{
 "about": {
  "method": "golden-gate (src/lib/seq/golden-gate.ts)",
  "oracle": "Pieces wrapped with Type IIS cassettes around a chosen scarless product and distinct non-palindromic overhangs; Bio.Restriction 1.88 (REBASE-derived, never shipped) digests each piece and confirms the released overhangs and that the product carries no recognition site; reverse complements by Biopython.",
  "recordedOn": "2026-10-10",
  "generatedBy": "pipeline/plasmid-map/golden-gate.py",
  "convention": "BsaI GGTCTC(1/5) and BsmBI CGTCTC(1/5) leave 4 nt 5' overhangs and cut outside the site, so the recognition sites leave on the discarded flanks and the product is scarless. The TS engine's product is compared up to rotation and strand. A part and its reverse complement are one double-stranded molecule, so a part supplied on the other strand gives the same product, with that piece joining in the '-' orientation (defect list B6). Refused: a palindromic overhang, a duplicate or reverse-complement overhang, an unresolved internal site, a cut off a linear end. No fidelity figure; a designed product is not evidence that the reaction occurred.",
  "ruling": "CSO, 10 October 2026 (docs/board/memos/2026-10-10-cso-wave2-cloning.md §2.1 M7)."
 },
 "positive": [
  {
   "id": "bsai-two-part",
   "enzyme": "BsaI",
   "note": "Two parts into a destination with BsaI: three distinct 5' overhangs, the recognition sites on the discarded flanks, a scarless product.",
   "vector": {
    "sequence": "GGGGGGAAAAATGCAGAGACCAAAAAAGGTCTCTTTCA",
    "circular": true,
    "name": "destination"
   },
   "parts": [
    {
     "sequence": "AAGGTCTCTATGCTTTTTCCCCCACCTAGAGACCAA",
     "circular": false,
     "name": "part 1"
    },
    {
     "sequence": "AAGGTCTCTACCTAAGGTTACGTTTCAAGAGACCAA",
     "circular": false,
     "name": "part 2"
    }
   ],
   "product": "GGGGGGAAAAATGCTTTTTCCCCCACCTAAGGTTACGTTTCA",
   "overhangs": [
    "ATGC",
    "ACCT",
    "TTCA"
   ],
   "productHash": "34d38fcaa4a9f23d2285a38c2270f24e83233b12de1127a37663aab1760c0f1c"
  },
  {
   "id": "bsmbi-one-part",
   "enzyme": "BsmBI",
   "note": "One part into a destination with BsmBI: two distinct overhangs, scarless.",
   "vector": {
    "sequence": "CCCCCCGGGGAGGAAGAGACGAAAAAACGTCTCTTCCA",
    "circular": true,
    "name": "destination"
   },
   "parts": [
    {
     "sequence": "AACGTCTCTAGGAATATGCGCATTCCAAGAGACGAA",
     "circular": false,
     "name": "insert"
    }
   ],
   "product": "CCCCCCGGGGAGGAATATGCGCATTCCA",
   "overhangs": [
    "AGGA",
    "TCCA"
   ],
   "productHash": "97efce5501dd2dc7cc7049f3decd94fc3281483cb14ca2760e26aeb631ee44b6"
  },
  {
   "id": "bsai-two-part-reversed-part",
   "enzyme": "BsaI",
   "note": "The two-part BsaI design with part 2 supplied on the other strand: the same physical part, so the same scarless product, with part 2 joining in the '-' orientation.",
   "vector": {
    "sequence": "GGGGGGAAAAATGCAGAGACCAAAAAAGGTCTCTTTCA",
    "circular": true,
    "name": "destination"
   },
   "parts": [
    {
     "sequence": "AAGGTCTCTATGCTTTTTCCCCCACCTAGAGACCAA",
     "circular": false,
     "name": "part 1"
    },
    {
     "sequence": "TTGGTCTCTTGAAACGTAACCTTAGGTAGAGACCTT",
     "circular": false,
     "name": "part 2 (other strand)"
    }
   ],
   "product": "GGGGGGAAAAATGCTTTTTCCCCCACCTAAGGTTACGTTTCA",
   "overhangs": [
    "ATGC",
    "ACCT",
    "TTCA"
   ],
   "orientations": [
    "+",
    "+",
    "-"
   ],
   "productHash": "34d38fcaa4a9f23d2285a38c2270f24e83233b12de1127a37663aab1760c0f1c"
  }
 ],
 "refusals": [
  {
   "id": "palindromic-overhang",
   "enzyme": "BsaI",
   "reason": "palindromic-overhang",
   "note": "A part designed with the palindromic overhang GATC can ligate either way: refused, not warned.",
   "vector": {
    "sequence": "GGGGGGAAAAGATCAGAGACCAAAAAAGGTCTCTTTCA",
    "circular": true,
    "name": "destination"
   },
   "parts": [
    {
     "sequence": "AAGGTCTCTGATCTTTTTCCCCCTTCAAGAGACCAA",
     "circular": false,
     "name": "part"
    }
   ]
  },
  {
   "id": "duplicate-overhang",
   "enzyme": "BsaI",
   "reason": "duplicate-overhang",
   "note": "Two parts share the overhang ACCT, so more than one assembly order exists: refused.",
   "vector": {
    "sequence": "GGGGGGAAAAATGCAGAGACCAAAAAAGGTCTCTTTCA",
    "circular": true,
    "name": "destination"
   },
   "parts": [
    {
     "sequence": "AAGGTCTCTATGCTTTTTCCCCCACCTAGAGACCAA",
     "circular": false,
     "name": "part 1"
    },
    {
     "sequence": "AAGGTCTCTATGCAAGGTTACGTACCTAGAGACCAA",
     "circular": false,
     "name": "part 2"
    }
   ]
  },
  {
   "id": "internal-site",
   "enzyme": "BsaI",
   "reason": "internal-site",
   "note": "A part with a BsaI site inside its core: refused, never domesticated silently.",
   "vector": {
    "sequence": "GGGGGGAAAAATGCAGAGACCAAAAAAGGTCTCTTTCA",
    "circular": true,
    "name": "destination"
   },
   "parts": [
    {
     "sequence": "AAGGTCTCTATGCTTGGTCTCGATTCAAGAGACCAA",
     "circular": false,
     "name": "part"
    }
   ]
  },
  {
   "id": "off-linear-end",
   "enzyme": "BsaI",
   "reason": "off-end",
   "note": "A BsaI recognition sequence near a linear part's end whose cut falls off it: Biopython reports no usable cut; refused, never wrapped.",
   "vector": {
    "sequence": "GGGGGGAAAAATGCAGAGACCAAAAAAGGTCTCTTTCA",
    "circular": true,
    "name": "destination"
   },
   "parts": [
    {
     "sequence": "AAGGTCTCTATGCTTTTTCCCCCTTCAGGTCTC",
     "circular": false,
     "name": "part"
    }
   ]
  }
 ]
}