{
  "about": {
    "generatedBy": "pipeline/plasmid-map/assembly-record-refusals.py",
    "recordedOn": "2026-10-11",
    "source": "assembly-record-v2.json",
    "sourceSha256": "b736ab30823ff07dfebda748a638764e6097f1572a23f6e65775c12ed2c68648",
    "oracle": "Independent Python string lengths, parent roles and junction-count invariants; explicit malformed-record mutations of pinned positive controls.",
    "meaning": "Record integrity, not evidence that an assembly reaction occurred."
  },
  "cases": [
    {
      "id": "control-restriction-cloning",
      "input": {
        "v": 1,
        "app": "plasmid-map",
        "residues": "GAATTCCCCATGCCCAAGCTTTTTTTTTTTT",
        "alphabet": "dna-circular",
        "name": "vector + insert (designed)",
        "source": {
          "kind": "assembly",
          "method": "restriction-cloning",
          "from": [
            "vector",
            "insert"
          ]
        },
        "recordFeatures": [],
        "edits": [],
        "meth": "dam-dcm",
        "enz": [],
        "dig": [],
        "insert": null,
        "data": {
          "features": "1",
          "enzymes": "1",
          "primers": "1"
        },
        "assembly": {
          "v": 1,
          "method": "restriction-cloning",
          "methodVersion": "1.0.0",
          "release": "f1.e1.p1",
          "host": "dam-dcm",
          "topology": "circular",
          "productSha256": "362bc5695412e7cac9774bcaca765ce1296701cd900cba0f1d5c831824e436d9",
          "inputs": [
            {
              "name": "vector",
              "role": "vector",
              "sequence": "GAATTCGGGAAGCTTTTTTTTTTTT",
              "circular": true,
              "sha256": "6d97aebff6eb9531ac1a530a6ad79be087377035135007907f579b5e699bbb56",
              "ref": "mine:construct/parent-1"
            },
            {
              "name": "insert",
              "role": "insert",
              "sequence": "AGAATTCCCCATGCCCAAGCTTA",
              "circular": false,
              "sha256": "8774cb77ae23ae71fbabd095f8a0c7c80ddbdee10e596e7eddf61331064e3afa",
              "ref": "mine:construct/parent-2"
            }
          ],
          "enzymes": [
            "EcoRI",
            "HindIII"
          ],
          "orientation": 0,
          "products": 1,
          "junctions": [
            {
              "upstream": "5' AATT",
              "downstream": "5' AATT",
              "overhang": "AATT"
            },
            {
              "upstream": "5' AGCT",
              "downstream": "5' AGCT",
              "overhang": "AGCT"
            }
          ],
          "conserved": {
            "coreBases": 23,
            "overhangs": 8,
            "product": 31
          },
          "qualifications": [],
          "designedAt": "2026-10-11T12:00:00.000Z",
          "statement": "A designed product is not evidence that the reaction occurred."
        }
      },
      "independent": {
        "inputBases": 48,
        "junctionBases": 8,
        "productBases": 31,
        "inputCount": 2,
        "junctionCount": 2
      },
      "expected": {
        "readable": true,
        "reason": null
      }
    },
    {
      "id": "control-gibson-style",
      "input": {
        "v": 1,
        "app": "plasmid-map",
        "residues": "GTAACTAGTAATAAAAATTGTAATACTGTGCCAACGACACGCCTTCAGGCCGCCCGATATCGTTACCTCTGCTCATTTTT",
        "alphabet": "dna",
        "name": "left + right (designed)",
        "source": {
          "kind": "assembly",
          "method": "gibson-style",
          "from": [
            "left",
            "right"
          ]
        },
        "recordFeatures": [],
        "edits": [],
        "meth": "dam-dcm",
        "enz": [],
        "dig": [],
        "insert": null,
        "data": {
          "features": "1",
          "enzymes": "1",
          "primers": "1"
        },
        "assembly": {
          "v": 1,
          "method": "gibson-style",
          "methodVersion": "1.0.0",
          "release": "f1.e1.p1",
          "host": "dam-dcm",
          "topology": "linear",
          "productSha256": "87c5e3d5f1f3816940f8d47f96cfeb41c34cf425d94e1d24c2e047f000ff82a2",
          "inputs": [
            {
              "name": "left",
              "role": "fragment",
              "sequence": "GTAACTAGTAATAAAAATTGTAATACTGTGCCAACGACACGCCTTCAGGCCGCCC",
              "circular": false,
              "sha256": "02a2ac6fba5e74b9fa87a6e6aec12b2af58ed2decad1a0d9f937dd3e43909974",
              "ref": "mine:construct/parent-1"
            },
            {
              "name": "right",
              "role": "fragment",
              "sequence": "GCCTTCAGGCCGCCCGATATCGTTACCTCTGCTCATTTTT",
              "circular": false,
              "sha256": "5ce23b282f22960f41f8a928dd690c53fd82495e24f2bf8d92c34da6235d9ba2",
              "ref": "mine:construct/parent-2"
            }
          ],
          "enzymes": [],
          "orientation": 0,
          "products": 1,
          "junctions": [
            {
              "upstream": "left",
              "downstream": "right",
              "overhang": "GCCTTCAGGCCGCCC"
            }
          ],
          "conserved": {
            "fragmentBases": 95,
            "overlaps": 15,
            "product": 80
          },
          "qualifications": [],
          "designedAt": "2026-10-11T12:00:00.000Z",
          "statement": "A designed product is not evidence that the reaction occurred."
