCGTGGCACAACAACTGGCGGGCAAACAGTCGTTGCTGATTGGCGTTGCCACCTCCAGTCTGGCCCTGCACGCGCCGTCGCAAATTGTCGCGGCGATTAAATCTCGCGCCGATCAACTGGGTGCCAGCGTGGTGGTGTCGATGGTAGAACGAAGCGGCGTCGAAGCCTGTAAAGCGGCGGTGCACAATCTTCTCGCGCAACGCGTCAGTGGGCTGATCATTAACTATCCGCTGGATGACCAGGATGCCATTGCTGTGGAAGCTGCCTGCACTAATGTTCCGGCGTTATTTCTTGATGTCTCTGACCAGACACCCATCAACAGTATTATTTTCTCCCATGAAGACGGTACGCGACTGGGCGTGGAGCATCTG\n", "templateText": "", "state": { "alphabet": "dna" }, "sourceContext": "" } }, "expected": { "readable": false, "refusal": "malformed-primer-sets" }, "note": "Both retained Tm records changed consistently with one another to 10 mM but contradict saved settings." }, { "id": "qualification-record-v2-wrong-correction-label", "input": { "v": 2, "app": "sequence-toolkit", "residues": "GACACCATCGAATGGCGCAAAACCTTTCGCGGTATGGCATGATAGCGCCCGGAAGAGAGTCAATTCAGGGTGGTGAATGTGAAACCAGTAACGTTATACGATGTCGCAGAGTATGCCGGTGTCTCTTATCAGACCGTTTCCCGCGTGGTGAACCAGGCCAGCCACGTTTCTGCGAAAACGCGGGAAAAAGTGGAAGCGGCGATGGCGGAGCTGAATTACATTCCCAACCGCGTGGCACAACAACTGGCGGGCAAACAGTCGTTGCTGATTGGCGTTGCCACCTCCAGTCTGGCCCTGCACGCGCCGTCGCAAATTGTCGCGGCGATTAAATCTCGCGCCGATCAACTGGGTGCCAGCGTGGTGGTGTCGATGGTAGAACGAAGCGGCGTCGAAGCCTGTAAAGCGGCGGTGCACAATCTTCTCGCGCAACGCGTCAGTGGGCTGATCATTAACTATCCGCTGGATGACCAGGATGCCATTGCTGTGGAAGCTGCCTGCACTAATGTTCCGGCGTTATTTCTTGATGTCTCTGACCAGACACCCATCAACAGTATTATTTTCTCCCATGAAGACGGTACGCGACTGGGCGTGGAGCATCTG", "alphabet": "dna", "name": "Independent handoff fixture", "primerSets": [ { "v": 1, "id": "oracle-primer-set", "label": "Independent record contract example", "createdAt": "2026-10-11T00:00:00.000Z", "notes": "", "forward": { "annealing": "CCAGCCACGTTTCTGCGAAA", "tail": "" }, "reverse": { "annealing": "TGCGCGAGAAGATTGTGCAC", "tail": "" }, "conditions": { "oligo_nM": 250, "na_mM": 50, "mg_mM": 0, "dntp_mM": 0, "model": "primer-excess", "saltCorrection": "owczarzy-2004" }, "witness": { "templateHash": "fd182829946e68ba90d7c14906883ef31f663537dade5f617f804b8ce46dc316", "templateLength": 600, "topology": "linear", "coordinates": "1-based-inclusive-5prime-to-3prime", "forward": { "strand": "+", "start": 158, "end": 177, "length": 20 }, "reverse": { "strand": "-", "start": 428, "end": 409, "length": 20 }, "productId": "+:158:177|-:428:409", "method": "exact-pair-v1" }, "design": { "method": "bounded-flanks-v2", "target": { "start": 201, "end": 400 }, "capped": true, "ranking": { "tmDeviation": 0.06462320381317, "lengthDeviation": 0.0, "deltaTm": 0.03260351198753142, "total": 0.09722671580070141 }, "counts": { "windows": 918, "boundary": 0, "excluded": 0, "gc": 40, "tm": 234, "validForward": 353, "validReverse": 291, "productSize": 0, "deltaTm": 0, "eligiblePairs": 576, "exactChecked": 5, "exactRefused": 0 }, "settings": { "target": { "start": 201, "end": 400 }, "excluded": [], "forwardTail": "", "reverseTail": "", "conditions": { "oligo_nM": 250, "na_mM": 50, "mg_mM": 0, "dntp_mM": 0, "model": "primer-excess", "saltCorrection": "owczarzy-2004" }, "flank": 50, "minLength": 18, "maxLength": 26, "targetLength": 20, "minTm": 55, "maxTm": 68, "targetTm": 59.95, "maxDeltaTm": 3, "minGc": 30, "maxGc": 70, "minProduct": 180, "maxProduct": 420 }, "structures": [ { "kind": "forward hairpin", "evaluated": false, "dG37": null, "detail": "Not evaluated in this hand-authored reader-contract example." }, { "kind": "reverse hairpin", "evaluated": false, "dG37": null, "detail": "Not evaluated in this hand-authored reader-contract example." }, { "kind": "forward self-dimer", "evaluated": false, "dG37": null, "detail": "Not evaluated in this hand-authored reader-contract example." }, { "kind": "reverse self-dimer", "evaluated": false, "dG37": null, "detail": "Not evaluated in this hand-authored reader-contract example." }, { "kind": "cross-dimer", "evaluated": false, "dG37": null, "detail": "Not evaluated in this hand-authored reader-contract example." } ], "limitations": [ "Reader-contract fixture: no secondary structure calculation is represented." ], "temperatures": { "forward": { "value": 59.99861335790035, "method": "oligo-tm-nearest-neighbour", "version": "1.0.0", "saltCorrection": "santalucia-1998", "conditions": { "oligo_nM": 250, "na_mM": 50, "k_mM": 0, "tris_mM": 0, "mg_mM": 0, "dntp_mM": 0, "model": "primer-excess", "saltCorrection": "owczarzy-2004" }, "limit": "Monovalent correction: Owczarzy 2004, fitted at 69 mM to 1.02 M Na\u207a. It is also used from 20 to 69 mM, an extrapolation whose error has not been established here: Owczarzy 2008 places typical PCR buffers (20 to 100 mM monovalent) where this equation applies.", "outside": [] }, "reverse": { "value": 59.96600984591282, "method": "oligo-tm-nearest-neighbour", "version": "1.0.0", "saltCorrection": "owczarzy-2004", "conditions": { "oligo_nM": 250, "na_mM": 50, "k_mM": 0, "tris_mM": 0, "mg_mM": 0, "dntp_mM": 0, "model": "primer-excess", "saltCorrection": "owczarzy-2004" }, "limit": "Monovalent correction: Owczarzy 2004, fitted at 69 mM to 1.02 M Na\u207a. It is also used from 20 to 69 mM, an extrapolation whose error has not been established here: Owczarzy 2008 places typical PCR buffers (20 to 100 mM monovalent) where this equation applies.", "outside": [] } } } } ], "sequenceWorkspace": { "v": 1, "text": ">mapping alphabet=dna\nGACACCATCGAATGGCGCAAAACCTTTCGCGGTATGGCATGATAGCGCCCGGAAGAGAGTCAATTCAGGGTGGTGAATGTGAAACCAGTAACGTTATACGATGTCGCAGAGTATGCCGGTGTCTCTTATCAGACCGTTTCCCGCGTGGTGAACCAGGCCAGCCACGTTTCTGCGAAAACGCGGGAAAAAGTGGAAGCGGCGATGGCGGAGCTGAATTACATTCCCAACCGCGTGGCACAACAACTGGCGGGCAAACAGTCGTTGCTGATTGGCGTTGCCACCTCCAGTCTGGCCCTGCACGCGCCGTCGCAAATTGTCGCGGCGATTAAATCTCGCGCCGATCAACTGGGTGCCAGCGTGGTGGTGTCGATGGTAGAACGAAGCGGCGTCGAAGCCTGTAAAGCGGCGGTGCACAATCTTCTCGCGCAACGCGTCAGTGGGCTGATCATTAACTATCCGCTGGATGACCAGGATGCCATTGCTGTGGAAGCTGCCTGCACTAATGTTCCGGCGTTATTTCTTGATGTCTCTGACCAGACACCCATCAACAGTATTATTTTCTCCCATGAAGACGGTACGCGACTGGGCGTGGAGCATCTG\n", "templateText": "", "state": { "alphabet": "dna" }, "sourceContext": "" } }, "expected": { "readable": false, "refusal": "malformed-primer-sets" }, "note": "Top-level retained correction contradicts its own normalized conditions." }, { "id": "qualification-record-v2-balanced-correction-labels", "input": { "v": 2, "app": "sequence-toolkit", "residues": "GACACCATCGAATGGCGCAAAACCTTTCGCGGTATGGCATGATAGCGCCCGGAAGAGAGTCAATTCAGGGTGGTGAATGTGAAACCAGTAACGTTATACGATGTCGCAGAGTATGCCGGTGTCTCTTATCAGACCGTTTCCCGCGTGGTGAACCAGGCCAGCCACGTTTCTGCGAAAACGCGGGAAAAAGTGGAAGCGGCGATGGCGGAGCTGAATTACATTCCCAACCGCGTGGCACAACAACTGGCGGGCAAACAGTCGTTGCTGATTGGCGTTGCCACCTCCAGTCTGGCCCTGCACGCGCCGTCGCAAATTGTCGCGGCGATTAAATCTCGCGCCGATCAACTGGGTGCCAGCGTGGTGGTGTCGATGGTAGAACGAAGCGGCGTCGAAGCCTGTAAAGCGGCGGTGCACAATCTTCTCGCGCAACGCGTCAGTGGGCTGATCATTAACTATCCGCTGGATGACCAGGATGCCATTGCTGTGGAAGCTGCCTGCACTAATGTTCCGGCGTTATTTCTTGATGTCTCTGACCAGACACCCATCAACAGTATTATTTTCTCCCATGAAGACGGTACGCGACTGGGCGTGGAGCATCTG", "alphabet": "dna", "name": "Independent handoff fixture", "primerSets": [ { "v": 1, "id": "oracle-primer-set", "label": "Independent record contract example", "createdAt": "2026-10-11T00:00:00.000Z", "notes": "", "forward": { "annealing": "CCAGCCACGTTTCTGCGAAA", "tail": "" }, "reverse": { "annealing": "TGCGCGAGAAGATTGTGCAC", "tail": "" }, "conditions": { "oligo_nM": 250, "na_mM": 50, "mg_mM": 0, "dntp_mM": 0, "model": "primer-excess", "saltCorrection": "owczarzy-2004" }, "witness": { "templateHash": "fd182829946e68ba90d7c14906883ef31f663537dade5f617f804b8ce46dc316", "templateLength": 600, "topology": "linear", "coordinates": "1-based-inclusive-5prime-to-3prime", "forward": { "strand": "+", "start": 158, "end": 177, "length": 20 }, "reverse": { "strand": "-", "start": 428, "end": 409, "length": 20 }, "productId": "+:158:177|-:428:409", "method": "exact-pair-v1" }, "design": { "method": "bounded-flanks-v2", "target": { "start": 201, "end": 400 }, "capped": true, "ranking": { "tmDeviation": 0.06462320381317, "lengthDeviation": 0.0, "deltaTm": 0.03260351198753142, "total": 0.09722671580070141 }, "counts": { "windows": 918, "boundary": 0, "excluded": 0, "gc": 40, "tm": 234, "validForward": 353, "validReverse": 291, "productSize": 0, "deltaTm": 0, "eligiblePairs": 576, "exactChecked": 5, "exactRefused": 0 }, "settings": { "target": { "start": 201, "end": 400 }, "excluded": [], "forwardTail": "", "reverseTail": "", "conditions": { "oligo_nM": 250, "na_mM": 50, "mg_mM": 0, "dntp_mM": 0, "model": "primer-excess", "saltCorrection": "owczarzy-2004" }, "flank": 50, "minLength": 18, "maxLength": 26, "targetLength": 20, "minTm": 55, "maxTm": 68, "targetTm": 59.95, "maxDeltaTm": 3, "minGc": 30, "maxGc": 70, "minProduct": 180, "maxProduct": 420 }, "structures": [ { "kind": "forward hairpin", "evaluated": false, "dG37": null, "detail": "Not evaluated in this hand-authored reader-contract example." }, { "kind": "reverse hairpin", "evaluated": false, "dG37": null, "detail": "Not evaluated in this hand-authored reader-contract example." }, { "kind": "forward self-dimer", "evaluated": false, "dG37": null, "detail": "Not evaluated in this hand-authored reader-contract example." }, { "kind": "reverse self-dimer", "evaluated": false, "dG37": null, "detail": "Not evaluated in this hand-authored reader-contract example." }, { "kind": "cross-dimer", "evaluated": false, "dG37": null, "detail": "Not evaluated in this hand-authored reader-contract example." } ], "limitations": [ "Reader-contract