        }
      },
      "independent": {
        "inputBases": 95,
        "junctionBases": 15,
        "productBases": 80,
        "inputCount": 2,
        "junctionCount": 1
      },
      "expected": {
        "readable": true,
        "reason": null
      }
    },
    {
      "id": "control-golden-gate",
      "input": {
        "v": 1,
        "app": "plasmid-map",
        "residues": "CCCCCCGGGGAGGAATATGCGCATTCCA",
        "alphabet": "dna-circular",
        "name": "Golden Gate designed product",
        "source": {
          "kind": "assembly",
          "method": "golden-gate",
          "from": [
            "destination",
            "insert"
          ]
        },
        "recordFeatures": [],
        "edits": [],
        "meth": "dam-dcm",
        "enz": [],
        "dig": [],
        "insert": null,
        "data": {
          "features": "1",
          "enzymes": "1",
          "primers": "1"
        },
        "assembly": {
          "v": 1,
          "method": "golden-gate",
          "methodVersion": "1.0.0",
          "release": "f1.e1.p1",
          "host": "dam-dcm",
          "topology": "circular",
          "productSha256": "97efce5501dd2dc7cc7049f3decd94fc3281483cb14ca2760e26aeb631ee44b6",
          "inputs": [
            {
              "name": "destination",
              "role": "destination",
              "sequence": "CCCCCCGGGGAGGAAGAGACGAAAAAACGTCTCTTCCA",
              "circular": true,
              "sha256": "3875614c1bb2874726b7f93f3f7e307da3277dcecc7584e3cada1e4a6a073f7d",
              "ref": "mine:construct/golden-parent-0"
            },
            {
              "name": "insert",
              "role": "part",
              "sequence": "AACGTCTCTAGGAATATGCGCATTCCAAGAGACGAA",
              "circular": false,
              "sha256": "fcf75bec685c96b96ef23c740edf7c76ebcc384294af94535f632088721ba0a8",
              "ref": "mine:construct/golden-parent-1"
            }
          ],
          "enzymes": [
            "BsmBI"
          ],
          "orientation": 0,
          "products": 1,
          "junctions": [
            {
              "upstream": "5' TCCT",
              "downstream": "5' AGGA",
              "overhang": "TCCT"
            },
            {
              "upstream": "5' TGGA",
              "downstream": "5' TCCA",
              "overhang": "TGGA"
            }
          ],
          "conserved": {
            "coreBases": 20,
            "overhangs": 8,
            "product": 28
          },
          "qualifications": [],
          "designedAt": "2026-10-11T12:00:00.000Z",
          "statement": "A designed product is not evidence that the reaction occurred."
        }
      },
      "independent": {
        "inputBases": 74,
        "junctionBases": 8,
        "productBases": 28,
        "inputCount": 2,
        "junctionCount": 2
      },
      "expected": {
        "readable": true,
        "reason": null
      }
    },
    {
      "id": "gibson-balanced-false-accounting",
      "input": {
        "v": 1,
        "app": "plasmid-map",
        "residues": "GTAACTAGTAATAAAAATTGTAATACTGTGCCAACGACACGCCTTCAGGCCGCCCGATATCGTTACCTCTGCTCATTTTT",
        "alphabet": "dna",
        "name": "left + right (designed)",
        "source": {
          "kind": "assembly",
          "method": "gibson-style",
          "from": [
            "left",
            "right"
          ]
        },
        "recordFeatures": [],
        "edits": [],
        "meth": "dam-dcm",
        "enz": [],
        "dig": [],
        "insert": null,
        "data": {
          "features": "1",
          "enzymes": "1",
          "primers": "1"
        },
        "assembly": {
          "v": 1,
          "method": "gibson-style",
          "methodVersion": "1.0.0",
          "release": "f1.e1.p1",
          "host": "dam-dcm",
          "topology": "linear",
          "productSha256": "87c5e3d5f1f3816940f8d47f96cfeb41c34cf425d94e1d24c2e047f000ff82a2",
          "inputs": [
            {
              "name": "left",
              "role": "fragment",
              "sequence": "GTAACTAGTAATAAAAATTGTAATACTGTGCCAACGACACGCCTTCAGGCCGCCC",
              "circular": false,
              "sha256": "02a2ac6fba5e74b9fa87a6e6aec12b2af58ed2decad1a0d9f937dd3e43909974",
              "ref": "mine:construct/parent-1"
            },
            {
              "name": "right",
              "role": "fragment",
              "sequence": "GCCTTCAGGCCGCCCGATATCGTTACCTCTGCTCATTTTT",
              "circular": false,
              "sha256": "5ce23b282f22960f41f8a928dd690c53fd82495e24f2bf8d92c34da6235d9ba2",
              "ref": "mine:construct/parent-2"
            }
          ],
          "enzymes": [],
          "orientation": 0,
          "products": 1,
          "junctions": [
            {
              "upstream": "left",
              "downstream": "right",
              "overhang": "GCCTTCAGGCCGCCC"
            }
          ],
          "conserved": {
            "fragmentBases": 96,
            "overlaps": 16,
            "product": 80
          },
          "qualifications": [],
          "designedAt": "2026-10-11T12:00:00.000Z",
          "statement": "A designed product is not evidence that the reaction occurred."
        }
      },
      "independent": {
        "inputBases": 95,
        "junctionBases": 15,
        "productBases": 80,
        "inputCount": 2,
        "junctionCount": 1
      },
      "expected": {
        "readable": false,
        "reason": "input-and-junction-accounting"
      }
    },
    {
      "id": "gibson-junction-sequence-length",
      "input": {
        "v": 1,
        "app": "plasmid-map",
        "residues": "GTAACTAGTAATAAAAATTGTAATACTGTGCCAACGACACGCCTTCAGGCCGCCCGATATCGTTACCTCTGCTCATTTTT",
        "alphabet": "dna",
        "name": "left + right (designed)",
        "source": {
          "kind": "assembly",
          "method": "gibson-style",
          "from": [
            "left",
            "right"
          ]
        },
        "recordFeatures": [],
        "edits": [],
        "meth": "dam-dcm",
        "enz": [],
        "dig": [],
        "insert": null,
        "data": {
          "features": "1",
          "enzymes": "1",
          "primers": "1"
        },
        "assembly": {
          "v": 1,
          "method": "gibson-style",
          "methodVersion": "1.0.0",
          "release": "f1.e1.p1",
          "host": "dam-dcm",
          "topology": "linear",
          "productSha256": "87c5e3d5f1f3816940f8d47f96cfeb41c34cf425d94e1d24c2e047f000ff82a2",
          "inputs": [
            {
              "name": "left",
              "role": "fragment",
              "sequence": "GTAACTAGTAATAAAAATTGTAATACTGTGCCAACGACACGCCTTCAGGCCGCCC",
              "circular": false,
              "sha256": "02a2ac6fba5e74b9fa87a6e6aec12b2af58ed2decad1a0d9f937dd3e43909974",
              "ref": "mine:construct/parent-1"
            },
            {
              "name": "right",
              "role": "fragment",
              "sequence": "GCCTTCAGGCCGCCCGATATCGTTACCTCTGCTCATTTTT",
              "circular": false,
              "sha256": "5ce23b282f22960f41f8a928dd690c53fd82495e24f2bf8d92c34da6235d9ba2",
              "ref": "mine:construct/parent-2"
            }
          ],
          "enzymes": [],
          "orientation": 0,
          "products": 1,
          "junctions": [
            {
              "upstream": "left",
              "downstream": "right",
              "overhang": "GCCTTCAGGCCGCCCA"
            }
          ],
          "conserved": {
            "fragmentBases": 95,
            "overlaps": 15,
            "product": 80
          },
          "qualifications": [],
          "designedAt": "2026-10-11T12:00:00.000Z",
          "statement": "A designed product is not evidence that the reaction occurred."