fixture: no secondary structure calculation is represented." ], "temperatures": { "forward": { "value": 59.99861335790035, "method": "oligo-tm-nearest-neighbour", "version": "1.0.0", "saltCorrection": "santalucia-1998", "conditions": { "oligo_nM": 250, "na_mM": 50, "k_mM": 0, "tris_mM": 0, "mg_mM": 0, "dntp_mM": 0, "model": "primer-excess", "saltCorrection": "santalucia-1998" }, "limit": "Monovalent correction: Owczarzy 2004, fitted at 69 mM to 1.02 M Na\u207a. It is also used from 20 to 69 mM, an extrapolation whose error has not been established here: Owczarzy 2008 places typical PCR buffers (20 to 100 mM monovalent) where this equation applies.", "outside": [] }, "reverse": { "value": 59.96600984591282, "method": "oligo-tm-nearest-neighbour", "version": "1.0.0", "saltCorrection": "santalucia-1998", "conditions": { "oligo_nM": 250, "na_mM": 50, "k_mM": 0, "tris_mM": 0, "mg_mM": 0, "dntp_mM": 0, "model": "primer-excess", "saltCorrection": "santalucia-1998" }, "limit": "Monovalent correction: Owczarzy 2004, fitted at 69 mM to 1.02 M Na\u207a. It is also used from 20 to 69 mM, an extrapolation whose error has not been established here: Owczarzy 2008 places typical PCR buffers (20 to 100 mM monovalent) where this equation applies.", "outside": [] } } } } ], "sequenceWorkspace": { "v": 1, "text": ">mapping alphabet=dna\nGACACCATCGAATGGCGCAAAACCTTTCGCGGTATGGCATGATAGCGCCCGGAAGAGAGTCAATTCAGGGTGGTGAATGTGAAACCAGTAACGTTATACGATGTCGCAGAGTATGCCGGTGTCTCTTATCAGACCGTTTCCCGCGTGGTGAACCAGGCCAGCCACGTTTCTGCGAAAACGCGGGAAAAAGTGGAAGCGGCGATGGCGGAGCTGAATTACATTCCCAACCGCGTGGCACAACAACTGGCGGGCAAACAGTCGTTGCTGATTGGCGTTGCCACCTCCAGTCTGGCCCTGCACGCGCCGTCGCAAATTGTCGCGGCGATTAAATCTCGCGCCGATCAACTGGGTGCCAGCGTGGTGGTGTCGATGGTAGAACGAAGCGGCGTCGAAGCCTGTAAAGCGGCGGTGCACAATCTTCTCGCGCAACGCGTCAGTGGGCTGATCATTAACTATCCGCTGGATGACCAGGATGCCATTGCTGTGGAAGCTGCCTGCACTAATGTTCCGGCGTTATTTCTTGATGTCTCTGACCAGACACCCATCAACAGTATTATTTTCTCCCATGAAGACGGTACGCGACTGGGCGTGGAGCATCTG\n", "templateText": "", "state": { "alphabet": "dna" }, "sourceContext": "" } }, "expected": { "readable": false, "refusal": "malformed-primer-sets" }, "note": "Both retained top-level and nested corrections changed to SantaLucia; still contradict the saved design conditions." }, { "id": "qualification-record-v2-wrong-concentration", "input": { "v": 2, "app": "sequence-toolkit", "residues": "GACACCATCGAATGGCGCAAAACCTTTCGCGGTATGGCATGATAGCGCCCGGAAGAGAGTCAATTCAGGGTGGTGAATGTGAAACCAGTAACGTTATACGATGTCGCAGAGTATGCCGGTGTCTCTTATCAGACCGTTTCCCGCGTGGTGAACCAGGCCAGCCACGTTTCTGCGAAAACGCGGGAAAAAGTGGAAGCGGCGATGGCGGAGCTGAATTACATTCCCAACCGCGTGGCACAACAACTGGCGGGCAAACAGTCGTTGCTGATTGGCGTTGCCACCTCCAGTCTGGCCCTGCACGCGCCGTCGCAAATTGTCGCGGCGATTAAATCTCGCGCCGATCAACTGGGTGCCAGCGTGGTGGTGTCGATGGTAGAACGAAGCGGCGTCGAAGCCTGTAAAGCGGCGGTGCACAATCTTCTCGCGCAACGCGTCAGTGGGCTGATCATTAACTATCCGCTGGATGACCAGGATGCCATTGCTGTGGAAGCTGCCTGCACTAATGTTCCGGCGTTATTTCTTGATGTCTCTGACCAGACACCCATCAACAGTATTATTTTCTCCCATGAAGACGGTACGCGACTGGGCGTGGAGCATCTG", "alphabet": "dna", "name": "Independent handoff fixture", "primerSets": [ { "v": 1, "id": "oracle-primer-set", "label": "Independent record contract example", "createdAt": "2026-10-11T00:00:00.000Z", "notes": "", "forward": { "annealing": "CCAGCCACGTTTCTGCGAAA", "tail": "" }, "reverse": { "annealing": "TGCGCGAGAAGATTGTGCAC", "tail": "" }, "conditions": { "oligo_nM": 250, "na_mM": 50, "mg_mM": 0, "dntp_mM": 0, "model": "primer-excess", "saltCorrection": "owczarzy-2004" }, "witness": { "templateHash": "fd182829946e68ba90d7c14906883ef31f663537dade5f617f804b8ce46dc316", "templateLength": 600, "topology": "linear", "coordinates": "1-based-inclusive-5prime-to-3prime", "forward": { "strand": "+", "start": 158, "end": 177, "length": 20 }, "reverse": { "strand": "-", "start": 428, "end": 409, "length": 20 }, "productId": "+:158:177|-:428:409", "method": "exact-pair-v1" }, "design": { "method": "bounded-flanks-v2", "target": { "start": 201, "end": 400 }, "capped": true, "ranking": { "tmDeviation": 0.06462320381317, "lengthDeviation": 0.0, "deltaTm": 0.03260351198753142, "total": 0.09722671580070141 }, "counts": { "windows": 918, "boundary": 0, "excluded": 0, "gc": 40, "tm": 234, "validForward": 353, "validReverse": 291, "productSize": 0, "deltaTm": 0, "eligiblePairs": 576, "exactChecked": 5, "exactRefused": 0 }, "settings": { "target": { "start": 201, "end": 400 }, "excluded": [], "forwardTail": "", "reverseTail": "", "conditions": { "oligo_nM": 250, "na_mM": 50, "mg_mM": 0, "dntp_mM": 0, "model": "primer-excess", "saltCorrection": "owczarzy-2004" }, "flank": 50, "minLength": 18, "maxLength": 26, "targetLength": 20, "minTm": 55, "maxTm": 68, "targetTm": 59.95, "maxDeltaTm": 3, "minGc": 30, "maxGc": 70, "minProduct": 180, "maxProduct": 420 }, "structures": [ { "kind": "forward hairpin", "evaluated": false, "dG37": null, "detail": "Not evaluated in this hand-authored reader-contract example." }, { "kind": "reverse hairpin", "evaluated": false, "dG37": null, "detail": "Not evaluated in this hand-authored reader-contract example." }, { "kind": "forward self-dimer", "evaluated": false, "dG37": null, "detail": "Not evaluated in this hand-authored reader-contract example." }, { "kind": "reverse self-dimer", "evaluated": false, "dG37": null, "detail": "Not evaluated in this hand-authored reader-contract example." }, { "kind": "cross-dimer", "evaluated": false, "dG37": null, "detail": "Not evaluated in this hand-authored reader-contract example." } ], "limitations": [ "Reader-contract fixture: no secondary structure calculation is represented." ], "temperatures": { "forward": { "value": 59.99861335790035, "method": "oligo-tm-nearest-neighbour", "version": "1.0.0", "saltCorrection": "owczarzy-2004", "conditions": { "oligo_nM": 500, "na_mM": 50, "k_mM": 0, "tris_mM": 0, "mg_mM": 0, "dntp_mM": 0, "model": "primer-excess", "saltCorrection": "owczarzy-2004" }, "limit": "Monovalent correction: Owczarzy 2004, fitted at 69 mM to 1.02 M Na\u207a. It is also used from 20 to 69 mM, an extrapolation whose error has not been established here: Owczarzy 2008 places typical PCR buffers (20 to 100 mM monovalent) where this equation applies.", "outside": [] }, "reverse": { "value": 59.96600984591282, "method": "oligo-tm-nearest-neighbour", "version": "1.0.0", "saltCorrection": "owczarzy-2004", "conditions": { "oligo_nM": 250, "na_mM": 50, "k_mM": 0, "tris_mM": 0, "mg_mM": 0, "dntp_mM": 0, "model": "primer-excess", "saltCorrection": "owczarzy-2004" }, "limit": "Monovalent correction: Owczarzy 2004, fitted at 69 mM to 1.02 M Na\u207a. It is also used from 20 to 69 mM, an extrapolation whose error has not been established here: Owczarzy 2008 places typical PCR buffers (20 to 100 mM monovalent) where this equation applies.", "outside": [] } } } } ], "sequenceWorkspace": { "v": 1, "text": ">mapping alphabet=dna\nGACACCATCGAATGGCGCAAAACCTTTCGCGGTATGGCATGATAGCGCCCGGAAGAGAGTCAATTCAGGGTGGTGAATGTGAAACCAGTAACGTTATACGATGTCGCAGAGTATGCCGGTGTCTCTTATCAGACCGTTTCCCGCGTGGTGAACCAGGCCAGCCACGTTTCTGCGAAAACGCGGGAAAAAGTGGAAGCGGCGATGGCGGAGCTGAATTACATTCCCAACCGCGTGGCACAACAACTGGCGGGCAAACAGTCGTTGCTGATTGGCGTTGCCACCTCCAGTCTGGCCCTGCACGCGCCGTCGCAAATTGTCGCGGCGATTAAATCTCGCGCCGATCAACTGGGTGCCAGCGTGGTGGTGTCGATGGTAGAACGAAGCGGCGTCGAAGCCTGTAAAGCGGCGGTGCACAATCTTCTCGCGCAACGCGTCAGTGGGCTGATCATTAACTATCCGCTGGATGACCAGGATGCCATTGCTGTGGAAGCTGCCTGCACTAATGTTCCGGCGTTATTTCTTGATGTCTCTGACCAGACACCCATCAACAGTATTATTTTCTCCCATGAAGACGGTACGCGACTGGGCGTGGAGCATCTG\n", "templateText": "", "state": { "alphabet": "dna" }, "sourceContext": "" } }, "expected": { "readable": false, "refusal": "malformed-primer-sets" }, "note": "Retained concentration contradicts saved concentration." }, { "id": "qualification-record-v2-wrong-model", "input": { "v": 2, "app": "sequence-toolkit", "residues": "GACACCATCGAATGGCGCAAAACCTTTCGCGGTATGGCATGATAGCGCCCGGAAGAGAGTCAATTCAGGGTGGTGAATGTGAAACCAGTAACGTTATACGATGTCGCAGAGTATGCCGGTGTCTCTTATCAGACCGTTTCCCGCGTGGTGAACCAGGCCAGCCACGTTTCTGCGAAAACGCGGGAAAAAGTGGAAGCGGCGATGGCGGAGCTGAATTACATTCCCAACCGCGTGGCACAACAACTGGCGGGCAAACAGTCGTTGCTGATTGGCGTTGCCACCTCCAGTCTGGCCCTGCACGCGCCGTCGCAAATTGTCGCGGCGATTAAATCTCGCGCCGATCAACTGGGTGCCAGCGTGGTGGTGTCGATGGTAGAACGAAGCGGCGTCGAAGCCTGTAAAGCGGCGGTGCACAATCTTCTCGCGCAACGCGTCAGTGGGCTGATCATTAACTATCCGCTGGATGACCAGGATGCCATTGCTGTGGAAGCTGCCTGCACTAATGTTCCGGCGTTATTTCTTGATGTCTCTGACCAGACACCCATCAACAGTATTATTTTCTCCCATGAAGACGGTACGCGACTGGGCGTGGAGCATCTG", "alphabet": "dna", "name": "Independent handoff fixture", "primerSets": [ { "v": 1, "id": "oracle-primer-set", "label": "Independent record contract example", "createdAt": "2026-10-11T00:00:00.000Z", "notes": "", "forward": { "annealing": "CCAGCCACGTTTCTGCGAAA", "tail": "" }, "reverse": { "annealing": "TGCGCGAGAAGATTGTGCAC", "tail": "" }, "conditions": { "oligo_nM": 250, "na_mM": 50, "mg_mM": 0, "dntp_mM": 0, "model": "primer-excess", "saltCorrection": "owczarzy-2004" }, "witness": { "templateHash": "fd182829946e68ba90d7c14906883ef31f663537dade5f617f804b8ce46dc316", "templateLength": 600, "topology": "linear", "coordinates": "1-based-inclusive-5prime-to-3prime", "forward": { "strand": "+", "start": 158, "end": 177, "length": 20 }, "reverse": { "strand": "-", "start": 428, "end": 409, "length": 20 }, "productId": "+:158:177|-:428:409", "method": "exact-pair-v1" }, "design": { "method": "bounded-flanks-v2", "target": { "start": 201, "end": 