        }
      },
      "independent": {
        "inputBases": 95,
        "junctionBases": 16,
        "productBases": 80,
        "inputCount": 2,
        "junctionCount": 1
      },
      "expected": {
        "readable": false,
        "reason": "junction-accounting"
      }
    },
    {
      "id": "restriction-cloning-balanced-false-accounting",
      "input": {
        "v": 1,
        "app": "plasmid-map",
        "residues": "GAATTCCCCATGCCCAAGCTTTTTTTTTTTT",
        "alphabet": "dna-circular",
        "name": "vector + insert (designed)",
        "source": {
          "kind": "assembly",
          "method": "restriction-cloning",
          "from": [
            "vector",
            "insert"
          ]
        },
        "recordFeatures": [],
        "edits": [],
        "meth": "dam-dcm",
        "enz": [],
        "dig": [],
        "insert": null,
        "data": {
          "features": "1",
          "enzymes": "1",
          "primers": "1"
        },
        "assembly": {
          "v": 1,
          "method": "restriction-cloning",
          "methodVersion": "1.0.0",
          "release": "f1.e1.p1",
          "host": "dam-dcm",
          "topology": "circular",
          "productSha256": "362bc5695412e7cac9774bcaca765ce1296701cd900cba0f1d5c831824e436d9",
          "inputs": [
            {
              "name": "vector",
              "role": "vector",
              "sequence": "GAATTCGGGAAGCTTTTTTTTTTTT",
              "circular": true,
              "sha256": "6d97aebff6eb9531ac1a530a6ad79be087377035135007907f579b5e699bbb56",
              "ref": "mine:construct/parent-1"
            },
            {
              "name": "insert",
              "role": "insert",
              "sequence": "AGAATTCCCCATGCCCAAGCTTA",
              "circular": false,
              "sha256": "8774cb77ae23ae71fbabd095f8a0c7c80ddbdee10e596e7eddf61331064e3afa",
              "ref": "mine:construct/parent-2"
            }
          ],
          "enzymes": [
            "EcoRI",
            "HindIII"
          ],
          "orientation": 0,
          "products": 1,
          "junctions": [
            {
              "upstream": "5' AATT",
              "downstream": "5' AATT",
              "overhang": "AATT"
            },
            {
              "upstream": "5' AGCT",
              "downstream": "5' AGCT",
              "overhang": "AGCT"
            }
          ],
          "conserved": {
            "coreBases": 22,
            "overhangs": 9,
            "product": 31
          },
          "qualifications": [],
          "designedAt": "2026-10-11T12:00:00.000Z",
          "statement": "A designed product is not evidence that the reaction occurred."
        }
      },
      "independent": {
        "inputBases": 48,
        "junctionBases": 8,
        "productBases": 31,
        "inputCount": 2,
        "junctionCount": 2
      },
      "expected": {
        "readable": false,
        "reason": "junction-accounting"
      }
    },
    {
      "id": "restriction-cloning-missing-junction",
      "input": {
        "v": 1,
        "app": "plasmid-map",
        "residues": "GAATTCCCCATGCCCAAGCTTTTTTTTTTTT",
        "alphabet": "dna-circular",
        "name": "vector + insert (designed)",
        "source": {
          "kind": "assembly",
          "method": "restriction-cloning",
          "from": [
            "vector",
            "insert"
          ]
        },
        "recordFeatures": [],
        "edits": [],
        "meth": "dam-dcm",
        "enz": [],
        "dig": [],
        "insert": null,
        "data": {
          "features": "1",
          "enzymes": "1",
          "primers": "1"
        },
        "assembly": {
          "v": 1,
          "method": "restriction-cloning",
          "methodVersion": "1.0.0",
          "release": "f1.e1.p1",
          "host": "dam-dcm",
          "topology": "circular",
          "productSha256": "362bc5695412e7cac9774bcaca765ce1296701cd900cba0f1d5c831824e436d9",
          "inputs": [
            {
              "name": "vector",
              "role": "vector",
              "sequence": "GAATTCGGGAAGCTTTTTTTTTTTT",
              "circular": true,
              "sha256": "6d97aebff6eb9531ac1a530a6ad79be087377035135007907f579b5e699bbb56",
              "ref": "mine:construct/parent-1"
            },
            {
              "name": "insert",
              "role": "insert",
              "sequence": "AGAATTCCCCATGCCCAAGCTTA",
              "circular": false,
              "sha256": "8774cb77ae23ae71fbabd095f8a0c7c80ddbdee10e596e7eddf61331064e3afa",
              "ref": "mine:construct/parent-2"
            }
          ],
          "enzymes": [
            "EcoRI",
            "HindIII"
          ],
          "orientation": 0,
          "products": 1,
          "junctions": [
            {
              "upstream": "5' AATT",
              "downstream": "5' AATT",
              "overhang": "AATT"
            }
          ],
          "conserved": {
            "coreBases": 23,
            "overhangs": 8,
            "product": 31
          },
          "qualifications": [],
          "designedAt": "2026-10-11T12:00:00.000Z",
          "statement": "A designed product is not evidence that the reaction occurred."
        }
      },
      "independent": {
        "inputBases": 48,
        "junctionBases": 4,
        "productBases": 31,
        "inputCount": 2,
        "junctionCount": 1
      },
      "expected": {
        "readable": false,
        "reason": "junction-count"
      }
    },
    {
      "id": "golden-gate-balanced-false-accounting",
      "input": {
        "v": 1,
        "app": "plasmid-map",
        "residues": "CCCCCCGGGGAGGAATATGCGCATTCCA",
        "alphabet": "dna-circular",
        "name": "Golden Gate designed product",
        "source": {
          "kind": "assembly",
          "method": "golden-gate",
          "from": [
            "destination",
            "insert"
          ]
        },
        "recordFeatures": [],
        "edits": [],
        "meth": "dam-dcm",
        "enz": [],
        "dig": [],
        "insert": null,
        "data": {
          "features": "1",
          "enzymes": "1",
          "primers": "1"
        },
        "assembly": {
          "v": 1,
          "method": "golden-gate",
          "methodVersion": "1.0.0",
          "release": "f1.e1.p1",
          "host": "dam-dcm",
          "topology": "circular",
          "productSha256": "97efce5501dd2dc7cc7049f3decd94fc3281483cb14ca2760e26aeb631ee44b6",
          "inputs": [
            {
              "name": "destination",
              "role": "destination",
              "sequence": "CCCCCCGGGGAGGAAGAGACGAAAAAACGTCTCTTCCA",
              "circular": true,
              "sha256": "3875614c1bb2874726b7f93f3f7e307da3277dcecc7584e3cada1e4a6a073f7d",
              "ref": "mine:construct/golden-parent-0"
            },
            {
              "name": "insert",
              "role": "part",
              "sequence": "AACGTCTCTAGGAATATGCGCATTCCAAGAGACGAA",
              "circular": false,
              "sha256": "fcf75bec685c96b96ef23c740edf7c76ebcc384294af94535f632088721ba0a8",
              "ref": "mine:construct/golden-parent-1"
            }
          ],
          "enzymes": [
            "BsmBI"
          ],
          "orientation": 0,
          "products": 1,
          "junctions": [
            {
              "upstream": "5' TCCT",
              "downstream": "5' AGGA",
              "overhang": "TCCT"
            },
            {
              "upstream": "5' TGGA",
              "downstream": "5' TCCA",
              "overhang": "TGGA"
            }
          ],
          "conserved": {
            "coreBases": 19,
            "overhangs": 9,
            "product": 28
          },
          "qualifications": [],
          "designedAt": "2026-10-11T12:00:00.000Z",
          "statement": "A designed product is not evidence that the reaction occurred."
        }
      },
      "independent": {
        "inputBases": 74,
        "junctionBases": 8,
        "productBases": 28,
        "inputCount": 2,
        "junctionCount": 2
      },
      "expected": {
        "readable": false,
        "reason": "junction-accounting"
      }
    },
    {
      "id": "golden-gate-missing-junction",
      "input": {
        "v": 1,
        "app": "plasmid-map",
        "residues": "CCCCCCGGGGAGGAATATGCGCATTCCA",
        "alphabet": "dna-circular",
        "name": "Golden Gate designed product",
        "source": {
          "kind": "assembly",
          "method": "golden-gate",
          "from": [
            "destination",
            "insert"
          ]
        },
        "recordFeatures": [],
        "edits": [],
        "meth": "dam-dcm",
        "enz": [],
        "dig": [],
        "insert": null,
        "data": {
          "features": "1",
          "enzymes": "1",
          "primers": "1"
        },
        "assembly": {
          "v": 1,
          "method": "golden-gate",
          "methodVersion": "1.0.0",
          "release": "f1.e1.p1",
          "host": "dam-dcm",
          "topology": "circular",
          "productSha256": "97efce5501dd2dc7cc7049f3decd94fc3281483cb14ca2760e26aeb631ee44b6",
          "inputs": [
            {
              "name": "destination",
              "role": "destination",
              "sequence": "CCCCCCGGGGAGGAAGAGACGAAAAAACGTCTCTTCCA",
              "circular": true,
              "sha256": "3875614c1bb2874726b7f93f3f7e307da3277dcecc7584e3cada1e4a6a073f7d",
              "ref": "mine:construct/golden-parent-0"
            },
            {
              "name": "insert",
              "role": "part",
              "sequence": "AACGTCTCTAGGAATATGCGCATTCCAAGAGACGAA",
              "circular": false,
              "sha256": "fcf75bec685c96b96ef23c740edf7c76ebcc384294af94535f632088721ba0a8",
              "ref": "mine:construct/golden-parent-1"
            }
          ],
          "enzymes": [
            "BsmBI"
          ],
          "orientation": 0,
          "products": 1,
          "junctions": [
            {
              "upstream": "5' TCCT",
              "downstream": "5' AGGA",
              "overhang": "TCCT"
            }
          ],
          "conserved": {
            "coreBases": 20,
            "overhangs": 8,
            "product": 28
          },
          "qualifications": [],
          "designedAt": "2026-10-11T12:00:00.000Z",
          "statement": "A designed product is not evidence that the reaction occurred."
        }
      },
      "independent": {
        "inputBases": 74,
        "junctionBases": 4,
        "productBases": 28,
        "inputCount": 2,
        "junctionCount": 1
      },
      "expected": {
        "readable": false,
        "reason": "junction-count"
      }
    },
    {
      "id": "restriction-wrong-parent-roles",
      "input": {
        "v": 1,
        "app": "plasmid-map",
        "residues": "GAATTCCCCATGCCCAAGCTTTTTTTTTTTT",
        "alphabet": "dna-circular",
        "name": "vector + insert (designed)",
        "source": {
          "kind": "assembly",
          "method": "restriction-cloning",
          "from": [
            "vector",
            "insert"
          ]
        },
        "recordFeatures": [],
        "edits": [],
        "meth": "dam-dcm",
        "enz": [],
        "dig": [],
        "insert": null,
        "data": {
          "features": "1",
          "enzymes": "1",
          "primers": "1"
        },
        "assembly": {
          "v": 1,
          "method": "restriction-cloning",
          "methodVersion": "1.0.0",
          "release": "f1.e1.p1",
          "host": "dam-dcm",
          "topology": "circular",
          "productSha256": "362bc5695412e7cac9774bcaca765ce1296701cd900cba0f1d5c831824e436d9",
          "inputs": [
            {
              "name": "vector",
              "role": "part",
              "sequence": "GAATTCGGGAAGCTTTTTTTTTTTT",
              "circular": true,
              "sha256": "6d97aebff6eb9531ac1a530a6ad79be087377035135007907f579b5e699bbb56",
              "ref": "mine:construct/parent-1"
            },
            {
              "name": "insert",
              "role": "insert",
              "sequence": "AGAATTCCCCATGCCCAAGCTTA",
              "circular": false,
              "sha256": "8774cb77ae23ae71fbabd095f8a0c7c80ddbdee10e596e7eddf61331064e3afa",
              "ref": "mine:construct/parent-2"
            }
          ],
          "enzymes": [
            "EcoRI",
            "HindIII"
          ],
          "orientation": 0,
          "products": 1,
          "junctions": [
            {
              "upstream": "5' AATT",
              "downstream": "5' AATT",
              "overhang": "AATT"
            },
            {
              "upstream": "5' AGCT",
              "downstream": "5' AGCT",
              "overhang": "AGCT"
            }
          ],
          "conserved": {
            "coreBases": 23,
            "overhangs": 8,
            "product": 31
          },
          "qualifications": [],
          "designedAt": "2026-10-11T12:00:00.000Z",
          "statement": "A designed product is not evidence that the reaction occurred."