400 }, "capped": true, "ranking": { "tmDeviation": 0.06462320381317, "lengthDeviation": 0.0, "deltaTm": 0.03260351198753142, "total": 0.09722671580070141 }, "counts": { "windows": 918, "boundary": 0, "excluded": 0, "gc": 40, "tm": 234, "validForward": 353, "validReverse": 291, "productSize": 0, "deltaTm": 0, "eligiblePairs": 576, "exactChecked": 5, "exactRefused": 0 }, "settings": { "target": { "start": 201, "end": 400 }, "excluded": [], "forwardTail": "", "reverseTail": "", "conditions": { "oligo_nM": 250, "na_mM": 50, "mg_mM": 0, "dntp_mM": 0, "model": "primer-excess", "saltCorrection": "owczarzy-2004" }, "flank": 50, "minLength": 18, "maxLength": 26, "targetLength": 20, "minTm": 55, "maxTm": 68, "targetTm": 59.95, "maxDeltaTm": 3, "minGc": 30, "maxGc": 70, "minProduct": 180, "maxProduct": 420 }, "structures": [ { "kind": "forward hairpin", "evaluated": false, "dG37": null, "detail": "Not evaluated in this hand-authored reader-contract example." }, { "kind": "reverse hairpin", "evaluated": false, "dG37": null, "detail": "Not evaluated in this hand-authored reader-contract example." }, { "kind": "forward self-dimer", "evaluated": false, "dG37": null, "detail": "Not evaluated in this hand-authored reader-contract example." }, { "kind": "reverse self-dimer", "evaluated": false, "dG37": null, "detail": "Not evaluated in this hand-authored reader-contract example." }, { "kind": "cross-dimer", "evaluated": false, "dG37": null, "detail": "Not evaluated in this hand-authored reader-contract example." } ], "limitations": [ "Reader-contract fixture: no secondary structure calculation is represented." ], "temperatures": { "forward": { "value": 59.99861335790035, "method": "oligo-tm-nearest-neighbour", "version": "1.0.0", "saltCorrection": "owczarzy-2004", "conditions": { "oligo_nM": 250, "na_mM": 50, "k_mM": 0, "tris_mM": 0, "mg_mM": 0, "dntp_mM": 0, "model": "primer-excess", "saltCorrection": "owczarzy-2004" }, "limit": "Monovalent correction: Owczarzy 2004, fitted at 69 mM to 1.02 M Na\u207a. It is also used from 20 to 69 mM, an extrapolation whose error has not been established here: Owczarzy 2008 places typical PCR buffers (20 to 100 mM monovalent) where this equation applies.", "outside": [] }, "reverse": { "value": 59.96600984591282, "method": "oligo-tm-nearest-neighbour", "version": "1.0.0", "saltCorrection": "owczarzy-2004", "conditions": { "oligo_nM": 250, "na_mM": 50, "k_mM": 0, "tris_mM": 0, "mg_mM": 0, "dntp_mM": 0, "model": "equal-strands", "saltCorrection": "owczarzy-2004" }, "limit": "Monovalent correction: Owczarzy 2004, fitted at 69 mM to 1.02 M Na\u207a. It is also used from 20 to 69 mM, an extrapolation whose error has not been established here: Owczarzy 2008 places typical PCR buffers (20 to 100 mM monovalent) where this equation applies.", "outside": [] } } } } ], "sequenceWorkspace": { "v": 1, "text": ">mapping alphabet=dna\nGACACCATCGAATGGCGCAAAACCTTTCGCGGTATGGCATGATAGCGCCCGGAAGAGAGTCAATTCAGGGTGGTGAATGTGAAACCAGTAACGTTATACGATGTCGCAGAGTATGCCGGTGTCTCTTATCAGACCGTTTCCCGCGTGGTGAACCAGGCCAGCCACGTTTCTGCGAAAACGCGGGAAAAAGTGGAAGCGGCGATGGCGGAGCTGAATTACATTCCCAACCGCGTGGCACAACAACTGGCGGGCAAACAGTCGTTGCTGATTGGCGTTGCCACCTCCAGTCTGGCCCTGCACGCGCCGTCGCAAATTGTCGCGGCGATTAAATCTCGCGCCGATCAACTGGGTGCCAGCGTGGTGGTGTCGATGGTAGAACGAAGCGGCGTCGAAGCCTGTAAAGCGGCGGTGCACAATCTTCTCGCGCAACGCGTCAGTGGGCTGATCATTAACTATCCGCTGGATGACCAGGATGCCATTGCTGTGGAAGCTGCCTGCACTAATGTTCCGGCGTTATTTCTTGATGTCTCTGACCAGACACCCATCAACAGTATTATTTTCTCCCATGAAGACGGTACGCGACTGGGCGTGGAGCATCTG\n", "templateText": "", "state": { "alphabet": "dna" }, "sourceContext": "" } }, "expected": { "readable": false, "refusal": "malformed-primer-sets" }, "note": "Retained concentration model contradicts saved model." }, { "id": "qualification-record-v2-missing-temperatures", "input": { "v": 2, "app": "sequence-toolkit", "residues": "GACACCATCGAATGGCGCAAAACCTTTCGCGGTATGGCATGATAGCGCCCGGAAGAGAGTCAATTCAGGGTGGTGAATGTGAAACCAGTAACGTTATACGATGTCGCAGAGTATGCCGGTGTCTCTTATCAGACCGTTTCCCGCGTGGTGAACCAGGCCAGCCACGTTTCTGCGAAAACGCGGGAAAAAGTGGAAGCGGCGATGGCGGAGCTGAATTACATTCCCAACCGCGTGGCACAACAACTGGCGGGCAAACAGTCGTTGCTGATTGGCGTTGCCACCTCCAGTCTGGCCCTGCACGCGCCGTCGCAAATTGTCGCGGCGATTAAATCTCGCGCCGATCAACTGGGTGCCAGCGTGGTGGTGTCGATGGTAGAACGAAGCGGCGTCGAAGCCTGTAAAGCGGCGGTGCACAATCTTCTCGCGCAACGCGTCAGTGGGCTGATCATTAACTATCCGCTGGATGACCAGGATGCCATTGCTGTGGAAGCTGCCTGCACTAATGTTCCGGCGTTATTTCTTGATGTCTCTGACCAGACACCCATCAACAGTATTATTTTCTCCCATGAAGACGGTACGCGACTGGGCGTGGAGCATCTG", "alphabet": "dna", "name": "Independent handoff fixture", "primerSets": [ { "v": 1, "id": "oracle-primer-set", "label": "Independent record contract