        }
      },
      "independent": {
        "inputBases": 48,
        "junctionBases": 8,
        "productBases": 31,
        "inputCount": 2,
        "junctionCount": 2
      },
      "expected": {
        "readable": false,
        "reason": "parent-roles"
      }
    },
    {
      "id": "restriction-third-parent",
      "input": {
        "v": 1,
        "app": "plasmid-map",
        "residues": "GAATTCCCCATGCCCAAGCTTTTTTTTTTTT",
        "alphabet": "dna-circular",
        "name": "vector + insert (designed)",
        "source": {
          "kind": "assembly",
          "method": "restriction-cloning",
          "from": [
            "vector",
            "insert"
          ]
        },
        "recordFeatures": [],
        "edits": [],
        "meth": "dam-dcm",
        "enz": [],
        "dig": [],
        "insert": null,
        "data": {
          "features": "1",
          "enzymes": "1",
          "primers": "1"
        },
        "assembly": {
          "v": 1,
          "method": "restriction-cloning",
          "methodVersion": "1.0.0",
          "release": "f1.e1.p1",
          "host": "dam-dcm",
          "topology": "circular",
          "productSha256": "362bc5695412e7cac9774bcaca765ce1296701cd900cba0f1d5c831824e436d9",
          "inputs": [
            {
              "name": "vector",
              "role": "vector",
              "sequence": "GAATTCGGGAAGCTTTTTTTTTTTT",
              "circular": true,
              "sha256": "6d97aebff6eb9531ac1a530a6ad79be087377035135007907f579b5e699bbb56",
              "ref": "mine:construct/parent-1"
            },
            {
              "name": "insert",
              "role": "insert",
              "sequence": "AGAATTCCCCATGCCCAAGCTTA",
              "circular": false,
              "sha256": "8774cb77ae23ae71fbabd095f8a0c7c80ddbdee10e596e7eddf61331064e3afa",
              "ref": "mine:construct/parent-2"
            },
            {
              "name": "insert",
              "role": "insert",
              "sequence": "AGAATTCCCCATGCCCAAGCTTA",
              "circular": false,
              "sha256": "8774cb77ae23ae71fbabd095f8a0c7c80ddbdee10e596e7eddf61331064e3afa",
              "ref": "mine:construct/parent-2"
            }
          ],
          "enzymes": [
            "EcoRI",
            "HindIII"
          ],
          "orientation": 0,
          "products": 1,
          "junctions": [
            {
              "upstream": "5' AATT",
              "downstream": "5' AATT",
              "overhang": "AATT"
            },
            {
              "upstream": "5' AGCT",
              "downstream": "5' AGCT",
              "overhang": "AGCT"
            }
          ],
          "conserved": {
            "coreBases": 23,
            "overhangs": 8,
            "product": 31
          },
          "qualifications": [],
          "designedAt": "2026-10-11T12:00:00.000Z",
          "statement": "A designed product is not evidence that the reaction occurred."
        }
      },
      "independent": {
        "inputBases": 71,
        "junctionBases": 8,
        "productBases": 31,
        "inputCount": 3,
        "junctionCount": 2
      },
      "expected": {
        "readable": false,
        "reason": "parent-count"
      }
    },
    {
      "id": "golden-wrong-destination-role",
      "input": {
        "v": 1,
        "app": "plasmid-map",
        "residues": "CCCCCCGGGGAGGAATATGCGCATTCCA",
        "alphabet": "dna-circular",
        "name": "Golden Gate designed product",
        "source": {
          "kind": "assembly",
          "method": "golden-gate",
          "from": [
            "destination",
            "insert"
          ]
        },
        "recordFeatures": [],
        "edits": [],
        "meth": "dam-dcm",
        "enz": [],
        "dig": [],
        "insert": null,
        "data": {
          "features": "1",
          "enzymes": "1",
          "primers": "1"
        },
        "assembly": {
          "v": 1,
          "method": "golden-gate",
          "methodVersion": "1.0.0",
          "release": "f1.e1.p1",
          "host": "dam-dcm",
          "topology": "circular",
          "productSha256": "97efce5501dd2dc7cc7049f3decd94fc3281483cb14ca2760e26aeb631ee44b6",
          "inputs": [
            {
              "name": "destination",
              "role": "vector",
              "sequence": "CCCCCCGGGGAGGAAGAGACGAAAAAACGTCTCTTCCA",
              "circular": true,
              "sha256": "3875614c1bb2874726b7f93f3f7e307da3277dcecc7584e3cada1e4a6a073f7d",
              "ref": "mine:construct/golden-parent-0"
            },
            {
              "name": "insert",
              "role": "part",
              "sequence": "AACGTCTCTAGGAATATGCGCATTCCAAGAGACGAA",
              "circular": false,
              "sha256": "fcf75bec685c96b96ef23c740edf7c76ebcc384294af94535f632088721ba0a8",
              "ref": "mine:construct/golden-parent-1"
            }
          ],
          "enzymes": [
            "BsmBI"
          ],
          "orientation": 0,
          "products": 1,
          "junctions": [
            {
              "upstream": "5' TCCT",
              "downstream": "5' AGGA",
              "overhang": "TCCT"
            },
            {
              "upstream": "5' TGGA",
              "downstream": "5' TCCA",
              "overhang": "TGGA"
            }
          ],
          "conserved": {
            "coreBases": 20,
            "overhangs": 8,
            "product": 28
          },
          "qualifications": [],
          "designedAt": "2026-10-11T12:00:00.000Z",
          "statement": "A designed product is not evidence that the reaction occurred."
        }
      },
      "independent": {
        "inputBases": 74,
        "junctionBases": 8,
        "productBases": 28,
        "inputCount": 2,
        "junctionCount": 2
      },
      "expected": {
        "readable": false,
        "reason": "parent-roles"
      }
    },
    {
      "id": "golden-wrong-part-role",
      "input": {
        "v": 1,
        "app": "plasmid-map",
        "residues": "CCCCCCGGGGAGGAATATGCGCATTCCA",
        "alphabet": "dna-circular",
        "name": "Golden Gate designed product",
        "source": {
          "kind": "assembly",
          "method": "golden-gate",
          "from": [
            "destination",
            "insert"
          ]
        },
        "recordFeatures": [],
        "edits": [],
        "meth": "dam-dcm",
        "enz": [],
        "dig": [],
        "insert": null,
        "data": {
          "features": "1",
          "enzymes": "1",
          "primers": "1"
        },
        "assembly": {
          "v": 1,
          "method": "golden-gate",
          "methodVersion": "1.0.0",
          "release": "f1.e1.p1",
          "host": "dam-dcm",
          "topology": "circular",
          "productSha256": "97efce5501dd2dc7cc7049f3decd94fc3281483cb14ca2760e26aeb631ee44b6",
          "inputs": [
            {
              "name": "destination",
              "role": "destination",
              "sequence": "CCCCCCGGGGAGGAAGAGACGAAAAAACGTCTCTTCCA",
              "circular": true,
              "sha256": "3875614c1bb2874726b7f93f3f7e307da3277dcecc7584e3cada1e4a6a073f7d",
              "ref": "mine:construct/golden-parent-0"
            },
            {
              "name": "insert",
              "role": "fragment",
              "sequence": "AACGTCTCTAGGAATATGCGCATTCCAAGAGACGAA",
              "circular": false,
              "sha256": "fcf75bec685c96b96ef23c740edf7c76ebcc384294af94535f632088721ba0a8",
              "ref": "mine:construct/golden-parent-1"
            }
          ],
          "enzymes": [
            "BsmBI"
          ],
          "orientation": 0,
          "products": 1,
          "junctions": [
            {
              "upstream": "5' TCCT",
              "downstream": "5' AGGA",
              "overhang": "TCCT"
            },
            {
              "upstream": "5' TGGA",
              "downstream": "5' TCCA",
              "overhang": "TGGA"
            }
          ],
          "conserved": {
            "coreBases": 20,
            "overhangs": 8,
            "product": 28
          },
          "qualifications": [],
          "designedAt": "2026-10-11T12:00:00.000Z",
          "statement": "A designed product is not evidence that the reaction occurred."
        }
      },
      "independent": {
        "inputBases": 74,
        "junctionBases": 8,
        "productBases": 28,
        "inputCount": 2,
        "junctionCount": 2
      },
      "expected": {
        "readable": false,
        "reason": "parent-roles"
      }
    },
    {
      "id": "gibson-extra-linear-junction",
      "input": {
        "v": 1,
        "app": "plasmid-map",
        "residues": "GTAACTAGTAATAAAAATTGTAATACTGTGCCAACGACACGCCTTCAGGCCGCCCGATATCGTTACCTCTGCTCATTTTT",
        "alphabet": "dna",
        "name": "left + right (designed)",
        "source": {
          "kind": "assembly",
          "method": "gibson-style",
          "from": [
            "left",
            "right"
          ]
        },
        "recordFeatures": [],
        "edits": [],
        "meth": "dam-dcm",
        "enz": [],
        "dig": [],
        "insert": null,
        "data": {
          "features": "1",
          "enzymes": "1",
          "primers": "1"
        },
        "assembly": {
          "v": 1,
          "method": "gibson-style",
          "methodVersion": "1.0.0",
          "release": "f1.e1.p1",
          "host": "dam-dcm",
          "topology": "linear",
          "productSha256": "87c5e3d5f1f3816940f8d47f96cfeb41c34cf425d94e1d24c2e047f000ff82a2",
          "inputs": [
            {
              "name": "left",
              "role": "fragment",
              "sequence": "GTAACTAGTAATAAAAATTGTAATACTGTGCCAACGACACGCCTTCAGGCCGCCC",
              "circular": false,
              "sha256": "02a2ac6fba5e74b9fa87a6e6aec12b2af58ed2decad1a0d9f937dd3e43909974",
              "ref": "mine:construct/parent-1"
            },
            {
              "name": "right",
              "role": "fragment",
              "sequence": "GCCTTCAGGCCGCCCGATATCGTTACCTCTGCTCATTTTT",
              "circular": false,
              "sha256": "5ce23b282f22960f41f8a928dd690c53fd82495e24f2bf8d92c34da6235d9ba2",
              "ref": "mine:construct/parent-2"
            }
          ],
          "enzymes": [],
          "orientation": 0,
          "products": 1,
          "junctions": [
            {
              "upstream": "left",
              "downstream": "right",
              "overhang": "GCCTTCAGGCCGCCC"
            },
            {
              "upstream": "second",
              "downstream": "first",
              "overhang": ""
            }
          ],
          "conserved": {
            "fragmentBases": 95,
            "overlaps": 15,
            "product": 80
          },
          "qualifications": [],
          "designedAt": "2026-10-11T12:00:00.000Z",
          "statement": "A designed product is not evidence that the reaction occurred."