example", "createdAt": "2026-10-11T00:00:00.000Z", "notes": "", "forward": { "annealing": "CCAGCCACGTTTCTGCGAAA", "tail": "" }, "reverse": { "annealing": "TGCGCGAGAAGATTGTGCAC", "tail": "" }, "conditions": { "oligo_nM": 250, "na_mM": 50, "mg_mM": 0, "dntp_mM": 0, "model": "primer-excess", "saltCorrection": "owczarzy-2004" }, "witness": { "templateHash": "fd182829946e68ba90d7c14906883ef31f663537dade5f617f804b8ce46dc316", "templateLength": 600, "topology": "linear", "coordinates": "1-based-inclusive-5prime-to-3prime", "forward": { "strand": "+", "start": 158, "end": 177, "length": 20 }, "reverse": { "strand": "-", "start": 428, "end": 409, "length": 20 }, "productId": "+:158:177|-:428:409", "method": "exact-pair-v1" }, "design": { "method": "bounded-flanks-v2", "target": { "start": 201, "end": 400 }, "capped": true, "ranking": { "tmDeviation": 0.06462320381317, "lengthDeviation": 0.0, "deltaTm": 0.03260351198753142, "total": 0.09722671580070141 }, "counts": { "windows": 918, "boundary": 0, "excluded": 0, "gc": 40, "tm": 234, "validForward": 353, "validReverse": 291, "productSize": 0, "deltaTm": 0, "eligiblePairs": 576, "exactChecked": 5, "exactRefused": 0 }, "settings": { "target": { "start": 201, "end": 400 }, "excluded": [], "forwardTail": "", "reverseTail": "", "conditions": { "oligo_nM": 250, "na_mM": 50, "mg_mM": 0, "dntp_mM": 0, "model": "primer-excess", "saltCorrection": "owczarzy-2004" }, "flank": 50, "minLength": 18, "maxLength": 26, "targetLength": 20, "minTm": 55, "maxTm": 68, "targetTm": 59.95, "maxDeltaTm": 3, "minGc": 30, "maxGc": 70, "minProduct": 180, "maxProduct": 420 }, "structures": [ { "kind": "forward hairpin", "evaluated": false, "dG37": null, "detail": "Not evaluated in this hand-authored reader-contract example." }, { "kind": "reverse hairpin", "evaluated": false, "dG37": null, "detail": "Not evaluated in this hand-authored reader-contract example." }, { "kind": "forward self-dimer", "evaluated": false, "dG37": null, "detail": "Not evaluated in this hand-authored reader-contract example." }, { "kind": "reverse self-dimer", "evaluated": false, "dG37": null, "detail": "Not evaluated in this hand-authored reader-contract example." }, { "kind": "cross-dimer", "evaluated": false, "dG37": null, "detail": "Not evaluated in this hand-authored reader-contract example." } ], "limitations": [ "Reader-contract fixture: no secondary structure calculation is represented." ] } } ], "sequenceWorkspace": { "v": 1, "text": ">mapping alphabet=dna\nGACACCATCGAATGGCGCAAAACCTTTCGCGGTATGGCATGATAGCGCCCGGAAGAGAGTCAATTCAGGGTGGTGAATGTGAAACCAGTAACGTTATACGATGTCGCAGAGTATGCCGGTGTCTCTTATCAGACCGTTTCCCGCGTGGTGAACCAGGCCAGCCACGTTTCTGCGAAAACGCGGGAAAAAGTGGAAGCGGCGATGGCGGAGCTGAATTACATTCCCAACCGCGTGGCACAACAACTGGCGGGCAAACAGTCGTTGCTGATTGGCGTTGCCACCTCCAGTCTGGCCCTGCACGCGCCGTCGCAAATTGTCGCGGCGATTAAATCTCGCGCCGATCAACTGGGTGCCAGCGTGGTGGTGTCGATGGTAGAACGAAGCGGCGTCGAAGCCTGTAAAGCGGCGGTGCACAATCTTCTCGCGCAACGCGTCAGTGGGCTGATCATTAACTATCCGCTGGATGACCAGGATGCCATTGCTGTGGAAGCTGCCTGCACTAATGTTCCGGCGTTATTTCTTGATGTCTCTGACCAGACACCCATCAACAGTATTATTTTCTCCCATGAAGACGGTACGCGACTGGGCGTGGAGCATCTG\n", "templateText": "", "state": { "alphabet": "dna" }, "sourceContext": "" } }, "expected": { "readable": false, "refusal": "malformed-primer-sets" }, "note": "v2 requires its qualification block." }, { "id": "qualification-record-historical-v1-no-injection", "input": { "v": 2, "app": "sequence-toolkit", "residues": "GACACCATCGAATGGCGCAAAACCTTTCGCGGTATGGCATGATAGCGCCCGGAAGAGAGTCAATTCAGGGTGGTGAATGTGAAACCAGTAACGTTATACGATGTCGCAGAGTATGCCGGTGTCTCTTATCAGACCGTTTCCCGCGTGGTGAACCAGGCCAGCCACGTTTCTGCGAAAACGCGGGAAAAAGTGGAAGCGGCGATGGCGGAGCTGAATTACATTCCCAACCGCGTGGCACAACAACTGGCGGGCAAACAGTCGTTGCTGATTGGCGTTGCCACCTCCAGTCTGGCCCTGCACGCGCCGTCGCAAATTGTCGCGGCGATTAAATCTCGCGCCGATCAACTGGGTGCCAGCGTGGTGGTGTCGATGGTAGAACGAAGCGGCGTCGAAGCCTGTAAAGCGGCGGTGCACAATCTTCTCGCGCAACGCGTCAGTGGGCTGATCATTAACTATCCGCTGGATGACCAGGATGCCATTGCTGTGGAAGCTGCCTGCACTAATGTTCCGGCGTTATTTCTTGATGTCTCTGACCAGACACCCATCAACAGTATTATTTTCTCCCATGAAGACGGTACGCGACTGGGCGTGGAGCATCTG", "alphabet": "dna", "name": "Independent handoff fixture", "primerSets": [ { "v": 1, "id": "oracle-primer-set", "label": "Independent record contract example", "createdAt": "2026-10-11T00:00:00.000Z", "notes": "", "forward": { "annealing": "CCAGCCACGTTTCTGCGAAA", "tail": "" }, "reverse": { "annealing": "TGCGCGAGAAGATTGTGCAC", "tail": "" }, "conditions": { "oligo_nM": 250, "na_mM": 50, "mg_mM": 0, "dntp_mM": 0, "model": "primer-excess", "saltCorrection": "owczarzy-2004" }, "witness": { "templateHash": "fd182829946e68ba90d7c14906883ef31f663537dade5f617f804b8ce46dc316", "templateLength": 600, "topology": "linear", "coordinates": "1-based-inclusive-5prime-to-3prime", "forward": { "strand": "+", "start": 158, "end": 177, "length": 20 }, "reverse": { "strand": "-", "start": 428, "end": 409, "length": 20 }, "productId": "+:158:177|-:428:409", "method": "exact-pair-v1" }, "design": { "method": "bounded-flanks-v1", "target": { "start": 201, "end": 400 }, "capped": true, "ranking": { "tmDeviation": 0.06462320381317, "lengthDeviation": 0.0, "deltaTm": 0.03260351198753142, "total": 0.09722671580070141 }, "counts": { "windows": 918, "boundary": 0, "excluded": 0, "gc": 40, "tm": 234, "validForward": 353, "validReverse": 291, "productSize": 0, "deltaTm": 0, "eligiblePairs": 576, "exactChecked": 5, "exactRefused": 0 }, "settings": { "target": { "start": 201, "end": 400 }, "excluded": [], "forwardTail": "", "reverseTail": "", "conditions": { "oligo_nM": 250, "na_mM": 50, "mg_mM": 0, "dntp_mM": 0, "model": "primer-excess", "saltCorrection": "owczarzy-2004" }, "flank": 50, "minLength": 18, "maxLength": 26, "targetLength": 20, "minTm": 55, "maxTm": 68, "targetTm": 59.95, "maxDeltaTm": 3, "minGc": 30, "maxGc": 70, "minProduct": 180, "maxProduct": 420 }, "structures": [ { "kind": "forward hairpin", "evaluated": false, "dG37": null, "detail": "Not evaluated in this hand-authored reader-contract example." }, { "kind": "reverse hairpin", "evaluated": false, "dG37": null, "detail": "Not evaluated in this hand-authored reader-contract example." }, { "kind": "forward self-dimer", "evaluated": false, "dG37": null, "detail": "Not evaluated in this hand-authored reader-contract example." }, { "kind": "reverse self-dimer", "evaluated": false, "dG37": null, "detail": "Not evaluated in this hand-authored reader-contract example." }, { "kind": "cross-dimer", "evaluated": false, "dG37": null, "detail": "Not evaluated in this hand-authored reader-contract example." } ], "limitations": [ "Reader-contract fixture: no secondary structure calculation is represented." ] } } ], "sequenceWorkspace": { "v": 1, "text": ">mapping alphabet=dna\nGACACCATCGAATGGCGCAAAACCTTTCGCGGTATGGCATGATAGCGCCCGGAAGAGAGTCAATTCAGGGTGGTGAATGTGAAACCAGTAACGTTATACGATGTCGCAGAGTATGCCGGTGTCTCTTATCAGACCGTTTCCCGCGTGGTGAACCAGGCCAGCCACGTTTCTGCGAAAACGCGGGAAAAAGTGGAAGCGGCGATGGCGGAGCTGAATTACATTCCCAACCGCGTGGCACAACAACTGGCGGGCAAACAGTCGTTGCTGATTGGCGTTGCCACCTCCAGTCTGGCCCTGCACGCGCCGTCGCAAATTGTCGCGGCGATTAAATCTCGCGCCGATCAACTGGGTGCCAGCGTGGTGGTGTCGATGGTAGAACGAAGCGGCGTCGAAGCCTGTAAAGCGGCGGTGCACAATCTTCTCGCGCAACGCGTCAGTGGGCTGATCATTAACTATCCGCTGGATGACCAGGATGCCATTGCTGTGGAAGCTGCCTGCACTAATGTTCCGGCGTTATTTCTTGATGTCTCTGACCAGACACCCATCAACAGTATTATTTTCTCCCATGAAGACGGTACGCGACTGGGCGTGGAGCATCTG\n", "templateText": "", "state": { "alphabet": "dna" }, "sourceContext": "" } }, "expected": { "readable": true, "features": [ { "direction": "forward", "key": "primer_bind", "strand": "+", "location": "158..177", "parts": [ { "start": 158, "end": 177 } ], "extracted": "CCAGCCACGTTTCTGCGAAA", "annealing": "CCAGCCACGTTTCTGCGAAA", "tail": "", "meaning": "recorded-exact-template-site" }, { "direction": "reverse", "key": "primer_bind", "strand": "-", "location": "complement(409..428)", "parts": [ { "start": 409, "end": 428 } ], "extracted": "TGCGCGAGAAGATTGTGCAC", "annealing": "TGCGCGAGAAGATTGTGCAC", "tail": "", "meaning": "recorded-exact-template-site" } ], "placedSets": 1, "skippedSets": 0, "pcrFeatures": 0 }, "note": "Historical v1 without temperatures reads byte-equivalent JSON data; reader must not inject present-day Tm qualifications." }, { "id": "qualification-record-v2-historical-text-retained", "input": { "v": 2, "app": "sequence-toolkit", "residues": "GACACCATCGAATGGCGCAAAACCTTTCGCGGTATGGCATGATAGCGCCCGGAAGAGAGTCAATTCAGGGTGGTGAATGTGAAACCAGTAACGTTATACGATGTCGCAGAGTATGCCGGTGTCTCTTATCAGACCGTTTCCCGCGTGGTGAACCAGGCCAGCCACGTTTCTGCGAAAACGCGGGAAAAAGTGGAAGCGGCGATGGCGGAGCTGAATTACATTCCCAACCGCGTGGCACAACAACTGGCGGGCAAACAGTCGTTGCTGATTGGCGTTGCCACCTCCAGTCTGGCCCTGCACGCGCCGTCGCAAATTGTCGCGGCGATTAAATCTCGCGCCGATCAACTGGGTGCCAGCGTGGTGGTGTCGATGGTAGAACGAAGCGGCGTCGAAGCCTGTAAAGCGGCGGTGCACAATCTTCTCGCGCAACGCGTCAGTGGGCTGATCATTAACTATCCGCTGGATGACCAGGATGCCATTGCTGTGGAAGCTGCCTGCACTAATGTTCCGGCGTTATTTCTTGATGTCTCTGACCAGACACCCATCAACAGTATTATTTTCTCCCATGAAGACGGTACGCGACTGGGCGTGGAGCATCTG", "alphabet": "dna", "name": "Independent handoff fixture", "primerSets": [ { "v": 1, "id": "oracle-primer-set", "label": "Independent record contract example", "createdAt": "2026-10-11T00:00:00.000Z", "notes": "", "forward": { "annealing": "CCAGCCACGTTTCTGCGAAA", "tail": "" }, "reverse": { "annealing": "TGCGCGAGAAGATTGTGCAC", "tail": "" }, "conditions": { "oligo_nM": 250, "na_mM": 50, "mg_mM": 0, "dntp_mM": 