        }
      },
      "independent": {
        "inputBases": 95,
        "junctionBases": 15,
        "productBases": 80,
        "inputCount": 2,
        "junctionCount": 2
      },
      "expected": {
        "readable": false,
        "reason": "junction-count"
      }
    },
    {
      "id": "gibson-circular-missing-closing-junction",
      "input": {
        "v": 1,
        "app": "plasmid-map",
        "residues": "GTAACTAGTAATAAAAATTGTAATACTGTGCCAACGACACGCCTTCAGGCCGCCCGATATCGTTACCTCTGCTCATTTTT",
        "alphabet": "dna-circular",
        "name": "left + right (designed)",
        "source": {
          "kind": "assembly",
          "method": "gibson-style",
          "from": [
            "left",
            "right"
          ]
        },
        "recordFeatures": [],
        "edits": [],
        "meth": "dam-dcm",
        "enz": [],
        "dig": [],
        "insert": null,
        "data": {
          "features": "1",
          "enzymes": "1",
          "primers": "1"
        },
        "assembly": {
          "v": 1,
          "method": "gibson-style",
          "methodVersion": "1.0.0",
          "release": "f1.e1.p1",
          "host": "dam-dcm",
          "topology": "circular",
          "productSha256": "87c5e3d5f1f3816940f8d47f96cfeb41c34cf425d94e1d24c2e047f000ff82a2",
          "inputs": [
            {
              "name": "left",
              "role": "fragment",
              "sequence": "GTAACTAGTAATAAAAATTGTAATACTGTGCCAACGACACGCCTTCAGGCCGCCC",
              "circular": false,
              "sha256": "02a2ac6fba5e74b9fa87a6e6aec12b2af58ed2decad1a0d9f937dd3e43909974",
              "ref": "mine:construct/parent-1"
            },
            {
              "name": "right",
              "role": "fragment",
              "sequence": "GCCTTCAGGCCGCCCGATATCGTTACCTCTGCTCATTTTT",
              "circular": false,
              "sha256": "5ce23b282f22960f41f8a928dd690c53fd82495e24f2bf8d92c34da6235d9ba2",
              "ref": "mine:construct/parent-2"
            }
          ],
          "enzymes": [],
          "orientation": 0,
          "products": 1,
          "junctions": [
            {
              "upstream": "left",
              "downstream": "right",
              "overhang": "GCCTTCAGGCCGCCC"
            }
          ],
          "conserved": {
            "fragmentBases": 95,
            "overlaps": 15,
            "product": 80
          },
          "qualifications": [],
          "designedAt": "2026-10-11T12:00:00.000Z",
          "statement": "A designed product is not evidence that the reaction occurred."
        }
      },
      "independent": {
        "inputBases": 95,
        "junctionBases": 15,
        "productBases": 80,
        "inputCount": 2,
        "junctionCount": 1
      },
      "expected": {
        "readable": false,
        "reason": "junction-count"
      }
    },
    {
      "id": "gibson-style-multiple-products",
      "input": {
        "v": 1,
        "app": "plasmid-map",
        "residues": "GTAACTAGTAATAAAAATTGTAATACTGTGCCAACGACACGCCTTCAGGCCGCCCGATATCGTTACCTCTGCTCATTTTT",
        "alphabet": "dna",
        "name": "left + right (designed)",
        "source": {
          "kind": "assembly",
          "method": "gibson-style",
          "from": [
            "left",
            "right"
          ]
        },
        "recordFeatures": [],
        "edits": [],
        "meth": "dam-dcm",
        "enz": [],
        "dig": [],
        "insert": null,
        "data": {
          "features": "1",
          "enzymes": "1",
          "primers": "1"
        },
        "assembly": {
          "v": 1,
          "method": "gibson-style",
          "methodVersion": "1.0.0",
          "release": "f1.e1.p1",
          "host": "dam-dcm",
          "topology": "linear",
          "productSha256": "87c5e3d5f1f3816940f8d47f96cfeb41c34cf425d94e1d24c2e047f000ff82a2",
          "inputs": [
            {
              "name": "left",
              "role": "fragment",
              "sequence": "GTAACTAGTAATAAAAATTGTAATACTGTGCCAACGACACGCCTTCAGGCCGCCC",
              "circular": false,
              "sha256": "02a2ac6fba5e74b9fa87a6e6aec12b2af58ed2decad1a0d9f937dd3e43909974",
              "ref": "mine:construct/parent-1"
            },
            {
              "name": "right",
              "role": "fragment",
              "sequence": "GCCTTCAGGCCGCCCGATATCGTTACCTCTGCTCATTTTT",
              "circular": false,
              "sha256": "5ce23b282f22960f41f8a928dd690c53fd82495e24f2bf8d92c34da6235d9ba2",
              "ref": "mine:construct/parent-2"
            }
          ],
          "enzymes": [],
          "orientation": 0,
          "products": 2,
          "junctions": [
            {
              "upstream": "left",
              "downstream": "right",
              "overhang": "GCCTTCAGGCCGCCC"
            }
          ],
          "conserved": {
            "fragmentBases": 95,
            "overlaps": 15,
            "product": 80
          },
          "qualifications": [],
          "designedAt": "2026-10-11T12:00:00.000Z",
          "statement": "A designed product is not evidence that the reaction occurred."
        }
      },
      "independent": {
        "inputBases": 95,
        "junctionBases": 15,
        "productBases": 80,
        "inputCount": 2,
        "junctionCount": 1
      },
      "expected": {
        "readable": false,
        "reason": "single-product"
      }
    },
    {
      "id": "gibson-style-second-orientation",
      "input": {
        "v": 1,
        "app": "plasmid-map",
        "residues": "GTAACTAGTAATAAAAATTGTAATACTGTGCCAACGACACGCCTTCAGGCCGCCCGATATCGTTACCTCTGCTCATTTTT",
        "alphabet": "dna",
        "name": "left + right (designed)",
        "source": {
          "kind": "assembly",
          "method": "gibson-style",
          "from": [
            "left",
            "right"
          ]
        },
        "recordFeatures": [],
        "edits": [],
        "meth": "dam-dcm",
        "enz": [],
        "dig": [],
        "insert": null,
        "data": {
          "features": "1",
          "enzymes": "1",
          "primers": "1"
        },
        "assembly": {
          "v": 1,
          "method": "gibson-style",
          "methodVersion": "1.0.0",
          "release": "f1.e1.p1",
          "host": "dam-dcm",
          "topology": "linear",
          "productSha256": "87c5e3d5f1f3816940f8d47f96cfeb41c34cf425d94e1d24c2e047f000ff82a2",
          "inputs": [
            {
              "name": "left",
              "role": "fragment",
              "sequence": "GTAACTAGTAATAAAAATTGTAATACTGTGCCAACGACACGCCTTCAGGCCGCCC",
              "circular": false,
              "sha256": "02a2ac6fba5e74b9fa87a6e6aec12b2af58ed2decad1a0d9f937dd3e43909974",
              "ref": "mine:construct/parent-1"
            },
            {
              "name": "right",
              "role": "fragment",
              "sequence": "GCCTTCAGGCCGCCCGATATCGTTACCTCTGCTCATTTTT",
              "circular": false,
              "sha256": "5ce23b282f22960f41f8a928dd690c53fd82495e24f2bf8d92c34da6235d9ba2",
              "ref": "mine:construct/parent-2"
            }
          ],
          "enzymes": [],
          "orientation": 1,
          "products": 2,
          "junctions": [
            {
              "upstream": "left",
              "downstream": "right",
              "overhang": "GCCTTCAGGCCGCCC"
            }
          ],
          "conserved": {
            "fragmentBases": 95,
            "overlaps": 15,
            "product": 80
          },
          "qualifications": [],
          "designedAt": "2026-10-11T12:00:00.000Z",
          "statement": "A designed product is not evidence that the reaction occurred."