0, "model": "primer-excess", "saltCorrection": "owczarzy-2004" }, "witness": { "templateHash": "fd182829946e68ba90d7c14906883ef31f663537dade5f617f804b8ce46dc316", "templateLength": 600, "topology": "linear", "coordinates": "1-based-inclusive-5prime-to-3prime", "forward": { "strand": "+", "start": 158, "end": 177, "length": 20 }, "reverse": { "strand": "-", "start": 428, "end": 409, "length": 20 }, "productId": "+:158:177|-:428:409", "method": "exact-pair-v1" }, "design": { "method": "bounded-flanks-v2", "target": { "start": 201, "end": 400 }, "capped": true, "ranking": { "tmDeviation": 0.06462320381317, "lengthDeviation": 0.0, "deltaTm": 0.03260351198753142, "total": 0.09722671580070141 }, "counts": { "windows": 918, "boundary": 0, "excluded": 0, "gc": 40, "tm": 234, "validForward": 353, "validReverse": 291, "productSize": 0, "deltaTm": 0, "eligiblePairs": 576, "exactChecked": 5, "exactRefused": 0 }, "settings": { "target": { "start": 201, "end": 400 }, "excluded": [], "forwardTail": "", "reverseTail": "", "conditions": { "oligo_nM": 250, "na_mM": 50, "mg_mM": 0, "dntp_mM": 0, "model": "primer-excess", "saltCorrection": "owczarzy-2004" }, "flank": 50, "minLength": 18, "maxLength": 26, "targetLength": 20, "minTm": 55, "maxTm": 68, "targetTm": 59.95, "maxDeltaTm": 3, "minGc": 30, "maxGc": 70, "minProduct": 180, "maxProduct": 420 }, "structures": [ { "kind": "forward hairpin", "evaluated": false, "dG37": null, "detail": "Not evaluated in this hand-authored reader-contract example." }, { "kind": "reverse hairpin", "evaluated": false, "dG37": null, "detail": "Not evaluated in this hand-authored reader-contract example." }, { "kind": "forward self-dimer", "evaluated": false, "dG37": null, "detail": "Not evaluated in this hand-authored reader-contract example." }, { "kind": "reverse self-dimer", "evaluated": false, "dG37": null, "detail": "Not evaluated in this hand-authored reader-contract example." }, { "kind": "cross-dimer", "evaluated": false, "dG37": null, "detail": "Not evaluated in this hand-authored reader-contract example." } ], "limitations": [ "Reader-contract fixture: no secondary structure calculation is represented." ], "temperatures": { "forward": { "value": 59.99861335790035, "method": "oligo-tm-nearest-neighbour", "version": "1.0.0", "saltCorrection": "owczarzy-2004", "conditions": { "oligo_nM": 250, "na_mM": 50, "k_mM": 0, "tris_mM": 0, "mg_mM": 0, "dntp_mM": 0, "model": "primer-excess", "saltCorrection": "owczarzy-2004" }, "limit": "Historical qualification as saved.", "outside": [ "Historical outside note as saved." ] }, "reverse": { "value": 59.96600984591282, "method": "oligo-tm-nearest-neighbour", "version": "1.0.0", "saltCorrection": "owczarzy-2004", "conditions": { "oligo_nM": 250, "na_mM": 50, "k_mM": 0, "tris_mM": 0, "mg_mM": 0, "dntp_mM": 0, "model": "primer-excess", "saltCorrection": "owczarzy-2004" }, "limit": "Monovalent correction: Owczarzy 2004, fitted at 69 mM to 1.02 M Na\u207a. It is also used from 20 to 69 mM, an extrapolation whose error has not been established here: Owczarzy 2008 places typical PCR buffers (20 to 100 mM monovalent) where this equation applies.", "outside": [] } } } } ], "sequenceWorkspace": { "v": 1, "text": ">mapping alphabet=dna\nGACACCATCGAATGGCGCAAAACCTTTCGCGGTATGGCATGATAGCGCCCGGAAGAGAGTCAATTCAGGGTGGTGAATGTGAAACCAGTAACGTTATACGATGTCGCAGAGTATGCCGGTGTCTCTTATCAGACCGTTTCCCGCGTGGTGAACCAGGCCAGCCACGTTTCTGCGAAAACGCGGGAAAAAGTGGAAGCGGCGATGGCGGAGCTGAATTACATTCCCAACCGCGTGGCACAACAACTGGCGGGCAAACAGTCGTTGCTGATTGGCGTTGCCACCTCCAGTCTGGCCCTGCACGCGCCGTCGCAAATTGTCGCGGCGATTAAATCTCGCGCCGATCAACTGGGTGCCAGCGTGGTGGTGTCGATGGTAGAACGAAGCGGCGTCGAAGCCTGTAAAGCGGCGGTGCACAATCTTCTCGCGCAACGCGTCAGTGGGCTGATCATTAACTATCCGCTGGATGACCAGGATGCCATTGCTGTGGAAGCTGCCTGCACTAATGTTCCGGCGTTATTTCTTGATGTCTCTGACCAGACACCCATCAACAGTATTATTTTCTCCCATGAAGACGGTACGCGACTGGGCGTGGAGCATCTG\n", "templateText": "", "state": { "alphabet": "dna" }, "sourceContext": "" } }, "expected": { "readable": true, "features": [ { "direction": "forward", "key": "primer_bind", "strand": "+", "location": "158..177", "parts": [ { "start": 158, "end": 177 } ], "extracted": "CCAGCCACGTTTCTGCGAAA", "annealing": "CCAGCCACGTTTCTGCGAAA", "tail": "", "meaning": "recorded-exact-template-site" }, { "direction": "reverse", "key": "primer_bind", "strand": "-", "location": "complement(409..428)", "parts": [ { "start": 409, "end": 428 } ], "extracted": "TGCGCGAGAAGATTGTGCAC", "annealing": "TGCGCGAGAAGATTGTGCAC", "tail": "", "meaning": "recorded-exact-template-site" } ], "placedSets": 1, "skippedSets": 0, "pcrFeatures": 0 }, "note": "Reader preserves bounded saved qualification text and version; it must not replace historical text with current copy or claim to recompute Tm." } ] }