        }
      },
      "independent": {
        "inputBases": 95,
        "junctionBases": 15,
        "productBases": 80,
        "inputCount": 2,
        "junctionCount": 1
      },
      "expected": {
        "readable": false,
        "reason": "single-product"
      }
    },
    {
      "id": "golden-gate-multiple-products",
      "input": {
        "v": 1,
        "app": "plasmid-map",
        "residues": "CCCCCCGGGGAGGAATATGCGCATTCCA",
        "alphabet": "dna-circular",
        "name": "Golden Gate designed product",
        "source": {
          "kind": "assembly",
          "method": "golden-gate",
          "from": [
            "destination",
            "insert"
          ]
        },
        "recordFeatures": [],
        "edits": [],
        "meth": "dam-dcm",
        "enz": [],
        "dig": [],
        "insert": null,
        "data": {
          "features": "1",
          "enzymes": "1",
          "primers": "1"
        },
        "assembly": {
          "v": 1,
          "method": "golden-gate",
          "methodVersion": "1.0.0",
          "release": "f1.e1.p1",
          "host": "dam-dcm",
          "topology": "circular",
          "productSha256": "97efce5501dd2dc7cc7049f3decd94fc3281483cb14ca2760e26aeb631ee44b6",
          "inputs": [
            {
              "name": "destination",
              "role": "destination",
              "sequence": "CCCCCCGGGGAGGAAGAGACGAAAAAACGTCTCTTCCA",
              "circular": true,
              "sha256": "3875614c1bb2874726b7f93f3f7e307da3277dcecc7584e3cada1e4a6a073f7d",
              "ref": "mine:construct/golden-parent-0"
            },
            {
              "name": "insert",
              "role": "part",
              "sequence": "AACGTCTCTAGGAATATGCGCATTCCAAGAGACGAA",
              "circular": false,
              "sha256": "fcf75bec685c96b96ef23c740edf7c76ebcc384294af94535f632088721ba0a8",
              "ref": "mine:construct/golden-parent-1"
            }
          ],
          "enzymes": [
            "BsmBI"
          ],
          "orientation": 0,
          "products": 2,
          "junctions": [
            {
              "upstream": "5' TCCT",
              "downstream": "5' AGGA",
              "overhang": "TCCT"
            },
            {
              "upstream": "5' TGGA",
              "downstream": "5' TCCA",
              "overhang": "TGGA"
            }
          ],
          "conserved": {
            "coreBases": 20,
            "overhangs": 8,
            "product": 28
          },
          "qualifications": [],
          "designedAt": "2026-10-11T12:00:00.000Z",
          "statement": "A designed product is not evidence that the reaction occurred."
        }
      },
      "independent": {
        "inputBases": 74,
        "junctionBases": 8,
        "productBases": 28,
        "inputCount": 2,
        "junctionCount": 2
      },
      "expected": {
        "readable": false,
        "reason": "single-product"
      }
    },
    {
      "id": "golden-gate-second-orientation",
      "input": {
        "v": 1,
        "app": "plasmid-map",
        "residues": "CCCCCCGGGGAGGAATATGCGCATTCCA",
        "alphabet": "dna-circular",
        "name": "Golden Gate designed product",
        "source": {
          "kind": "assembly",
          "method": "golden-gate",
          "from": [
            "destination",
            "insert"
          ]
        },
        "recordFeatures": [],
        "edits": [],
        "meth": "dam-dcm",
        "enz": [],
        "dig": [],
        "insert": null,
        "data": {
          "features": "1",
          "enzymes": "1",
          "primers": "1"
        },
        "assembly": {
          "v": 1,
          "method": "golden-gate",
          "methodVersion": "1.0.0",
          "release": "f1.e1.p1",
          "host": "dam-dcm",
          "topology": "circular",
          "productSha256": "97efce5501dd2dc7cc7049f3decd94fc3281483cb14ca2760e26aeb631ee44b6",
          "inputs": [
            {
              "name": "destination",
              "role": "destination",
              "sequence": "CCCCCCGGGGAGGAAGAGACGAAAAAACGTCTCTTCCA",
              "circular": true,
              "sha256": "3875614c1bb2874726b7f93f3f7e307da3277dcecc7584e3cada1e4a6a073f7d",
              "ref": "mine:construct/golden-parent-0"
            },
            {
              "name": "insert",
              "role": "part",
              "sequence": "AACGTCTCTAGGAATATGCGCATTCCAAGAGACGAA",
              "circular": false,
              "sha256": "fcf75bec685c96b96ef23c740edf7c76ebcc384294af94535f632088721ba0a8",
              "ref": "mine:construct/golden-parent-1"
            }
          ],
          "enzymes": [
            "BsmBI"
          ],
          "orientation": 1,
          "products": 2,
          "junctions": [
            {
              "upstream": "5' TCCT",
              "downstream": "5' AGGA",
              "overhang": "TCCT"
            },
            {
              "upstream": "5' TGGA",
              "downstream": "5' TCCA",
              "overhang": "TGGA"
            }
          ],
          "conserved": {
            "coreBases": 20,
            "overhangs": 8,
            "product": 28
          },
          "qualifications": [],
          "designedAt": "2026-10-11T12:00:00.000Z",
          "statement": "A designed product is not evidence that the reaction occurred."
        }
      },
      "independent": {
        "inputBases": 74,
        "junctionBases": 8,
        "productBases": 28,
        "inputCount": 2,
        "junctionCount": 2
      },
      "expected": {
        "readable": false,
        "reason": "single-product"
      }
    }
  ]
}